4—role of environment structure geometry and restraint on distress development

Báo cáo khoa học: "The role of body mass index and diabetes in the development of acute organ failure and subsequent mortality in an observational cohor" doc

Báo cáo khoa học: "The role of body mass index and diabetes in the development of acute organ failure and subsequent mortality in an observational cohor" doc

... except Jackson, where only African-Americans were included Participants underwent baseline clinical examination, BMI measurement, and pulmonary function testing, and provided information on their ... DM, and lower levels of lung function These same factors, along with smoking, black race, and a lower educational level, predicted death within three years The presence of DM was among the strongest ... the DM population Finally, we included only three years of follow-up in this analysis This was done to focus on the short-term risk of BMI and DM on acute organ failure Over the long term, patients...

Ngày tải lên: 13/08/2014, 03:20

9 501 0
Tài liệu Báo cáo khoa học: A tyrosinase with an abnormally high tyrosine hydroxylase/dopa oxidase ratio Role of the seventh histidine and accessibility to the active site docx

Tài liệu Báo cáo khoa học: A tyrosinase with an abnormally high tyrosine hydroxylase/dopa oxidase ratio Role of the seventh histidine and accessibility to the active site docx

... rate of TH activity as a function of the concentration of l-dopa cofactor added to the assay mixture R3-1501– extracts have a high TH activity, almost independent of the addition of l-dopa cofactor, ... conditions for this activity (0.02% SDS, pH 7) The second one displayed only DO activity under these conditions Interestingly, the first peak but not the second one was found in the extracts of ... rate-limiting step, monophenol hydroxylation, and NP_519622 would catalyse the second step, oxidation of o-diphenol to o-quinone, or alternatively a stabilization of the former enzyme Studies on possible...

Ngày tải lên: 19/02/2014, 07:20

14 849 0
Tài liệu Báo cáo khoa học: Fatty acid synthesis Role of active site histidines and lysine in Cys-His-His-type b-ketoacyl-acyl carrier protein synthases ppt

Tài liệu Báo cáo khoa học: Fatty acid synthesis Role of active site histidines and lysine in Cys-His-His-type b-ketoacyl-acyl carrier protein synthases ppt

... crystallization conditions included an ammonium ion concentration of 1.9 m, which probably influences the nature of the cation under crystallization conditions The function of the ion is presumably ... readily monitored with the aid of a size-exclusion column and scintillation counting of the fractions We have previously shown [9] that, under saturation conditions, wild-type KAS I transfers 42% of ... coli by use of crystal structures of active site mutants and biochemical characterization of the acyl transfer, decarboxylation and ⁄ or condensation steps of the reaction performed by these mutants...

Ngày tải lên: 19/02/2014, 08:20

16 451 0
Tài liệu Investigating the Role of Poultry in Livelihoods and the Impact of Avian Flu on Livelihoods Outcomes in Africa docx

Tài liệu Investigating the Role of Poultry in Livelihoods and the Impact of Avian Flu on Livelihoods Outcomes in Africa docx

... private foundations, and international and regional organizations, most of which are members of the Consultative Group on International Agricultural Research (CGIAR) PARTNERS AND CONTRIBUTORS IFPRI ... outbreak, and thus facilitate the implementation of control measures, is a function of the effect of HPAI on livelihoods This link rationalizes the system of compensation for the loss of poultry ... Implementation of Propensity Score Matching Journal of Economic Surveys, 22(1): 31–72 Cameron, C., and P K Trivedi 1986 Econometric models based on count data: Comparisons and applications of some...

Ngày tải lên: 21/02/2014, 01:20

40 760 0
Báo cáo khoa học: Caenorhabditis elegans metallothionein isoform specificity – metal binding abilities and the role of histidine in CeMT1 and CeMT2 potx

Báo cáo khoa học: Caenorhabditis elegans metallothionein isoform specificity – metal binding abilities and the role of histidine in CeMT1 and CeMT2 potx

... metal coordination in the Zn– and Cd–CeMT1 and Zn– and Cd–CeMT2 complexes Diethyl pyrocarbonate (DEPC) modification allows the identification and quantification of the histidine residues of proteins ... concordance with an involvement of CeMT1 in the global metabolism of physiological Zn, as well as the contribution of CeMT2 to ingested cadmium detoxification Results and Discussion Identity and ... same con- ditions, CeMT2 and DHisCeMT2 gave rise to mixtures of homonuclear Zn(II) complexes with Zn6 as the major species, in concordance with the results of an in vitro reconstitution of apo-CeMT2...

