... Bản 19 96 , ĐH Chalmer –Goteborg - Thụy điển 19 97 • Kỹ sư hàng hải – ĐH Hàng hải - 19 94 + Kinh nghiệm làm việc : • 19 94 - 19 98 : Cục hàng hải Việt Nam, Ban quản lý DA đường thuỷ -Bộ GTVT • 19 99 -2000 ... (Cont.) • Business administration model : production management, marketing and sale management, maintenance operation management operational cost of project in operational phase • Other issues ... Project Manager and leave all the rest to him - Project manager will select and manage the project team including many kind of experts : legal, market, technical, finance, sale, operation, etc 18 Who...
Ngày tải lên: 14/03/2014, 19:20
... TGCGTCGACATTTGCCGCAATAGTGTCAACA; and rnc3¢I comp, TGAACCCCATCATCCACTGCCAG GTCAGCG The deletion was constructed in CVR69L and JB 69 to generate CVR69LDrnc and JB69Drnc, respectively (Table 1) A pTrc9 9A vector was ... for cloning and overexpression of era, encoding the GTPase Era The primers used were as follows: era_F_NcoI, CGACCATGGCGAAC AGGCGTTGAAAAAAC; and era_R_SalI, CGAGTCGA CAGCCTTCCATCGGAGTTACT The resulting ... traces) Finally, when traces of the rnc lesion strain (JB69Drnc) were examined, it was apparent that there FEBS Journal 278 (2 011 ) 17 45 17 56 ª 2 011 The Authors Journal compilation ª 2 011 FEBS 17 49...
Ngày tải lên: 06/03/2014, 00:21
Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx
... 87SufI-BamHI-rv (5¢-ACGCGGATCCAACATCGTCGC CCTTCCA-3¢, BamHI site underlined) and SufIHAXbaI+ClaI-rv (5¢-ACTGATCGATCTAGATTACGCAT AGTCAGGAACATCGTATGGGTAGCCGCCTGGCG GTACCGGATTGACCAAC-3¢, ClaI site ... MC 410 0Dtig::CmrD dnaKdnaJ::Kanr thr::Tn10 MC 410 0DtatA/E MC 410 0DtatADtatE MC 410 0DtatB MC 410 0DtatB MC 410 0DtatC MC 410 0DtatC::XSpecr HDB37 MC 410 0araD pC4Meth -10 0TorA/ pC4Meth, 94 torA/ P2TAG13 P2TAG13 pC4Meth -10 0TorA/ ... RRTorA-SacI-fw (5¢-GCGCGGAGCTCAAGAAGGA AGAAAAATAATGAAC-3¢, SacI site underlined) and TorA/Lep2-BamHI-rv (5¢-GCATGGATCCCGCGCGC TTGATGTAATC-3¢, BamHI site underlined) The resulting PCR fragment was cloned into...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Syndecan-4 is a signaling molecule for stromal cell-derived factor-1 (SDF-1)/ CXCL12 pptx
... RNA) SD -1 (SD-4 ds RNA) IgGl (mocktransfected) 0 10 10 1 10 2 10 3 10 0 SD -1 (mocktransfected) 10 1 10 2 10 3 10 4 E D 32 0 10 10 1 10 2 10 3 10 4 Fig SD-4 is involved in SDF -1 activation of MAPK pathways ... Glycan and glycosaminoglycan binding properties of stromal cell-derived factor (SDF) -1alpha Glycobiology 10 , 21 29 34 Valenzuela-Fernandez A, Palanche T, Amara A, Magerus A, Altmeyer R, Delaunay ... internalization in human hepatoma cell line HepG2 Cell Signal 13 , 311 – 3 19 Vila-Coro AJ, Rodriguez-Frade JM, Martin De Ana A, Moreno-Ortiz MC, Martinez AC & Mellado M ( 19 99 ) The chemokine SDF-1a...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Ets-1/ Elk-1 is a critical mediator of dipeptidyl-peptidase III transcription in human glioblastoma cells pdf
... Luc +5 pAAS–5 12 4 Luc +5 pAAS–4 –230 Luc +5 pAAS–3 –485 Luc +5 –7 81 pAAS–2 10 33 pAAS 1 +5 Luc 600 500 Luc * 400 – 21 x 390 .93 pAAS 9 12 4 * Luc x 418 . 59 +5 500 a 800 700 pAAS–5 12 4 600 90 0 Luc ... 5¢-CCCCTCGAGCCGTC CAGACCTGTAAAAG-3¢ ()7 81 ⁄ +5; pAAS-2), DPP-III F- 490 : 5¢-CACCTCGAGCTTTGCAACTTCCAAG-3¢ ()485 ⁄ +5; pAAS-3), DPP-III F -12 9: 5¢-CGACTCGAGAAG CTCGTCTTGG-3¢ ( )12 4 ⁄ +5; pAAS-5), DPP-III ... acetyl-lleucyl-l-argininal, inhibitor of dipeptidyl aminopeptidase III by bacteria J Antibiot (Tokyo) 37, 680–6 81 Hazato T, Inagaki-Shimamura M, Katayama T & Yamamoto T ( 19 82) Separation and characterization of a...
