... tay theo bóng… Trang Trườ n g Mẫ u Giá o Mỹ Nhơn GV: Phạ m Thò Nương KẾ HOẠCH TUẦN (Từ ngày 06 /12 /2 010 đến 10 /12 /2 010 ) Thứ ngày TCCL Thứ hai 06 /12 /2 010 Thứ ba 07 /12 /2 010 Thứ tư 08 /12 /2 010 ... ngày TCCL Thứ hai 06 /12 /2 010 Thứ ba 07 /12 /2 010 Thứ tư 08 /12 /2 010 Thứ năm 09 /12 /2 010 Thứ sáu 10 /12 /2 010 Đề tài Mơn MTXQ TDCK HĐTH Cho gà ăn Đất – Biển – Trời Vật ni gia đình Trèo lên xuống thang ... Lớp hát lần - Cơ cho lớp hát theo với hình thức - Nhóm bạn trai hát, nhóm bạn gái hát Hoạt động 2: Vận động theo nhạc: vỗ tay theo tiết tấu chậm - Cơ hát gõ đệm theo tiết tấu chậm lần - Cơ giải...
Ngày tải lên: 05/11/2013, 10:11
... sea-stories until the howl of the gale from without seemed to blend with the text, and the splash of the rain to lengthen out into the long swash of the sea waves My wife was on a visit to her mother's, ... have the date of the reception by your uncle of the letter, and the date of his supposed suicide." "The letter arrived on March 10 , 18 83 His death was seven weeks later, upon the night of May ... America Some of them were of the war time and showed that he had done his duty well and had borne the repute of a brave soldier Others were of a date during the reconstruction of the Southern states,...
Ngày tải lên: 15/12/2013, 14:15
Tài liệu Activity 5.1: Identifying Keys in the Logical Model pdf
... Specify the keys in a logical data model Review the ER diagram on the next page Identify the areas of the ER diagram for which keys are necessary Write the keys in the space provided on the ER ... Activity 5. 1: Identifying Keys in the Logical Model Exercise 1: Identifying Keys In this exercise, you will identify primary, foreign, and composite keys for a logical data model based on the Ferguson ... necessary, using the following syntax: Primary Key: (PK) Foreign Key: (FK) Composite Key: (CK) Draw a line under the attributes used to define the composite key, and then label their types as Primary...
Ngày tải lên: 21/12/2013, 06:16
Tài liệu Lab 5.1.3 Using the Boot System Command pptx
... FastEthernet (FA0) FastEthernet (FA1) Serial (S0) Serial (S1) 250 0 Ethernet (E0) Ethernet (E1) Serial (S0) Serial (S1) 2600 FastEthernet 0/0 FastEthernet 0 /1 (FA0 /1) Serial 0/0 (S0/0) Serial 0 /1 ... Ethernet Serial Serial Interface Model Interface #1 Interface #2 Interface #1 Interface #2 #5 800 (806) Ethernet (E0) Ethernet (E1) 16 00 Ethernet (E0) Ethernet (E1) Serial (S0) Serial (S1) 17 00 ... save the current blank configuration Step Configure the router and view the running configuration file a Configure the router with the information in the table b Enter show running-config at the...
Ngày tải lên: 18/01/2014, 04:20
Tài liệu Lab 5.1.3 Using the Boot System Command doc
... FastEthernet (FA0) FastEthernet (FA1) Serial (S0) Serial (S1) 250 0 Ethernet (E0) Ethernet (E1) Serial (S0) Serial (S1) 2600 FastEthernet 0/0 FastEthernet 0 /1 (FA0 /1) Serial 0/0 (S0/0) Serial 0 /1 ... Ethernet Serial Serial Interface Model Interface #1 Interface #2 Interface #1 Interface #2 #5 800 (806) Ethernet (E0) Ethernet (E1) 16 00 Ethernet (E0) Ethernet (E1) Serial (S0) Serial (S1) 17 00 ... save the current blank configuration Step Configure the router and view the running configuration file a Configure the router with the information in the table b Enter show running-config at the...
