5 2 5 creating the fc for the valves

lop 2 tuan 5( ca the -ktkn)

... tìm kết 12 que tính - HS nêu cách làm - HS đặt +5 12 - Lớp nhận xét - HS lập + = 11 + = 12 + = 16 - HS học thuộc bảng cộng - Hoạt động cá nhân - HS thi đua tên bảng 7 +4 +7 +8 +7 11 13 15 16 - ... nhóm (đôi) - Nghóa danh từ cột (1) & (2) khác ntn? - HS thảo luận – trình bày - Cột 1: Gọi tên chung - Cột 2: Gọi tên riêng vật - Cột 1: Không viết hoa - Cột 2: Viết hoa - Hoạt động nhóm - HS nêu ... Vậy + = 12 - GV nhận xét - GV yêu cầu HS thảo luận nhóm lập bảng cộng dạng cộng với số - GV nhận xét  Hoạt động 2: Thực hành  Phương pháp: Luyện tập Bài 1: - Nêu yêu cầu đề bài? Bài 2: - Nêu...

30
186
0

Tài liệu cisco migrationn_This document describes how to deploy VMware ESX Server 2.5 into the Cisco data center architecture. doc

Danh mục: Chứng chỉ quốc tế

... route 10.81. 25 4 .20 2 25 5 . 25 5 . 25 5 . 25 5 1 72. 26.176.1 name NTP ip route xx.xxx .22 3 .23 25 5 . 25 5 . 25 5 . 25 5 1 72. 26.176.1 name rtp5-esevpn-gw3# Crypto Peer ip route 1 72. 26. 129 . 25 2 25 5 . 25 5 . 25 5 . 25 5 1 72. 26.176.1 ... xx.xxx .22 3 .23 25 5 . 25 5 . 25 5 . 25 5 dhcp ip route 1 92 .5. 41.40 25 5 . 25 5 . 25 5 . 25 4 dhcp ip route xx.xxx .22 3. 25 25 5 . 25 5 . 25 5 . 25 5 dhcp ! end The Tunnel0 interface of the branch router is similarly configured to the ... Video1 751 ip route 10.81.7 .21 6 25 5 . 25 5 . 25 5 .24 8 Tunnel216 name Video831 ip route 10.81.7 .22 4 25 5 . 25 5 . 25 5 .24 8 Tunnel 224 name vpn-jk2-1711-vpn ip route 10.81.7 .23 2 25 5 . 25 5 . 25 5 .24 8 Tunnel2 32 name...

41
596
0

Tài liệu Creating the project office 5 docx

Danh mục: Kế hoạch kinh doanh

... resist the change until they are forced to make the change or they leave the organization The strategy then is to use that one-third early adopters to demonstrate the beneﬁts of your vision Then ... of the people in an organization will be ready and willing, waiting for the change, another third will be on the fence and only change when they experience the beneﬁts of the new process, and the ... Ford family Those left in the organization are the true believers in the goodness and righteousness of the status quo The older and the more successful the organization, the more deeply ingrained...

10
260
0

Báo cáo Y học: Investigations into the mechanisms used by the C-terminal anchors of Escherichia coli penicillin-binding proteins 4, 5, 6 and 6b for membrane interaction ppt

Danh mục: Báo cáo khoa học

... (19 92) Possible role of Escherichia coli penicillin-binding protein 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 in stabilisation of stationary-phase peptidoglycan J Bacteriol 174, 757 2 757 8 ... lipid order The peak position of ms(CH2) lies at 2 850 cm)1 in the gel phase and shifts at a lipid speciﬁc temperature Tc to 2 8 52 .0 cm)1 )2 8 52 .5 cm)1 in the liquid crystalline state RESULTS The identiﬁcation ... Myr2-PEtn Myr2-PGro – Myr2-PCho Myr2-PEtn Myr2-PGro 0 37 20 58 48 56 43 85 85 63 77 42 52 44 57 FTIR conformational analyses of P4 and P5 b-sheet structures (16 25 1640 cm)1) were computed and are shown...

9
472
0

báo cáo hóa học: " Recombinant expression and purification of the 2,5-diketocamphane 1,2-monooxygenase from the camphor metabolizing Pseudomonas putida strain NCIMB 10007" potx

Danh mục: Hóa học - Dầu khí

... (NdeI _2 ,5- DKCMO_fw: 5 - GGAATTCATATGAAA TGCGGATTTTTCCATACCCC-3’; 2 ,5- DKCMO_XhoI_rv: 5 - CCGCTCGAGTCAGCCCATTCGAACCTT3’) After initial denaturation for at 95 C, the cycling program was followed for 25 ... followed for 25 cycles: 45 s, 95 C denaturation, 45 s, 58 °C primer annealing, 70 s, 72 C elongation The final elongation step was performed over 10 minutes at 72 C The resulting 10 92 kb fragment ... 5- exo-alkohol-dehydrogenase (M13471.1); CamP: 1 ,2- diketocamphane 2 ,5- monooxygenase (AY 450 2 85. 1); CamQ: lactone hydrolase (AY 450 2 85) ; CamR: regulatory protein The putative 3-ketoacid-CoA-transferases...