Ngày tải lên: 29/03/2014, 09:20
Báo cáo khoa học: Adeno-associated virus gene transfer in Morquio A disease – effect of promoters and sulfatase-modifying factor 1 pot
... were transduced with · 10 10 vg of CMV– GALNS, AAT–GALNS or EF1–GALNS, and harvested 2, 4, and 10 days post-transduction All assays were carried out in duplicate Total DNA and RNA were isolated ... GALNS and SUMF1 in a : ratio gave 2.4-fold, 1. 5-fold and 1. 5-fold increases in cells cotransduced with CMV–GALNS (28. 31 ± 1. 52 UÆmg )1, P = 0.006), AAT–GALNS (28 . 19 ± 1. 74 UÆmg )1, P = 0. 012 ) and ... ´ C J Almeciga-Dıaz et al Although bone marrow transplantation improves many aspects of the somatic manifestations, it has a limited impact on cardiac, eye and skeletal abnormalities, in addition...
Ngày tải lên: 29/03/2014, 21:20
Báo cáo hóa học: " MMP-1 is a (pre-)invasive factor in Barrettassociated esophageal adenocarcinomas and is associated with positive lymph node status" doc
... 21) :3865-3872 Tanioka Y, Yoshida T, Yagawa T, Saiki Y, Takeo S, Harada T, Okazawa T, Yanai H, Okita K: Matrix metalloproteinase-7 and matrix metalloproteinase -9 are associated with unfavourable prognosis ... Translational Medicine 2 010 , 8 :99 http://www.translational-medicine.com/content/8 /1/ 99 Page of 11 Table Univariate analysis of prognostic factors of the patients (n = 60) Variable Unfavorable factor ... expression and allelic alteration in esophageal carcinoma J Gastroenterol Hepatol 2007, 22 (12 ):2303-23 09 35 Okazaki I, Wada N, Nakano M, Saito A, Takasaki K, Doi M, Kameyama K, Otani Y, Kubochi...
Ngày tải lên: 18/06/2014, 16:20
báo cáo hóa học:" Sphingosine-1 phosphate receptor (S1p1), a critical receptor controlling human lymphocyte trafficking, is expressed in hen and human ovaries and ovarian tumors" ppt
... software (Bio-Rad, Hercules, CA) Because there are currently no commercially available antibodies against avian S1P1, we used a commercially available polyclonal antibody against human S1P1 for Western ... were S1P1+ (Figure 3E, insert) Hen ovarian tumors had varied S1P1 staining (Figure 4) A mucinous ovarian tumor had S1P1 staining associated Bradaric et al Journal of Ovarian Research 2 011 , 4:4 ... sonography: a step toward early diagnosis in humans? J Ultrasound Med 2007, 26 :90 9- 91 9 16 Barua A, Edassery SL, Bitterman P, Abramowicz JS, Dirks AL, Bahr JM, et al: Prevalence of antitumor antibodies...
Ngày tải lên: 20/06/2014, 07:20
Báo cáo y học: "High mobility group box-1 protein as a tumor necrosis factor-independent therapeutic target in rheumatoid arthritis." ppsx
... necrosis factor α monoclonal antibody) versus placebo in rheumatoid arthritis patients receiving concomitant Methotrexate: a randomized phase III trial Lancet 19 99 , 354 : 19 32 - 19 39 Lipsky PE, van der ... J, Andersson U, Molina PE, Abumrad NN, Sama A, Tracey KJ: HMG -1 as a late mediator of endotoxin lethality in mice Science 19 99 , 285:248-2 51 10 Goldstein RS, Bruchfeld A, Yang L, Qureshi AR, GallowitschPuerta ... Taniguchi N, Kawahara K, Yone K, Hashiguchi T, Yamakuchi M, Goto M, Inoue K, Yamada S, Ijiri K, Matsunaga S, Nakajima T, Komiya S, Maruyama I: High mobility group box chromosomal protein plays a role...