Ngày tải lên: 18/01/2014, 04:20
Tài liệu Programming the Be Operating System-Chapter 1: BeOS Programming Overview ppt
... during the execution of a program An object can be added or deleted from the heap without regard for its placement in the heap, or for the other contents of the heap The stack, on the other hand, ... window like the one shown in Figure 1 -5 Figure 1 -5 The window that results from running the SimpleApp program The SimpleApp source code listing Presented next, in its entirety, is the source code ... a look at Figures 1- 6 and 1- 7 Figure 1- 6 The files used in the development of the HelloWorld application The /boot/apps/Metrowerks folder holds the BeIDE itself, along with other folders that...
Ngày tải lên: 26/01/2014, 07:20
Tài liệu Programming the Be Operating System-Chapter 5: Drawing ppt
... draws the following three lines 16 8 Chapter 5: Drawing • From point (50 .0, 10 0.0) to point ( 15 0 .0, 20.0) • From point ( 15 0 .0, 20.0) to point ( 250 .0, 10 0.0) • From point ( 250 .0, 10 0.0) back to point ... solid pattern in the current high color: BRect BRect rect1 (10 0.0, 10 0.0, 15 0 .0, 15 0 .0); rect2( 15 0 .0, 15 0 .0, 200.0, 200.0); FillRect(rect1, B_SOLID_HIGH); FillRect(rect2); Patterns 15 1 Earlier in ... rgb_color BRect redColor = { 255 , 0, 0, 255 }; aRect (10 , 10 , 11 0, 11 0); SetHighColor(redColor); FillRect(aRect, B_SOLID_HIGH); 13 8 Chapter 5: Drawing The previous snippet declares redColor to be a...
Ngày tải lên: 26/01/2014, 07:20
Tài liệu UNIT 5. ONLINE FACILITATION LESSON 1. THE ROLE OF THE FACILITATOR pptx
... Relationships: Are there political or other alliances in the group? Are these alliances known to all the members of the Relationships: Are there political or other alliances in the group? Are these alliances ... be aware both of the communication styles of the individuals who make up the group, and of the way the group interacts as a whole The way in which the group works together, and the way in which ... identity, in the eyes of its members and those outside the group What is the role of the facilitator? The role of the facilitator is to make it easier for groups to work together and achieve their goals...
Ngày tải lên: 22/02/2014, 01:20
oracle database quick installation guide 10g release 1 (10.1.0.3) for the solaris operating system (x86)
... Library (libm) patch ■ 11 2234 -12 , SunOS 5. 9_x86: Kernel Patch ■ 11 3986-08, SunOS 5. 9_x86: linker Patch ■ 1 15 1 14 -02, SunOS 5. 9_x86: Patch for assembler ■ 14 11 6 013 -02, SunOS 5. 9_x86: ps utility patch ... SUNWsprot SUNWi15cs SUNWxwfnt SUNWi1of SUNWi1cs SUNWlibm The following patches (or later versions) must be installed: ■ 11 1 713 -06, SunOS 5. 9_x86: Shared library patch for C++ ■ 11 1728-03, SunOS 5. 9_x86: ... Installation Guide, 10 g Release (10 .1. 0.3) for Solaris Operating System (x86) Part No B13972- 01 Copyright © 19 96, 2004, Oracle All rights reserved The Programs (which include both the software and...
Ngày tải lên: 07/04/2014, 15:52
Chapter 5: Battery-Powered Traction—The User’s Point of View potx
... (years) 50 87. 35 24 16 0 10 22 .58 16 610 9.93 II 600 11 20% EUR/Year 8 91 .56 672.09 12 7.06 10 2.26 306.78 2099. 75 EUR/h 3 .50 0. 15 559 . 35 0 .12 Copyright © 2003 by Expert Verlag All Rights Reserved 13 2. 71 ... connect the charger with the mains and the battery with the charger is m The factory code in the manual of the device shows the correlation of the charger to the battery Later in the plant during operation, ... Rights Reserved 13 2. 71 0.22 51 .13 0.00 0.00 640.93 1. 07 2740.68 4 .57 Figure 5. 2 5. 4 .1 Comparison of costs for two different battery types Increase of Electrical Performance The increase of electrical...