Ngày tải lên: 07/03/2014, 02:20

17 600 0
Báo cáo " Cell suspension culture Panax ginseng C. A. Meyer: Role of plant growth regulators and medium composition on biomass and ginsenoside production " docx

Báo cáo " Cell suspension culture Panax ginseng C. A. Meyer: Role of plant growth regulators and medium composition on biomass and ginsenoside production " docx

... suspension cells of P ginseng were maintained in MS medium The cultural conditions were done as described by [8] Determination and analyses Extraction and determination of ginsenoside production were ... nitrogen concentration of 40 mM.[14] In the simultaneous production of ginseng saponin and polysaccharide by suspension cultures of P ginseng, [15] reported that production of ginseng saponin was ... accumulation of total saponin and polysaccharide were also influenced by initial nitrogen concentration in the medium The maximum production of ginseng saponin and polysaccharide obtained (1.5 g/L and...

Ngày tải lên: 14/03/2014, 10:20

6 493 0
Báo cáo khoa học: Role of the hinge peptide and the intersubunit interface in the swapping of N-termini in dimeric bovine seminal RNase pptx

Báo cáo khoa học: Role of the hinge peptide and the intersubunit interface in the swapping of N-termini in dimeric bovine seminal RNase pptx

... 270) Fig Ribbon representation of the solution structure of mBS-RNase (A), as derived from heteronuclear NMR data (pdb accession code 1WQW), and the X-ray structure of the MxM form of BS-RNase ... point mutations on the solution structure of monomeric derivatives, we analysed the 2D NMR spectra of the different variants of mBS Figure shows the expanded regions of TOCSY spectra of L28Q-mBS ... Picone, D (2003) The swapping of terminal arms in ribonucleases: comparison of the solution structure of monomeric bovine seminal and pancreatic ribonucleases Biochemistry 42, 8704–8711 Di Donato,...

Ngày tải lên: 16/03/2014, 23:20

7 404 0
Neural Tube Defects – Role of Folate, Prevention Strategies and Genetics Edited by Kannan Laksmi Narasimhan ppt

Neural Tube Defects – Role of Folate, Prevention Strategies and Genetics Edited by Kannan Laksmi Narasimhan ppt

... division, neural function and growth Humans are unable to synthesize folate and depend on an adequate and constant intake Both observational and interventional studies, including randomized, controlled ... terms of knowledge about the benefits and sources of folic acid, and especially in terms of understanding the correct, periconceptional timing of folic acid intake Official health education initiatives ... g) and high lesions (Bol et al., 2006, Wong & Paulozzi, 2001) 4.3 Concerns Before the mandatory fortification of grains, the average consumption of folic acid was estimated to be 0.25mg/day and...

Ngày tải lên: 17/03/2014, 02:20

210 489 0
Báo cáo khoa học: 2-Oxo acid dehydrogenase complexes in redox regulation Role of the lipoate residues and thioredoxin pot

Báo cáo khoa học: 2-Oxo acid dehydrogenase complexes in redox regulation Role of the lipoate residues and thioredoxin pot

... ratio of the complex-bound lipoate/dihydrolipoate is a function of (a) concentrations of the reaction substrates and products, (b) kinetic properties of the component enzymes, E1, E2 and E3, and ... to respond to the state of the mitochondrial NAD+ and NADH pool The E1 activity is regulated both upon accumulation of NADH and decrease of NAD+ The E1 inactivation at low NAD+ concentration prevents ... action of dihydrolipoate on E1 and scavenging of ROS produced by E3 As a result, cooperation of the 2-oxo acid dehydrogenase complexes, thioredoxin and SP-22 (reaction 7) enables oxidation of...

Ngày tải lên: 17/03/2014, 09:20

7 407 0
Role of C-Reactive Protein and Procalcitonin in Differentiation of Tuberculosis from Bacterial Community Acquired Pneumonia potx

Role of C-Reactive Protein and Procalcitonin in Differentiation of Tuberculosis from Bacterial Community Acquired Pneumonia potx

... between CRP and PCT (p=0.733) At a cutoff value of 12.5 mg/dL, the CRP concentration had a sensitivity of 90.0% and a specificity of 58.9%; at a cutoff value of 0.25 ng/mL, the PCT concentration had ... sensitivity of 93.1% and a specificity of 59.6% (Fig 1, Table 2) CRP and PCT concentrations according to the PORT Pneumonia Severity Index (PSI) risk classes The median CRP and PCT concentrations were ... small number of study subjects should be considered when generalizing the results using CRP and PCT to determine pulmonary TB and bacterial CAP In conclusion, serum CRP and PCT concentrations differed...

Ngày tải lên: 22/03/2014, 18:20

6 515 2
Báo cáo khoa học: Cytoskeleton-modulating effectors of enteropathogenic and enterohemorrhagicEscherichia coli: role of EspL2 in adherence and an alternative pathway for modulating cytoskeleton through Annexin A2 function pot

Báo cáo khoa học: Cytoskeleton-modulating effectors of enteropathogenic and enterohemorrhagicEscherichia coli: role of EspL2 in adherence and an alternative pathway for modulating cytoskeleton through Annexin A2 function pot

... regulon are repressed by H-NS, but once expression of pchA and ler is stimulated by environmental signals, such as nutrient starvation or butyrate [27,28], transcription of the genes in the regulon ... cytoskeleton Conclusions Modulation of the cellular cytoskeleton seems to be essential for establishing the tight adherence of EHEC and EPEC A main contributor must be the Tir-mediated polymerization of ... leading to the formation of a condensed bacterial colony and a pseudopod-like structure (right cell) By contrast, without EspL2, attachment of EHEC induces the formation of F-actin pedestals,...

Ngày tải lên: 29/03/2014, 09:20

6 272 0
The role of health related, motivational and sociodemographic

The role of health related, motivational and sociodemographic

... Review of the Research on Consumer Understanding of Nutrition Labelling Brussels: European Heart Network 31 Jones G & Richardson M (2007) An objective examination of consumer perception of nutrition ... questionnaire contained questions about all of the variables and constructs listed in Fig Most of the predictor concepts and the outcome variable label use were assessed in scales consisting of ... presentation of nutritional information on the package as is mostly the case in Switzerland might be problematic from a public health perspective On the one hand, this format may decrease understanding...

Ngày tải lên: 08/04/2014, 17:00

8 272 0
the role of neutrinos, strings, gravity, and variable cosmological constant in particle physics

the role of neutrinos, strings, gravity, and variable cosmological constant in particle physics

... American Institute of Polish Culture, Chopin Foundation and Honorary Consul of the Republic of Poland in Miami, and to Dr and Mrs Edward Bacinich of Palm Beach, Florida for their continued generous ... at the conclusion of the conference Annotator: Comments on the dissertator’s presentation or asks questions about it upon invitation by the moderator CONFERENCE PROCEEDINGS Instructions to the ... ACCELERATION AND A NATURAL SOLUTION TO THE COSMOLOGICAL CONSTANT PROBLEM 33 Philip D Mannheim BEYOND THE STANDARD MODEL SPONTANEOUS VIOLATION OF LORENTZ AND CPT SYMMETRY Don Colladay...

Ngày tải lên: 24/04/2014, 17:07

284 2,2K 0
Role of environmental self-auditing and audit policies in regulatory compliance

Role of environmental self-auditing and audit policies in regulatory compliance

... permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced ... permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced ... permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced...

Ngày tải lên: 01/06/2014, 14:03

121 277 0
aging of the genome the dual role of dna in life and death mar 2007

aging of the genome the dual role of dna in life and death mar 2007

... Since the landmark completion of the HGP, the type of biology focused on the identification and functional analysis of genes, coding regions, and other functional elements of entire genomes on a high-throughput ... simultaneous demonstration of the existence of natural pro-longevity gene variants and the strong influence of the environment on the selection of these variants Later, the prediction that higher ... island not subject to predation and one on the mainland where they were exposed to significant predation, confirmed the prediction that the island population had the highest longevity63 Environment...

Ngày tải lên: 11/06/2014, 10:21

385 334 2
báo cáo hóa học:" Emerging role of microRNAs in diagnosis and treatment of various diseases including ovarian cancer" pdf

báo cáo hóa học:" Emerging role of microRNAs in diagnosis and treatment of various diseases including ovarian cancer" pdf

... degeneration of motor neurons It has been demonstrated that deletion or loss -of- function mutations in the survival of motor neuron (SMN) protein results in SMA [12] Gemin and Gemin are shared components ... components of SMN and miRNAcontaining ribonucleoprotein particles (miRNPs) Deletion or loss -of- function mutations of SMN in SMA may affect the activity of miRNPs due to possible redistribution or ... identified as one of the targets of miR-375 Inhibition of Myotrophin production has similar effects of miR-375 on insulin secretion, making miR-375 an important modulator of β-cell function Keller...

Ngày tải lên: 20/06/2014, 07:20

9 441 0
báo cáo hóa học: " A cohort study of short-term functional outcomes following injury: the role of pre-injury sociodemographic and health characteristics, injury and injury-related healthcare" pot

báo cáo hóa học: " A cohort study of short-term functional outcomes following injury: the role of pre-injury sociodemographic and health characteristics, injury and injury-related healthcare" pot

... an injury to one region only (exceptions to this were the associations between lower extremity and spine and back injuries and mobility problems, and injuries to the head and neck and cognitive ... functional outcome models, the contribution of a variable to the models was considered across all six of the models Pre-injury health status, age, gender and injury body region and type were considered ... resided in one of five ACC regions of New Zealand - Auckland, Manukau City, Gisborne, Otago, and Southland Each month, potential participants were selected from new ACC claimants ACC then sent, on our...

Ngày tải lên: 20/06/2014, 15:20

12 472 0
AUTISM SPECTRUM DISORDERS: THE ROLE OF GENETICS IN DIAGNOSIS AND TREATMENT pot

AUTISM SPECTRUM DISORDERS: THE ROLE OF GENETICS IN DIAGNOSIS AND TREATMENT pot

... points of convergence can include development and architecture of the synapse, and early developmental events in neurogenesis, neuronal cell migration and synaptogenesis Additionally, areas along ... approximately 10 -12 months of age Lack or delay of an alternating to -and- fro pattern of vocalizations between infant and parent, delay of onset of babbling, and decrease or no use of pre-speech gestures ... physical examinations, clinical observations, developmental evaluations, assessment of the strengths and weaknesses of the child, assessment of family functioning, administration of standardized diagnostic...

Ngày tải lên: 28/06/2014, 05:20

210 484 0
Báo cáo y học: "The role of leptin in innate and adaptive immune responses" doc

Báo cáo y học: "The role of leptin in innate and adaptive immune responses" doc

... state and could thus favor different immune and inflammatory responses To investigate the relative contributions of direct and indirect effects of leptin on the immune system in a normal environment, ... inflammation As mentioned above, leptin exerts various direct effects on cells involved in the immune and inflammatory responses However, the connection between leptin, immune responses and inflammation ... role of leptin in immune responses and inflammation has lately become increasingly evident Altered leptin production during infection and inflammation strongly suggests that leptin is a part of...

Ngày tải lên: 09/08/2014, 08:22

10 469 0
Báo cáo khoa hoc:" Role of HOXA7 to HOXA13 and PBX1 genes in various forms of MRKH syndrome (congenital absence of uterus and vagina)" ppt

Báo cáo khoa hoc:" Role of HOXA7 to HOXA13 and PBX1 genes in various forms of MRKH syndrome (congenital absence of uterus and vagina)" ppt

... HOXA-7 exon HOXA-9 exon (first half) HOXA-9 exon (second half) HOXA-9 exon HOXA-10 exon (first half) HOXA-10 exon (second half) HOXA-10 exon HOXA-11 exon (first half) HOXA-11 exon (second half) ... TGTTTGCTGATTGCTTCGAC PBX1 exon PBX1 exon PBX1 exon PBX1 exon PBX1 exon PBX1 exon PBX1 exon PBX1 exon is required for skeletal development and patterning [27], kidney morphogenesis [28] and especially, its ... spatiotemporal combinations to trigger positional identity of embryonic cells This determines the patterning and segment identity along the anterior-posterior axis of the skeleton and a variety of organ systems...

Ngày tải lên: 11/08/2014, 08:20

6 424 0
w