8
548
0

Báo cáo y học: "Anorexigen-induced pulmonary hypertension and the serotonin (5-HT) hypothesis: lessons for the future in pathogenesis" pps

Danh mục: Báo cáo khoa học

... lacking the 5- hydroxytryptamine transporter gene J Clin Invest 20 00, 1 05: 155 5- 156 2 Eddahibi S, Adnot S, Frisdal E, Levame M, Hamon M, Raffestin B: Dexfenfluramine-associated changes in 5- hydroxytryptamine ... mutations in the coding sequence of the BMPR2 gene were shown to occur in more than 50 % of patients with familial primary PH and in at least 25 % of patients with sporadic primary PH [26 ,27 ] The functional ... insertion (the L allele) or deletion (the S allele) [ 25 ] The L allele drives a twofold to threefold higher level of 5- HTT gene transcription than the S allele Preliminary results suggest that the L/L...

4
189
0

ĐỔI MỚI PHƯƠNG PHÁP DẠY HỌC BÀI SOẠN DẠY HỌC LỚP 5 MÔN THỂ DỤC TUẦN 2 ĐẾN TUẦN 6 CHI TIẾT, CỤ THỂ CÓ HÌNH ẢNH SINH ĐỘNG VÀ DỄ DÀNG GIẢNG DẠY.

Danh mục: Giáo dục học

... ng li ng * * * * * * ( Hc sinh m theo * nhp1 ,2 ; 1 ,2 nhp chõn * * * * * * trỏi, nhp chõn phi) * Trũ chi : Dit cỏc 28 p GV vt cú hi 20 p Kim tra bi c : HS Nhn xột 2- 3Ln II/ C BN: i hỡnh hc a ễn HN ... http://vn.ipanelonline.com/register?inviter_id=19 658 36 https://vn.ann-kate.com/registration/index.php?inviter=VNMT13060300 25 BI SON DY HC LP MễN TH DC TUN N TUN CHI TIT, C TH Cể HèNH NH SINH NG V D DNG GING DY Tun :2 Lp :5 Bi : 03 * ... Gim chõn gim ng li ng 28 p i hỡnh hc Trũ chi : Lm 20 p theo hiu lnh Nhn xột 2- 3Ln II/ C BN: a ễn HN - Thnh hng ngang http://vn.ipanelonline.com/register?inviter_id=19 658 36 https://vn.ann-kate.com/registration/index.php?inviter=VNMT1306030 025 ...

30
665
0

The 5 best MBA programs for entrepreneurship by geoffrey byruch

Danh mục: Tổng hợp

... provide the foundation for understanding the process of a business, the finances behind each purchase or sale, and the overall holistic context of an entrepreneur • The courses themselves bridge the ... • These concepts are then covered in a condensed set of classes for the first and second semester to maximize the students’ abilities to get started right away Their belief is to jump-start the ... could for you OVERVIEW • Below, I have outlined five of the top MBA entrepreneurship programs in the nation • These schools, in addition to their national reputation, have set a high standard for...

14
288
0

Bài 5: Điện thế hiệu điện thế

Danh mục: Vật lý

... – VN = 3V D VN – VM = 3V Đáp án: Chọn phương án C Vì: Theo công thức khái niệm hiệu điện thế: UMN = VM – VN Mà: UMN = 3V VM – VN = 3V Câu 2: Một êlectron (- e = -1,6.10-19C) bay từ điểm M đến ... cầu học sinh thực C1 *TL:Khi đặt điểm M ta xét đ/t thử dươngq.Di chuyển q từ điểm xa vô cực dọc theo đường thẳng qua Q.Trong di chuyển lực hút Q AM ∞ q sinh công âm:AM∞

14
547
1

giao an TLV 5 (TRẦN THẾ KHANH)

Danh mục: Tiểu học

... KHANH Tuần 25 Tiết 50 Ngày dạy : TẬP VIẾT ĐOẠN ĐỐI THOẠI I MỤC TIÊU Giúp HS : • Dựa theo truyện Thái Sư Trần Thủ Độ gợi ý giáo viên,viết tiếp lời đối thoại kòch với nội dung phù hợp(BT2) II ĐỒ ... 2ph Củng cố, dặn dò - Về nhà viết lại đoạn đối thoại vào chuẩn bò Tập viết đoạn đối thoại - Nhận xét :  Rút kinh nghiệm : NH :20 09 -20 10 TRƯỜNG TH TÂN THẠCH A Gv :TRẦN THẾ KHANH Tuần 26 Tiết 51 ... Bảng lớp viết sẵn đề cho HS lựa chọn III HOẠT ĐỘNG DẠY HỌC TG HĐGV HĐHS 1ph Ổn đònh 32ph Bài 2ph 2. 1 Giới thiệu 2. 2 Thực hành viết - HS đọc thành tiếng - Gọi HS đọc đề kiểm tra bảng - Nhắc HS : Các...

10
328
0

toan 5 trần thế khanh

Danh mục: Toán học

... phương: 2 ,5 x 2 ,5 = 6, 25 (cm2) Stp hình lập phương: 6, 25 x = 37 ,5 (cm2) Thể tích hình lập phương: 2 ,5 x 2 ,5 x 2 ,5 = 15, 6 25 (cm3) Đáp số: S1 mặt: 6, 25 cm2 Stp: 37 ,5 cm2 Thể tích: 15, 625 cm3 - HS đọc ... 10%, 5% 120 tính 15% 120 - 10% gấp đôi 5% , 15% gấp ba 5% ( 15% = 10% + 5% ) - HS đọc - HS nêu: 17 ,5% = 10% + 5% + 2 ,5% - HS lên bảng làm, lớp làm vào 10% 24 0 24 5% 24 0 12 2 ,5% 24 0 Vậy 17 ,5% 24 0 42 ... mặt (1) 1,5m 2, 25m2 DT toàn phần 13,5m2 Thể tích 3,375m3 - Gọi HS nhận xét bảng - GV nhận xét, ghi điểm Bài 2: (HS K-G) (2) 5/ 8dm 25 dm2 64 75 dm2 32 1 25 dm3 51 2 - HS nhận xét NH :20 09 -20 10 (3)...

20
413
0

skkn to 5(tran the khanh)

Danh mục: Tiểu học

... đầu năm môn Tiếng Việt: GIOÛI KHAÙ HS 57 HS 5. 6% 34.9% TB 45 HS 27 .6% YEÁU 52 HS 31.9%  Kết cuối học kì I môn Tiếng Việt GIOÛI 139 HS 85, 3% KHAÙ 21 HS TB HS 12, 9% YEÁU O HS 1,8% Bên cạnh chất lượng ... gợi cảm hứng cho em; dạy em biết diễn đạt có theo hệ thống tập từ đơn giản (nói, viết theo câu hỏi gợi ý, theo dàn ý …) đến cao nói, viết văn trọn vẹn theo đề tài kích thích hứng thú nhu cầu bộc ... cảnh theo không gian, tả thay đổi cảnh theo thời gian ; tả ngoại hình người, tả hoạt động người Câu hỏi lúc lên tâm trí làm để giúp HS làm tốt văn miêu tả kiểu ? Để dạy tốt văn miêu tả lớp 5, giáo...

18
265
0

GA toan 5(tran the khanh)

Danh mục: Tiểu học

... : 42dm2 = Vậy 42dm2 = 0,42m2 - Viết số thập phân thích hợp vào chỗ chấm : a) 56 dm2 = • 56 m2 = 0 ,56 m2 100 b) 17dm2 23 cm2 = 17 ,23 dm2 23 dm2 = 0 ,23 dm2 100 d) 2cm2 5mm2 = cm2 = 2, 05cm2 100 c) 23 cm2 ... a) 5ha = 50 000m2 ; 2km2 = 20 00000m2 b) 400dm2 = 4m2 ; 150 0dm2 = 7m2 70000cm2 = 7m2 2) HS đọc đề tự làm vào - HS lên bảng làm 2m2 9dm2 > 29 dm2 ; 790ha < 79km2 8dm2 5cm2 < 810cm2 ; 4cm2 5mm2 = ... HS a) 7km2 = 7000 000m2 ; 4ha = 40 000m2 8,5ha = b) 30dm2 = 0,3m2 ; 300dm2 = 3m2 51 5dm2 = 5m2 15dm2 = 5, 15m2 Bài giải 0,15km = 150 m Tổng số phần : + = (phần) Chiều dài sân trường : 150 : x =...

50
394
0

Module 5: Normalizing the Logical Data Design

Danh mục: Hệ điều hành

... Design Module 5: Normalizing the Logical Data Design Implementing Entity Relationships Module 5: Normalizing the Logical Data Design Activity 5. 2: Deriving the Third Normal Form for a Logical ... by searching the child entities for those instances with the appropriate foreign key A foreign key for a child entity is usually the primary key of the parent entity, because as the primary key ... that client The solution is to remove the client information from the Timesheet table and replace the information in the Timesheet table with a ClientID foreign key that corresponds to the ClientID...