Ngày tải lên: 09/08/2014, 10:23
báo cáo khoa học: " Comparison of Radioimmuno and Carbon Nanotube Field-Effect Transistor Assays for Measuring Insulin-Like Growth Factor-1 in a Preclinical Model of Human Breast Cancer" doc
... a pattern of progressive adenocarcinoma with similar genetic changes and pathophysiology as seen in human breast cancers associated with BRCA1-mutations [11 ,12 ] Additionally, as in human BRCA1-associated ... Foulkes WD: BRCA1 and BRCA2: 19 94 and beyond Nat Rev Cancer 2004, 4:665-676 Casey G: The BRCA1 and BRCA2 breast cancer genes Curr Opin Oncol 19 97 , 9: 88 -93 10 Xu X, Wagner KU, Larson D, Weaver Z, Li ... Ultrasensitive carbon nanotube-based biosensors using antibody-binding fragments Anal Biochem 2008, 3 81: 193 - 19 8 21 Maehashi K, Matsumoto K, Takamura Y, Tamiya E: Aptamer-Based LabelFree Immunosensors...
Ngày tải lên: 11/08/2014, 00:23
Báo cáo y học: "Gender-based reciprocal expression of transforming growth factor-β1 and the inducible nitric oxide synthase in a rat model of cyclophosphamide-induced cystitis" ppsx
... levels of active and latent/total TGF- 1 at baseline and after CYP Urine levels of active and latent/total TGF- 1 at baseline and after CYP Active and latent/total TGF- 1 values are reported as pg/mg ... Rosenblum LA: Transforming growth factor- beta and cortisol in differentially reared primates Brain Behav Immun 2002, 16 :14 0 -14 9 Ewan KB, Shyamala G, Ravani SA, Tang Y, Akhurst R, Wakefield L, Barcellos-Hoff ... MH: Latent transforming growth factor- beta activation in mammary gland: regulation by ovarian hormones affects ductal and alveolar proliferation Am J Pathol 2002, 16 0:20 81- 2 093 Casslen B, Sandberg...
Ngày tải lên: 11/08/2014, 08:22
Báo cáo y học: "Association of the T allele of an intronic single nucleotide polymorphism in the colony stimulating factor 1 receptor with Crohn''''s disease: a case-control study" ppt
... Acadian African-American Caucasian Hispanic Jewish Unknown Total 36 (84%) (57%) 32 ( 91 % ) (87%) (10 0%) 12 (10 0%) 94 (16 %) (43%) (9% ) (13 %) (0%) (0%) 14 43 35 12 10 8 Acadian Non-Acadian Total 10 (53%) ... 36:4 71- 5 Tokuhiro S, Yamada R, Chang X, Suzuki A, Kochi Y, Sawada T, Suzuki M, Nagasaki M, Ohtsuki M, Ono M, Furukawa H, Nagashima M, Yoshino S, Mabuchi A, Sekine A, Saito S, Takahashi A, Tsunoda ... disease-like pathogenesis and lethality: a critical role of STAT3 in innate immunity Proc Natl Acad Sci U S A 2003, 10 0 :18 79- 84 Takeda K, Clausen BE, Kaisho T, Tsujimura T, Terada N, Forster I, Akira S:...
Ngày tải lên: 11/08/2014, 10:23
Báo cáo y học: "Hypoxia-inducible factor-1 a/platelet derived growth factor axis in HIV-associated pulmonary vascular remodeling" pps
... 17 4(4):437-445 Mermis et al Respiratory Research 2 011 , 12 :10 3 http://respiratory-research.com/content /12 /1/ 103 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 Kanmogne GD, Primeaux ... hypertensive rats Am J Hypertens 19 97 , 10 (10 Pt 1) :11 17 -11 24 Ghofrani HA, Seeger W, Grimminger F: Imatinib for the treatment of pulmonary arterial hypertension N Engl J Med 2005, 353 (13 ) :14 12 -14 13 Patterson ... described [16 ] with primary antibodies including a- SMA, factor VIII, from Dako Corporation (Carpentaria, CA, USA), HIF- 1a, from Santa Cruz Biotechnology, Inc (Santa Cruz, CA) and PDGF-BB, from Abcam,...
