9 principles of definitive care

... College of Surgeons of England along with a medical scientist with an international reputation in the field of ballistic science The US editor is professor and chairman of the Department of Surgery ... Division of Traumatology and Surgical Critical Care, Department of Surgery, University of Pennsylvania School of Medicine, Philadelphia, PA, USA Mark Byers, MBBS, MSc, MCEM, MFSEM, MRCGP Ministry of ... Care, Hospital of the University of Pennsylvania, Philadelphia, PA, USA Toney W Baskin, MD, BS Trauma and Critical Care Service,   Brooke Army Medical Center,   United States Army Institute of...

Ngày tải lên: 29/06/2014, 09:20

... critical care outreach team (CCOT), but during the event all of the intensive care patients were accommodated within the physical space of the ICU All of these patients required ongoing critical care ... emphasis on the impact of this phase of care Page of (page number not for citation purposes) from the ICU point of view or, in fact, on what is now termed ‘the prolonged -care phase’ following ... burst of activity was just the start of a prolonged -care phase that greatly increased the surgical, anaesthetic, and intensive care workload As soon as the emergency department was cleared of casualties...

Ngày tải lên: 13/08/2014, 10:20

... capacities of different types of drainage basins is important along with knowledge of sediment residence times Of growing importance within geomorphologic drainage basin research is the development of ... fresh accumulations of debris/bed load were analysed by weighing of debris (portable field balance) and by a detailed measuring of the volumes of fresh deposits The estimation of annual bedload ... throughput of material above the delta of Latnjajaure, net accumulation of material in the delta of Latnjajaure and in the lake and a moderate fluvial down cutting between the outlet of Lake Latnjajaure...

Ngày tải lên: 19/06/2014, 23:20

... Triage and level of care To provide care for the greatest number of patients, physicians may need to alter standards of triage and individual-level care to maximize the number of lives saved and ... Issues Alter Standards of Care Develop Resilient Medical Surge CHAPTER THREE: Prehospital Care Introduction Basic Principles for Prehospital Care During a Terrorist Use of Explosives-Mass Casualty ... response, standards of care, and surge capacity The successful medical response to an MCE depends on effectively coordinating three critical areas of patient care: 1) prehospital care, 2) casualty...

Ngày tải lên: 19/02/2014, 03:20

... maturation stages of LD formation, and the structure of the LD itself Our histocytochemical analysis of the intestine and liver of mice fed Wy-14 643 showed that the induced expression of 17b-HSD11 ... instructions Briefly, 0.4 lg per well of plasmid DNA was incubated with 0.8 lL per well of PlusReagent, 1.2 lL per well of Lipofectamine Reagent and 250 lL of serum free F-12 medium, and the 60% ... equal protein loading (B) Comparison of the induction levels of 17b-HSD11 in the liver and intestine The same amounts (20 lg) of proteins from the PNS fractions of liver and small intestinal mucosa...

Ngày tải lên: 07/03/2014, 05:20

... gene-expression profile of bacterial-challenged rainbow trout was surveyed by means of suppression subtraction hybridization and sequence analysis [22] This resulted in identification of a number of immune ... molecular mass of 23.3 kDa and a theoretical isoelectric point (pI) of 9.77 A signal peptide of 26 amino acids was predicted [32] Thus the mature trout IL-11 generated following cleavage of the signal ... were a 26 bp insertion in the 5¢-UTR of the cDNA and an insertion of 12 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the 3¢-UTR of the cDNA sequence (Fig 1) A TATA box...

Ngày tải lên: 07/03/2014, 16:20

... observed value of diffusion coefficient literature value of diffusion coefficient half width of the channel length of the main portion of the channel mass-transfer rate cross sectional area of the recovery-side ... representation of concentration profile within channel Mass-transfer Characteristics of a Microchannel Device of Double-Y Type The mass-transfer across the contacting plane is modeled on the basis of the ... plane; Cb, the concentration of bulk liquid The contact time; θ, is calculated from the channel length of main portion of the channel, l divided by the average velocity of the contacting plane, vint,av...

Ngày tải lên: 19/06/2014, 23:20

... horizontal, a small piece of glass is kept at the air-water interface above the measurement volume The lack of this piece of glass, or the presence of a drop of water on the piece of glass could lead ... (Delbos, 2008) 4.1 Effect of the variation of the stroke on electrodeposition and flow In this section, the effect of the variation of the stroke of the comb is shown In this set of experiments all parameters ... maximum amplitude of stirring), the width of the comb (h), the shape of the teeth section, and the dimensions of the cell (L and H) Prior unpublished studies also showed that the mesh of the comb (M)...

Ngày tải lên: 19/06/2014, 23:20

... conditions (i.e to prove the validity of the Markovian approach of the condition of local equilibrium of dust system and of the assumption of the linear reaction of this system on its perturbations) ... influence of the openness of dusty plasma system and of the irregular distribution of grains’ stochastic energy on the degrees of freedom, including the question on a capability of the use of this ... the field of view of the video camera; (ii) the probability of simultaneous registration of grains in the next layer in the case of the multi-layer structure The results of measurement of velocity...

Ngày tải lên: 19/06/2014, 23:20

... rate of transport to the continuous phase One of the key aspects in the dynamic behaviour of the mass-transfer processes is the role of hydrodynamics On a macroscopic scale, the improvement of ... change in mass of solid body in a short time period of dissolving is very small and the mean area of dissolved cylinder may be used The relation between loss of mass, mean area of mass-transfer ... amplitude of reciprocating agitator, m; drec - diameter of reciprocating agitator, m; drot - diameter of rotational agitator, m; f - frequency of reciprocating agitator, s-1; n - rotational speed of...

Ngày tải lên: 19/06/2014, 23:20

... expansion phase The nature of the remnant depends upon the state of the primary during the onset of RLOF and the orbital properties of the resultant binary depend upon the details of the mass transfer ... Sagittarii and modulated radio flux density levels with evidence of eclipses of the emission regions of both conjunctions of the binary The form of the light curve obtained implied that the radio source ... mechanism in which a packet of the toroidal component of magnetic field (Bφ) plays a role Such a packet of P g toroidal field produced by the action of rapid rotation of the star in the region where...

Ngày tải lên: 19/06/2014, 23:20

... investigation of Schmidt et al., 1999, indicate existence of a maximum of Sherwood number Sh = f (k), at bed voidage about 0.8 Results of our investigations (Fig 5&6), show existence of maximum of mass ... elements of a vertical two-phase fluid-particle flow Design and practical realization of any of these systems that contain elements of a vertical two-phase flow, requires knowledge of the laws ... presence of inert glass particles The foils of silica gel were used as adsorbent (″Merck″, DC-Alufolien Kie-selgel) Concentration profiles of methylene blue were measured in the flow of water...

Ngày tải lên: 19/06/2014, 23:20

... hand, the use of the electrochemical microsensors method is also adapted to the characterization of the mixing state in different geometries of minireactor composed of networks of minichannels ... the issue of the dynamic behaviour of the electrochemical probe The shape of the PSD of the corrected wall shear rate is similar to that calculated by the transfer function in the range of frequency ... of the Taylor microscale is equal to 0.74 mm and the sizes of the larger eddies is ranged between 0.97 mm and 1.73 mm which are of the same order of magnitude than the characteristic length of...

Ngày tải lên: 19/06/2014, 23:20

... temperature of rice kernel surface, Ta (ºC) is the temperature of drying air, λ (J/kg) is latent heat of vaporization, V (m3) is the volume of the kernel, A (m2) is the total surface area of the kernel ... flux of heat input from the drying air to rice grains It depends upon properties of drying air, porosity of rice bed and the shape of rice grains Deep bed drying can be considered as packed bed of ... cooling of a deep bed of biological products under varying inlet air conditions Journal of Agricultural Engineering Research, 12, 4, 297-307 Bal, S (1968) Analytical study of radiant heating of rice...

Ngày tải lên: 19/06/2014, 23:20

... the rate of NEB increases until a maximum value almost at 0.7 and then significantly decreases The trend of NEB is a consequence of two different effects: 1.the changes of the mobility of chemical ... effect of microwave power and the thickness of banana slices on drying rate As expected, the author reported a significantly increase of drying rate as a function of energy power in a range of 350 ... degradation of middle lamella for onion tissue and a reduction of cross section area of 40%-60%; moreover, in the case of strawberries the authors showed a typical plasmolysis with the detachment of plasmalemma...

Ngày tải lên: 19/06/2014, 23:20

... initial phase of convection drying of vegetables and mushrooms and the effect of shrinkage Journal of Agricultural Engineering Research, 72, 187-195 Pabis, S (2007) Theoretical models of vegetable ... dehydration of high pressure treeated pineapple Journal of Food Science, 63, 508-511 Rastogi, N.K., & Raghavarao, K.S.M.S (1994) Effect of temperature and concentration of osmotic dehydration of coconut ... dehydration of apples Journal of Food Process Engineering, 26 (1), 31-48 Togrul, I.T., & Pehlivan, D (2002) Mathematical modeling of solar drying of apricots in thin layers Journal of Food Engineering,...

Ngày tải lên: 19/06/2014, 23:20

... slab of a binary alloy consisting of two components A, B Let C be the concentration of “A” We suppose that solidification of the alloy is governed by an equilibrium phase diagram consisting of ... profiles as a function of the similarity variable η for various values of the modified Grashof number It is observed from these figures that an increase in the modified Grashof number leads to increases ... effect of the Dufour parameter on the dimensionless temperature and concentration It is observed that the temperature of fluid increases with an increase of Dufour number while the concentration of...

Ngày tải lên: 19/06/2014, 23:20

... behavior of the solution of the porous media equation with absorption (reaction-diffusion processes of a gas inside a chemical reactor); penetration of solvents in polymers; filtration of water ... Lavrentyev of Applied Mathematics of Far Eastern Branch RAS Institute of Hydrodynamics of Siberian Branch RAS Russia Introduction Much attention has recently been given to statement and investigation of ... divide the set of all data of Model into two groups: the group of controls containing the functions g ∈ H1/2 (Γ) and χ ∈ L2 (Γ N ), which play the role of controls, and the group of fixed data comprising...

Ngày tải lên: 19/06/2014, 23:20

... Prediction of the performance of desiccant wheels One of the potentialities of the present numerical model is the calculation of the transient evolutions of the internal fields of temperature and of ... case of equal mass flow rates The outlet state of each 517 Heat and Mass Transfer in Desiccant Wheels airflow is defined by the interception of the isolines of the channel length L c and of the ... desiccant wheel are those based on the changes of adsorbed water content X (kg of adsorbed water/kg of dry desiccant,) and of the specific enthalpy h (J/kg of dry air), respectively, ηX and ηh Taking...

Ngày tải lên: 19/06/2014, 23:20