24
351
0

Lesson 5:At the Stadium

Danh mục: Kỹ năng nói tiếng Anh

... and other adverbs usually by providing information how something is done or the degree of an adjective/past participle (adverbs of degree) or adverb (adverbs of degree) Most adverbs are formed ... seriously Unfortunately warm well well wonderful Brian: The opponent plays ! Their offender is very He aims very and shoots very Linda: Our team is not either Our goalkeeper ... Linda: And the hot dog is Hahaha It looks though, and hmmmm tastes very too! A goal has been scored for the opposing team Brian: Oh, I don’t know if we have a chance The opponent...

3
374
0

Bài soạn CHỦ ĐỀ 5+6 THỂ TÍCH KHỐI ĐA DIỆN - MẶT TRÒN XOAY

Danh mục: Tư liệu khác

... quanh hình nón b Tính thể tích khối nón tạo bỡi hình nón (ĐS: câu a p 25 10 25 ; câu p 25 2 20 ) Bài 2: Cho hình trụ có bán kính r=5cm có khoảng cách hai đáy 7cm a Tính diện tích xung quanh hình trụ ... Diện tích S= a ; Hình vng cạng a=>S=a2 ;đ chéo =a Hình chóp Tứ diện Hình lăng trụ Hình hộp Hình hộp chủ Định lý cosin: 2 2 2 2 a =b +c -2bc.cosA; b =a +c -2ac.cosB; c =a +b -abcosC - Đáy đa giác ... cách hai đường thẳng DM SC theo a Đáp số: V(S.NDCM)= 2a 5a 3 ; h= 19 24 BÀI 2: ( KHỐI B- 20 10) trang TỔ TĨAN –TIN TRƯỜNG THPT NGUYỄN KHUYẾN TÀI LIỆU ƠN TẬP TN.THPT -20 11 Cho hình lăng trụ tam...

12
1,136
16

Tài liệu Security Essentials Day 2 Threat and the Need for Defense in Depth docx

Danh mục: An ninh - Bảo mật

... SANS 20 01 v1.1 Oct 24 , 1999 S Northcutt v1 .2 Jun 19, 20 00 v1.3 edited by J Kolde, reconciled with audio 6 /28 /00 v1.4 – edited by J Kolde, adjusted grayscale for b/w printing – 22 Nov 20 00 v1.41 ... SANS 20 01 24 The code red worm uses the same mechanism as the original Code Red worm to infect vulnerable computers That is, the worm looks for systems running IIS that have not patched the unchecked ... compromising that system Then the vulnerable host that got compromised can be used to attack other systems, either in the same facility or in other organizations This is one reason for the statement that...

31
572
0

Tài liệu Module 5: Managing the Business Logic Layer pptx

Danh mục: Hệ điều hành

... following URL: Delivery Tip Open the files mod5ex1.asp and mod5ex2.asp in the \InetPub\WWWRoot \22 60\ Sampapps folder These files pass information in the URL that identifies the shopper http://localhost/shoppingcart.asp?shopid= 124 32 354 ... cookie and skip the logon page For more information about the mechanisms that provide ASP.NET formbased authentication, search for the topic “Scenario – Cookie Authentication” in the Next Generation ... as follows: Delivery Tip Open the files mod5ex3.asp and mod5ex4.asp in the \InetPub\WWWRoot \22 60\ Sampapps folder These files pass information in the FORM tag that identifies a hopper

60
420
0

Tài liệu Module 5: Normalizing the Logical Data Design docx

Danh mục: Chứng chỉ quốc tế

... Design Module 5: Normalizing the Logical Data Design Implementing Entity Relationships Module 5: Normalizing the Logical Data Design Activity 5. 2: Deriving the Third Normal Form for a Logical ... by searching the child entities for those instances with the appropriate foreign key A foreign key for a child entity is usually the primary key of the parent entity, because as the primary key ... that client The solution is to remove the client information from the Timesheet table and replace the information in the Timesheet table with a ClientID foreign key that corresponds to the ClientID...

24
452
0

Tài liệu Module 5: Creating a Security Design for Physical Resources pdf

Danh mục: Quản trị mạng

... Both: 50 portable computers x $ 52 5 = $26 , 25 0 By reducing by three the number of portable computers stolen, together these countermeasures would save the company $33, 750 annually ($60,000 – $26 , 25 0 ... education: 50 portable computers x $ 350 = $17 ,50 0 By reducing by two the number of portable computers stolen, this countermeasure would save the company $22 ,50 0 annually ($40,000 - $17 ,50 0 = $22 ,50 0) ... Alarms: 50 portable computers x $1 75 = $8, 750 By reducing by one the number of portable computers stolen, this countermeasure would save the company $11, 25 0 annually ( $20 ,000 – $8, 750 = $11, 25 0 )...

24
417
0