Ngày tải lên: 05/07/2014, 06:20
Báo cáo y học: "The angiogenesis inhibitor protease-activated kringles 1–5 reduces the severity of murine collagen-induced arthritis" ppsx
... 2 .11 ± 0 .11 ** 2 .19 ± 0 .10 ** 2.30 ± 0 .13 ** 2.33 ± 0 .10 ** 2.47 ± 0 .12 ** 2 .50 ± 0 .12 ** 2. 41 ± 0 .11 ** 2. 41 ± 0 .10 ** 2.42 ± 0 .11 ** 1. 91 ± 0.04 1. 96 ± 0.08 1. 91 ± 0.09 1. 92 ± 0 .10 2 .14 ± 0 .13 2 .16 ... 0 .19 ** 3.64 ± 0.40** 4.29 ± 0 .52 ** 4.93 ± 0.44** 5. 19 ± 0 .58 ** 5. 70 ± 0.44** 5. 67 ± 1. 17** 5. 56 ± 0. 95* * 5. 75 ± 0. 85* * 6 .50 ± 1. 03** 2 .57 ± 0.20 2.33 ± 0 .17 2 .14 ± 0 .18 2. 75 ± 0. 75 3. 25 ± 0 . 51 ... 3. 75 ± 0 . 51 4.33 ± 0.38 3.33 ± 0.38 4.00 ± 0.64 3.90 ± 0. 91 1.93 ± 0.04** 2.20 ± 0 .11 ** 2. 25 ± 0 .11 ** 2.36 ± 0 .13 ** 2.34 ± 0 .14 ** 2.22 ± 0 .14 ** 2.49 ± 0 .11 ** 2.43 ± 0 .12 ** 2.37 ± 0 .12 ** 2. 45 ±...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: " Effect of chloroquine on reducing HIV-1 replication in vitro and the DC-SIGN mediated transfer of virus to CD4+ T-lymphocytes" pdf
... inhibition and spectrum of activity AIDS 20 01, 15 : 22 21- 2229 Page 10 of 12 (page number not for citation purposes) Retrovirology 2007, 4:6 10 11 12 13 14 15 16 17 18 19 20 Savarino A, Lucia MB, Rastrelli ... 15 16 17 18 19 20 21 22 23 24 27 25 28 26 29 30 31 32 33 34 35 36 37 NCTRPNNNTRK .Y .Y .Y .Y .Y .Y .Y .Y .Y .Y Y Y Y Y Y Y Y Y Y Y Y Y Y 15 16 18 20 21 22 29 30 31 32 ... http://www.retrovirology.com/content/4 /1/ 6 A 0.0 05 CA-p24 (ng/ml) 12 0 10 0 80 60 40 20 0.004 >0.0 01 +CQ -CQ +CQ day 14 -CQ +CQ day 77 -CQ +CQ day 1 35 -CQ day 19 7 B 0.003 400 CA-p24 (ng/ml) 350 300 0.002 250 200 15 0 0.0009 10 0 50 ...