Ngày tải lên: 12/08/2014, 13:22
Suitability of insulin like growth factor 1 (IGF1) as a measure of relative growth rates in lingcod
... population dynamics via size-dependent fecundity (Werner and Gilliam 19 84; Roff 19 92 ) because larger individuals produce greater numbers of eggs and larvae (Morita et al 19 99 ; Osborne et al 19 99 ) ... 0 .95 F 1, = 30.38 F 1, = 9. 36 F 1, = 6.86 0.0 01 0.0 01 0.006 0.0 01 F 1, = 5. 49 F 1, = 0.02 F 1, = 2 .18 F 1, = 2.22 F 1, 34 = 2 .93 F 1, = 1. 61 F 1, 34 = 2.78 F 1, = 2. 71 14.74 11 .65 15 .35 4 .17 39. 64 ... Journal of Marine Science 21: 211 – 216 Pannella, G 19 71 Fish otoliths: daily growth layers and periodical patterns Science (Washington, D.C.) 17 3 :11 24 11 27 Perez-Sanchez, J., H Marti-Palanca, and...
Ngày tải lên: 04/09/2015, 17:15
The discursive construction of identity in chinese english bilingual advertising a critical inquiry 1
... fundamental principle of Critical Discourse Analysis (henceforth CDA) (e.g., Fairclough 19 89, 19 92 , 2003; Chouliaraki & Fairclough 19 99 ; van Dijk 19 93 , 19 98 , 200 6a) that discourses constitutive of various ... linguistic-semiotic meaning (Blommaert 2005; Slembrouck 19 95 ) and with the politics of CDA practitioners’ interpretation (Schegloff 19 97 ; Slembrouck 20 01; Widdowson 19 95 , 19 98 ) Importance of CDA, as Iedema asserts, ... motivation underpinning bilingual practices (e.g., Bell 19 84; Bhatia 19 92 ; Bhatia & Ritchie 2004; Myers-Scotton 19 88; van Meurs et al 2007) The last but perhaps most significant reason is largely...
Ngày tải lên: 11/09/2015, 09:56
Environmental performance and sustainable architecture a critical review in the context of singapore public housing 1
... effects have also been acknowledged as an inevitable factor (Dorf, 20 01) Similarly, the techno-centric approach has many contributions as an initiating and radical approach, but also has drawbacks ... (Kellert, 19 99 ) 2.4.2 Quantitative approach The practice of building environmental performance concentrates on quantifiable environmental factors and it lacks qualitative aspects This has raised a number ... understanding, and form an integrated framework for sustainable housing design and discourse 13 1. 5 1. 5 .1 Research approach, objectives and scope Research approach The above literature analysis has...
Ngày tải lên: 16/09/2015, 08:29
It’s a mobile world 9+1 learnings to build a path to success
... Great Results Digital Strategy & Advisory Consumer Behavior Analysis Content Marketing Reputation Management 30 Countries 13 2 Beloved Brands Our Expertise After 10 Years Technology FMCG Transportation ... KNOW EACH OTHER I BELIEVE IN THE GOD OF DATA AND MARKETING :-) hello! XPLAIN.co The Digital Marketing Auditors and Advisors XPLAIN.co We Transform Brands’ Poor Digital Performance ... IMPORTANT STATS because you don't need to know more! Sources: Ancom, Nielsen, Ipsos, Google, F acebook, XPLAIN, Monetate, Kantar - 2 014 11 3 ,9% MOBILE PENETRATION Romania 3RD...
Ngày tải lên: 30/11/2015, 10:41
Báo cáo y học: "Do we need a critical care ultrasound certification program? Implications from an Australian medical-legal perspective"
... Curtin [ 19 97 ] NSWCA 15 2 O’Shea v Sullivan ( 19 94 ) ATPR (Digest) 46 -12 4 doi :10 .11 86/cc 896 8 Cite this article as: Huang SJ, McLean AS: Do we need a critical care ultrasound certification program? Implications ... Cole [ 19 93 ] Med L R 393 Tran v Lam [ 19 97 ] NSWSC, unreported decision, BC 95 055 41 Thake v Maurice [ 19 86] QB 644 Stacey v Chiddy [ 19 93 ] NSWSC 2 51 Walton-Taylor v Wilson [ 19 98 ] NSWCA 253 Holliday v ... Maurice [ 19 86] QB 644 Donoghue v Stevenson [ 19 32] AC 562 Page of 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Rogers v Whitaker ( 19 92 ) 17 5 CLR 4 79 Rosenberg v Percival (20 01) 205 CLR...
Ngày tải lên: 25/10/2012, 10:02
Bạn có muốn tìm thêm với từ khóa: