5 6 entering a truth table in vhdl using a vector signal

Digital electronics a practical approach  with VHDL

Digital electronics a practical approach with VHDL

... 6 5 Outline 1 56 Objectives 1 56 Introduction 157 Combinational Logic 157 Boolean Algebra Laws and Rules 162 Simplification of Combinational Logic Circuits Using Boolean Algebra 167 Using Quartus® ... 68 0 Multivibrators 68 1 Capacitor Charge and Discharge Rates 68 1 Astable Multivibrators 6 85 Monostable Multivibrators 68 7 Integrated-Circuit Monostable Multivibrators 69 0 Retriggerable Monostable ... Answers to Review Questions 7 15 Chapter 15 Interfacing to the Analog World 7 16 Outline 7 16 Objectives 7 16 Introduction 7 16 CONTENTS 15 1 15 2 15 3 15 4 15 5 15 6 15 7 15 8 15 9 15 10 15 11 15 12...

Ngày tải lên: 09/03/2016, 08:09

983 4,6K 0
G/A Công nghệ 8 (tiết 5,6)

G/A Công nghệ 8 (tiết 5,6)

... làm tập / 26 5. Dặn dò :Học ,làm câu hỏi / 25. Chuẩn bò thực hành Kích thước d.h d.h d Kích thước d d d TRƯỜNG THCS LONG HẢI Tuần 3: Tiết 5: TH.ĐỌC BẢN VẼ CÁC KHỐI A DIỆN I/MỤC TIÊU: -Học sinh đọc ... Bảng 5. 1: -Cho học sinh làm giấy củ GV A4 tập,vẽ A B C D sơ đồ bố trí phần hình X phần chữ X Hoạt động 3:Tổ chức thực hành :(13’) X -Học sinh thực -Giáo viên đến bàn X hướng dẫn kiễm tra cách ... vật thể có dạng khối a diện -Phát huy trí tưởng tượng không gian II/CHUẨN BỊ : -Mô hình vật thể A, B,C,D (h5.2 SGK) III/CÁC HOẠT ĐỘNG TRÊN LỚP : 1,n đònh lớp(1’): 2,Kiểm tra cũ (4’): -Thế hình...

Ngày tải lên: 30/06/2013, 01:27

3 404 0
Tiết 6, bài 5: Đông nam á

Tiết 6, bài 5: Đông nam á

... hình “Cam pu chia” nên quan hệ nước đông Nam Á ASEAN căng thẳng - Nhiều nước tăng trưởng kinh tế cao: Singapore; Malaysia Thailand Hình ảnh thịnh vượng kinh tế Singapore – Malaysia Thailand CÂU ... qua văn kiện quan trọng ASEAN - Những năm 80 quan hệ lại căng thẳng ( ?) Nhiều nước tăng trưởng kinh tế.như : Singapore, Malaysia… III TỪ “ASEAN 6 PHÁT TRIỂN THÀNH “ASEAN 11”: Sau “ chiến tranh ... Mianma, In ônêxia, Xigapo, Philippin, Đôngtimo,Malayxia,Thailan, Brunay - Diện tích: 4 ,5 tiệu km - Dânsố: 53 6 triệu người ( 2002) Nhóm 2: Tình hình Đông Nam Á trước năm 19 45? Hầu hết thuộc đ a thực...

Ngày tải lên: 27/09/2013, 09:10

21 500 0
trac nghiem A 4,5,6

trac nghiem A 4,5,6

... hospital (A) has taken (B) has been taking (C) was taken (D) was taking 13 - Did you get any mail? - No, I haven't gotten a letter (A) a long time before (B) since a long time (C) for a long ... that woman? Yes, I know (A) hers (B) she (C) her (D) him you got a transistor radio at home? (A) have (B) are (C) (D) has I to her since last Wednesday morning (A) haven't talked ... practising the violin (A) makes (B) made (C) is making (D) has made 17 "I wish you me to put these things away" he said (A) will help (B) help (C) are helping (D) would help 18 Some parts...

Ngày tải lên: 09/10/2013, 14:11

11 289 0
KT T.A 12 lan 2 HKI (Unit 4,5,6)

KT T.A 12 lan 2 HKI (Unit 4,5,6)

... animals which are protected carefully are living in National Parks A The wild animals protecting carefully are living in National Parks B The wild animals protected carefully are living in National ... morning A saw / was walking B saw / walked C was seeing / was walking D was seeing / walked 17 Hellen : “ Congratulations! You passed the final exam ” Jane : _ A What a pity ... we always play tennis in 38 The wild animals which are living in National Parks are protected carefully A The wild animals living in National Parks are protected carefully B The wild animals...

Ngày tải lên: 14/10/2013, 01:11

7 1,1K 27
KT T.A 12 CB lan 2 HKI ( Unit4,5,6)

KT T.A 12 CB lan 2 HKI ( Unit4,5,6)

... animals which are protected carefully are living in National Parks A The wild animals protecting carefully are living in National Parks B The wild animals protected carefully are living in National ... morning A saw / was walking B saw / walked C was seeing / was walking D was seeing / walked 17 Hellen : “ Congratulations! You passed the final exam ” Jane : _ A What a pity ... we always play tennis in 38 The wild animals which are living in National Parks are protected carefully A The wild animals living in National Parks are protected carefully B The wild animals...

Ngày tải lên: 14/10/2013, 01:11

7 451 0
KT T.A 11HKI lan 2 ( unit 4,5,6)

KT T.A 11HKI lan 2 ( unit 4,5,6)

... company money 34.” I don’t want to stay at home all day ” Linda said  Linda can’t stand _ at home all day 35 “ I’ll never it again.” Lam said  He promised it again 36 “ ... Brothers A volunteer B voluntary C voluntarily D B and C 19 All students can take part in the annual English –Speaking Competition A happening once a month B happening once a term C happening once a ... I said to John  I accused the company money 34.” I don’t want to stay at home all day ” Linda said  Linda can’t stand _ at home all day 35 “ I’ll never it again.” Lam...

Ngày tải lên: 17/10/2013, 03:11

6 496 4
Tài liệu Creating a Table in the Database from a DataTable Schema docx

Tài liệu Creating a Table in the Database from a DataTable Schema docx

... constructs a Data Definition Language (DDL) statement to create a table in a SQL Server database from the schema of a DataTable The complete statement that is generated is shown in Example 10- 16 Example ... command If you have a number of tables in a DataSet that you want to create in a database, you can iterate through the collection of DataRelation objects for the DataSet and use the ALTER TABLE ... ConfigurationSettings.AppSettings["Sql_ConnectString"]); MessageBox.Show( "Table " + TABLENAME + " created.", "Create DataTable from schema.", MessageBoxButtons.OK, MessageBoxIcon.Information); } private void CreateTableFromSchema(DataTable...

Ngày tải lên: 21/01/2014, 11:20

6 493 0
Tài liệu Preface, Contents Product Overview Getting Started1 2 3 4 5 6 7 8 9 10 11 12 A B C D E F pdf

Tài liệu Preface, Contents Product Overview Getting Started1 2 3 4 5 6 7 8 9 10 11 12 A B C D E F pdf

... to allow you to have a more stable signal You can enable the analog filter for each analog input point When analog input filtering is enabled for an analog input, the S7-200 updates that analog ... *LD10, VB1900 Sample Program for Using a Pointer to Access Data in a Table This example uses LD14 as a pointer to a recipe stored in a table of recipes that begins at VB100 In this example, VW1008 ... voltages Such sources include double insulation as defined in international electrical safety standards and have outputs that are rated as SELV, PELV, Class 2, or Limited Voltage according to various...

Ngày tải lên: 25/01/2014, 21:20

494 3,6K 0
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

... CGGGATCCTCTTGTATTACCCTCTA GCGAATTCTCCATCGTGCC TTTTTATTGTGGAGTATGCTGCTGAAATG ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT ... AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG PPP6C-siR-Bottom PPP6C-forward PPP6C-reverse 2 052 FEBS Journal 278 (2011) 2044–2 054 ... PPP6C gene (and the b-actin gene as an endogenous control) by PCR PCR primers were as follows: PPP6C sense and PPP6C antisense as above; b-actin sense, 5 -CGTGACATTAAGGAGAAGCTG-3¢; and b-actin antisense,...

Ngày tải lên: 14/03/2014, 23:20

11 397 0
Báo cáo "Developing a bilateral input-output table in the case of Thailand and Vietnam: Methodology and applications " doc

Báo cáo "Developing a bilateral input-output table in the case of Thailand and Vietnam: Methodology and applications " doc

... particular industry In essence, there are two types of linkages, namely, backward linkages and forward linkages A backward linkage is a measure of the relative importance of an industry as a ... sustain unit changes in their respective final demands The inverse matrix is the most important table needed in inter-national input-output analysis as it unravels the inter-national, inter-industrial ... sustain regional final demands Table shows that, because of weak interregional (national) linkages among and between sectors, the estimated spillover and feedback effects appear to be insignificant(2)...

Ngày tải lên: 22/03/2014, 13:20

13 563 0
HiPath 3000/5000 Version 4.0Service Manual..Important information1 2 3 4 5 6 7 8 9 10 11 12 A B doc

HiPath 3000/5000 Version 4.0Service Manual..Important information1 2 3 4 5 6 7 8 9 10 11 12 A B doc

... 6- 41 6- 43 6- 43 6- 43 6- 44 6- 46 6- 46 6- 46 6-47 6- 47 6- 47 6- 47 6- 47 6- 48 6- 49 6 -50 6 -51 6 -52 6 -54 6 -54 6 -55 6 -57 6 -57 6 -57 6 -59 6- 60 6- 60 6- 61 6- 62 6- 66 6 -67 6- 68 6- 68 6- 69 6- 69 6- 69 0-7 hp3hp5shTOC.fm ... 3 -60 Table 3 -61 Table 3 -62 Table 3 -63 Table 3 -64 Table 3- 65 Table 3 -66 Table 3 -67 Table 3 -68 Table 3 -69 Table 3-70 Table 3-71 Table 3-72 Table 3-73 Table 3-74 Table 3- 75 Table 3- 76 Table 3-77 Table ... 3-113 Table 3-114 Table 3-1 15 Table 4-1 Table 4-2 Table 4-3 Table 4-4 Table 4 -5 Table 4 -6 Table 4-7 Table 4-8 Table 4-9 Table 4-10 Table 4-11 Table 5- 1 Table 5- 2 Table 5- 3 Table 5- 4 Table 5- 5 Table...

Ngày tải lên: 22/03/2014, 15:21

860 6,4K 0
Ruta 6 selectively induces cell death in brain cancer cells but proliferation in normal peripheral blood lymphocytes: A novel treatment for human brain cancer doc

Ruta 6 selectively induces cell death in brain cancer cells but proliferation in normal peripheral blood lymphocytes: A novel treatment for human brain cancer doc

... intracranial brain cancers The 15 patients (9 male, female) with intracranial brain cancers who were treated with Ruta + Ca3(PO4)2 at the PBH Research Foundation, Kolkata, India, had been diagnosed ... therapy to treat 15 patients diagnosed with advanced intracranial malignant brain cancer at the PBH Research Foundation, Kolkata, India The other two authors (S.P and A. S.M.) have performed in ... chromosome-type aberrations in the brain cancer cells (data not shown) The percentages of metaphases with normal and abnormal spreads are shown in Fig 3A In the cells treated with Ruta and H2O2 in combination,...

Ngày tải lên: 22/03/2014, 17:20

8 671 0
Báo cáo khoa học: N-Glycan structures of squid rhodopsin Existence of the a1–3 and a1–6 difucosylated innermost GlcNAc residue in a molluscan glycoprotein pot

Báo cáo khoa học: N-Glycan structures of squid rhodopsin Existence of the a1–3 and a1–6 difucosylated innermost GlcNAc residue in a molluscan glycoprotein pot

... head pressure was maintained at  56 .6 kPa to give a constant flow rate of mLÆmin)1 using helium as carrier gas The initial oven temperature was held at 60 °C for min, increased to 90 °C for min, ... reducing end GlcNAc When subjected to linkage analysis, glycan B1 gave terminal Fuc, terminal Man, terminal Gal, 3 ,6- linked Man, 4-linked GlcNAc and, importantly, a peak that can be assigned as ... Kumamoto, Japan) and purified using DEAE-cellulose (Whatman, Maidstone, Kent, UK) and concanavalin A Sepharose 4B (Amersham Biosciences, Piscataway, NJ, USA) column chromatography a- Methyl mannoside...

Ngày tải lên: 23/03/2014, 17:22

6 430 0
Báo cáo "Tổng hợp và hoạt tính độc tế bào của một số dẫn xuất của 4'''',5,6-trihidroxy-3,3'''',7-trimetoxyflavon được phân lập từ cây Miliusa balansae " pot

Báo cáo "Tổng hợp và hoạt tính độc tế bào của một số dẫn xuất của 4'''',5,6-trihidroxy-3,3'''',7-trimetoxyflavon được phân lập từ cây Miliusa balansae " pot

... 11 76 (2001) Mai Ngoc Tam, Nguyen Hai Nam, Gyu Yong Song, and Byung Zun Ahn Arch Pharm Med Chem., Vol 333, P 189 - 194 (2000) Tokunaru Horie, Hideaki Tominaga, Isao Yoshida, and Yasuhico Kawamura ... R2=OH T2i liệu tham khảo Do Thu Huong, Christine Kamperdick, and Tran Van Sung Homogentisic acid derivatives from Miliusa balansae (Annonaceae), Journal of Natural Products (submitted in 2004) Nguyễn ... 6, 88 s 7, 16 d 7 ,63 dd 7,72 d 6, 88 s 7, 16 d 7 ,63 dd 7,73 d 7,02 s 7,30 d 7,72 dd 7,80 d 6, 97 s 7, 36 d 7 ,66 dd 7,78 d R =R =(CH3)NCO; R =OH 6 ,53 s 7,23 d 7 ,66 dd 7, 75 d R1=R2=R3=CH3 6, 75 s 6, 99 d...