Ngày tải lên: 13/08/2014, 09:20
Báo cáo sinh học: "Mapping of a milk production quantitative trait locus to a 1.056 Mb region on bovine chromosome 5 in the Fleckvieh dual purpose cattle breed" pps
... 1 25 12 4 12 3 12 2 12 1 12 0 11 9 11 8 11 7 11 6 1 15 11 4 24 22 20 18 16 14 12 10 MY1 PY1 FY1 A0 Homo 1 25 12 4 12 3 12 2 12 1 12 0 11 9 11 8 11 7 11 6 1 15 11 4 11 3 11 2 1 25 12 4 12 3 12 2 12 1 12 0 11 9 11 8 11 7 11 6 1 15 ... Set1 DIK 212 2 11 4.68 11 3 216 193 -11 3 216 706 CAACAAACTGTGCGTTGTGA ACTCAGCAGTTGCCCTCAGT Set3 BM2830 11 6. 91 1 15 2 62 054 -1 15 2 620 75 AATGGGCGTATAAACACAGATG TGAGTCCTGTCACCATCAGC Set0 10 BM49 11 8.06 11 62 053 43 -11 62 059 72 ... 13 DIK5277 12 1 .53 12 0099447 -12 010 0247 ACCCAAACTTAGCGTGGATG GTCTCCAAGGCTGCTCACTC Set3 14 DIK 510 6 12 1.47 11 84 612 14 -11 84 616 02 GCATGTGTGCAGAAGAAGGA TGTTCAGTGGTTCCCTGTGA Set3 15 LMU 050 5 12 3.64 12 1423920 -12 142 452 0...
Ngày tải lên: 14/08/2014, 13:21
ĐỔI MỚI PHƯƠNG PHÁP DẠY HỌC BÀI SOẠN DẠY HỌC LỚP 5 MÔN THỂ DỤC TUẦN 1 ĐẾN TUẦN 5 CHI TIẾT, CỤ THỂ CÓ HÌNH ẢNH SINH ĐỘNG VÀ DỄ DÀNG GIẢNG DẠY.
... http://vn.ipanelonline.com/register?inviter_id =19 658 36 https://vn.ann-kate.com/registration/index.php?inviter=VNMT13060300 25 dung yêu cầu học HS đứng chỗ vổ tay hát Giậm chân ….giậm Đứng lại ……đứng ( Học sinh đếm theo nhịp1,2 ; 1, 2 nhịp ... https://vn.ann-kate.com/registration/index.php?inviter=VNMT13060300 25 tay hát GV Giậm chân …giậm Đứng lại ….đứng ( Học sinh đếm theo nhịp1,2 ; 1, 2 nhịp 28p chân trái, nhịp 15 p Đội hình học tập chân phải) 2-3Lần Nhận ... http://vn.ipanelonline.com/register?inviter_id =19 658 36 https://vn.ann-kate.com/registration/index.php?inviter=VNMT13060300 25 hát * * * * * * * * Giậm chân …giâm * Đứng lại ……đứng * * * * * * * * ( Học sinh đếm theo * nhịp1,2 ; 1, 2 nhịp...
Ngày tải lên: 22/03/2015, 14:38
ĐỔI MỚI PHƯƠNG PHÁP DẠY HỌC BÀI SOẠN DẠY HỌC LỚP 5 MÔN THỂ DỤC TUẦN 1 ĐẾN TUẦN 10 CHI TIẾT, CỤ THỂ CÓ HÌNH ẢNH SINH ĐỘNG VÀ DỄ DÀNG GIẢNG DẠY.
... * GV Đội hình học tập 11 p 8p http://vn.ipanelonline.com/register?inviter_id =19 658 36 Đội hình trò chơi https://vn.ann-kate.com/registration/index.php?inviter=VNMT13060300 25 học phải đảm bảo - Nhận ... http://vn.ipanelonline.com/register?inviter_id =19 658 36 GV https://vn.ann-kate.com/registration/index.php?inviter=VNMT13060300 25 theo nhịp Thả lỏng: Hệ thống lại học nhận xét học - Về nha luyện tâpl ĐHĐN Tuần Lớp: Bài : 16 * Động ... https://vn.ann-kate.com/registration/index.php?inviter=VNMT13060300 25 ĐỔI ĐỔI MỚI PHƯƠNG PHÁP DẠY HỌC BÀI SOẠN DẠY HỌC LỚP MÔN THỂ DỤC TUẦN ĐẾN TUẦN 10 CHI TIẾT, CỤ THỂ CÓ HÌNH ẢNH SINH ĐỘNG VÀ DỄ DÀNG GIẢNG DẠY Tuần :1 Lớp: Bài : 01 * Giới thiệu...
Ngày tải lên: 23/03/2015, 05:47
Bài giảng công cụ thu nhập cố định chương 5 1 trái phiếu có thể mua lại
... forward rate 5, 25 5, 25 10 0 + 5, 25 + + = 10 2,0 75$ (1, 0 35) (1, 04 01) (1, 0 454 1) 5, 25 5, 25 10 0 + 5, 25 + + = 10 2,0 75$ (1, 0 35) (1, 0 35) (1, 0 452 3) (1, 0 35) (1, 0 452 3) (1, 055 80) Bổ sung: Biến động lãi suất • Với ... rate) 3 ,50 3 ,50 0 4, 01 4 ,52 3 4 ,54 1 5, 580 • Lưu ý: Lãi suất kỳ hạn spot rate tương lai • Hai cách định giá cho kết quả: chiết khấu dòng tiền theo spot rate theo forward rate 5, 25 5, 25 10 0 + 5, 25 + ... nhận 10 4$ bị mua lại) • Nếu TP 10 năm, 13 % có lợi suất thị trường 6%, bị mua lại sau năm với giá 10 4$; lợi suất TP năm 5% , nhà đầu tư đặt giá bán theo lợi suất TP năm: (6 ,5$ /1, 1 25) + 11 0 ,5$ / (1, 0 25) 2...
Ngày tải lên: 04/06/2015, 12:13
PHÂN TÍCH mô HÌNH 5+1 của m PORTER vận DỤNG mô HÌNH này để ĐÁNH GIÁ CƯỜNG độ CẠNH TRANH cụ THỂ LIÊN hệ NGÂN HÀNG SACOMBANK
... niên( đvt: 10 00 VND) Thẻ chuẩn Sacombank Techcombank HSBC ANZ Thẻ vàng Thẻ bạch kim 299 399 999 350 55 0 300 600 12 00 350 55 0 11 00 950 Lãi suất (%/tháng) Thẻ chuẩn Sacombank Thẻ vàng 2. 15 Thẻ bạch ... cuối quý I/2 014 1 15 . 257 tỷ đồng, tăng 4 ,5% Trong đó, dư nợ cho vay tổ chức kinh tế dân cư đạt 11 1.672 tỷ đồng, tăng 3 ,5% Dư nợ tiền đồng ngoại tệ tăng 4,6% 3%, dư nợ vàng giảm 3 05 lượng dần tiến ... Sacombank Thẻ vàng 2. 15 Thẻ bạch kim 2. 15 2. 15 Techcombank HSBC ANZ 2. 15 2.07 2.00 2.6 2.33 2.32 2. 65 2. 65 2.40 2: Áp lực cạnh tranh đến từ khách hàng Trong năm 2 013 – năm với nhiều đổi mới, nhiều...
Ngày tải lên: 14/12/2015, 22:03
Cambridge.University.Press.The.Works.of.Archimedes.Volume.1.The.Two.Books.On.the.Sphere.and.the.Cylinder.Translation.and.Commentary.May.2004.pdf
... isbn -13 isbn -10 978-0 - 51 1- 19430-6 eBook (EBL) 0 - 51 1- 19430-7 eBook (EBL) isbn -13 isbn -10 978-0 -52 1- 6 616 0-7 hardback 0 -52 1- 6 616 0-9 hardback Cambridge University Press has no responsibility for the ... 2 45 /1/ There are in a plane some limited 11 curved lines, which are either wholly on the same side as the straight 12 joining their limits or have nothing on the other side .13 /2/ So14 I ... a fragment of another, the Stomachion Heiberg went on to provide a new edition (19 10– 15 ) reading the Palimpsest as best he could We imagine him, through the years 19 06 to 19 15 , poring in Copenhagen...
Ngày tải lên: 21/09/2012, 11:00