Ngày tải lên: 25/03/2014, 12:21

4 554 0
ĐÔ THỊ HÓA & PHÁT TRIỂN BỀN VỮNG (Week 5-6, 27 Mar 2012) pdf

ĐÔ THỊ HÓA & PHÁT TRIỂN BỀN VỮNG (Week 5-6, 27 Mar 2012) pdf

... ĐƠ THỊ SINH THÁI LÀ GÌ? Sinh thái học thị Nghiên cưu cá c mó i ́ quan hệ gi a ̃ ̀ và moi trương xung ̀ quanh; Trên đi a bà n đo thị Giả i phá p qui hoạ ch và bả o vệ moi trương ... tại Trung Q́c và Ấn Đợ 1980 - 20 06 Thu nhập/người tại Trung Q́c và Ấn Đợ 1980 - 20 06 ĐƠ THỊ SINH THÁI LÀ GÌ? Đơ thị sinh thái là gì? Vì cần có thị sinh thái? ĐƠ THỊ SINH ... ĐƠ THỊ SINH THÁI Đo thị sinh thá i/Eco-City/Eco-Village Vì là Đo thị Sinh thá i?  Là xu hướng tất ́u cu a quá trình thị ho a nhanh với qui mơ toàn cầu  Nhằm hướng...

Ngày tải lên: 03/04/2014, 00:20

30 255 1
Giáo trình eagle 5 6 thiết kế mạch in

Giáo trình eagle 5 6 thiết kế mạch in

... Tập tin trái tim chương trình POV-Ray (thư_mục_con/povray) cap.inc Macros tụ điện capwima.inc Macros tụ Wima connector.inc Macros kết nối diode.inc Macros diodes ic.inc Macros IC qfp.inc Macros ... resistor.inc Macros Điện trở socket.inc Macros đế cắm cho ICs special.inc Macros đặc biệt switch.inc Macros công tắc switches transistor.inc Macros transistors tools.inc Miscellaneous macros, declares ... PACKAGE_NAME:0:1:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:MACR O_NAME(:: Bây cần thay đổi giá trị PACKAGE_NAME MACRO_NAME để render Để tìm PACKAGE_NAME linh kiện chúng va quay ngược lại với chương trình Eagle Tại c a sổ làm việc Eagle PCB,...

Ngày tải lên: 09/05/2014, 00:20

54 917 0
Bài 5: BẢO MẬT VÀ IN ẤN VĂN BẢN docx

Bài 5: BẢO MẬT VÀ IN ẤN VĂN BẢN docx

... 12/ 15/ 2009 TRƯỜNG CAO ĐẲNG NGHỀ CNTT iSPACE Website: http://www.ispace.edu.vn BÀI 5: BẢO MẬT VÀ IN ẤN VĂN BẢN Biết cách bảo mật và định dạng trang in, cũng thao tác in ấn văn bản ... http://www.ispace.edu.vn IN ẤN Thiết lập máy in Cài đặt máy ina chọn máy in in ấn Start-> Printers and Faxes TRƯỜNG CAO ĐẲNG NGHỀ CNTT iSPACE Website: http://www.ispace.edu.vn IN ẤN Chọn máy ... trang văn bản 12/ 15/ 2009 TRƯỜNG CAO ĐẲNG NGHỀ CNTT iSPACE Website: http://www.ispace.edu.vn BẢO MẬT Biết các thao tác liên quan đến việc bảo mật tài liệu Bảo mật tài liệu Bảo...

Ngày tải lên: 03/07/2014, 08:20

6 325 1
Tài liệu hướng dẫn sử dụng Micrologic control units 2.0 A, 5.0 A, 6.0 A and 7.0 A pps

Tài liệu hướng dẫn sử dụng Micrologic control units 2.0 A, 5.0 A, 6.0 A and 7.0 A pps

... alarm x In 95 98 In = 2000 A Ir = 0.7 x In = 1400 A Isd = x Ir = 4200 A instantaneous Isd 2 .5 10 1 .5 x Ir setting In = 2000 A See pages and for information on the available settings E51 368 A A ... 15 off x In 10 2 .5 1 .5 x Ir Ii = x In = 60 00 A Ii setting In = 2000 A In = 2000 A See pages and for information on the available settings E60 368 A Set the tripping delay Thresholds E5137 2A E5137 3A ... threshold values E51 366 A E60 367 A The rating of the circuit breaker in this example is 2000 A In = 2000 A long time alarm Ir 95 98 x In Ir = 0.7 x In = 1400 A Isd = x Ir = 2800 A instantaneous short...

Ngày tải lên: 05/07/2014, 10:20

31 3,3K 19
w