1 3 2 construction of a stress element for plane stress

... 1) 56.4( 8a) 1. 5 6.2d 1. 5 1. 4 7 .2 6.0 1. 9 1. 6 1. 2 1. 1 1. 2 1. 2 1. 3 1. 0 1. 2 1. 1 1. 1 4.6 1. 2 5.5 1. 5 1. 0d 1. 1 1. 1 1. 1 14 .3 13 JCHa 16 2( 2) 16 8(4) 16 0(6), 11 (8) 16 1(7) 4.7 4 .3 4.9 4.4 4.5 13 Determined ... 15 9 .36 14 5 .16 95.49 13 8 .33 12 4.68 8a 8b 11 0.48 15 4 .37 10 8. 71 1 02. 81 185.80 a [U- C6]Glucose Coupling constants (Hz) JCCa 73. 0 (2) , 62. 8(8b) 73. 0 (1) , 66 .3( 3) 66.8(4 ,2) 74.7(4), 64 .1( 8b) 66.8( 8a) ... intensities for C- 8a (Fig and % 13 13 C C in Table 1) On the basis of the overall 13 C abundance of C- 8a (4.9%), the molar contribution of [4b, 8a - 13 C2] - 13 was calculated as 1. 0 mol% (see Fig 7A) basis of...

Ngày tải lên: 08/03/2014, 02:21

... journal of combinatorics 13 (20 06), #R49 19 P 10 F G E 2 D C B a F 4’ 1 5’ 6’ 3 8’ 9’ 7’ 10 ’ E H 17 16 10 F B 11 12 18 15 b 20 c E 19 J 2 3 D 4’ 1 5’ 6’ B C 7’ 8’ 9’ 14 11 13 12 21 22 10 ’ ... 14 8’ 7’ B 6’ 11 ’ 13 1 9’ 12 10 3 N O 13 ’ 11 13 6’ 1 12 ’ O M 2 10 ’ 10 3 7’ B 12 2 8’ 11 14 ’ a P’ b Figure 15 : A 24 -tile configuration forced at any (0, 5, 1) vertex Figure 16 : Covering the ... hypotenuse of triangle 18 must be the electronic journal of combinatorics 13 (20 06), #R49 17 Q 20 19 M M 18 17 L 16 N 10 2 P N 15 K 11 ’ D 5’ 1 6’ 7’ C 18 17 L 16 19 a 10 2 P 15 K 11 ’ D 5’ 1 6’ 7’...

Ngày tải lên: 07/08/2014, 13:21

... fludarabine at a dose of 25 mg/m2 i.v on days to 3; cyclophosphamide at a dose of gr/m2 i.v on day and rituximab Page of at a dose of 37 5 mg/m2 was given on day of each cycle every 28 days Patients ... Research 2 011 , 30 :16 http://www.jeccr.com/content /30 /1/ 16 Table Patient characteristics Number of patients = Male/Female 3/ 6 Median Age (Range) 63 (46-77) years Disease stage at diagnosis at start of ... statistical analysis Author details Department of Hematology Regina Elena National Cancer Institute, Via Elio Chianesi, 53 0 0 12 8 Rome, Italy 2Department of Nuclear Medicine Regina Elena National Cancer...

Ngày tải lên: 10/08/2014, 10:21

... GGCGCGCCTTACTTGTACAGCTCGTCCATGC TCTAGACCAACCACCGGTGCCACCATGGTGAGCAAG GGGGAGCTCGCTAGCTGGATTTATCCTGATGAGTCCGTGAGGACG AAACTATAGGAAAGGAATTCCTATAGTCGATAAATCCAAAAGC CCCGCCGGCGGAGGGGTTAGCTGTGAGATTTTGCATCATTGATATATG ... CCCGCCGGCGGAGGGGTTAGCTGTGAGATTTTGCATCATTGATATATG TATGCTTTTGGATTTATCGACTATAGGAATTCCTT CCGCGGCCGCTCTAGAT25ATTGAAAATTTTAAAAACC CCGCGGCCGCTCTAGAT23ATATTGAAAATTTTAAAACC EcoRI 3HHribo2 NotIXbaIPolyAR NotIXbaIPolyA3R XbaI SacI HpaI AscI AscI ... CCGAATTCGTTAAATCCAAAAGCATACATATATCAATGATGC CCCGGGGCGGCCCCAAGGTCGAGAACTGAGTTG CCCGGGAGGAGTGACCGACTACTGCGTGAAGAAG GGTCTAGAGTATGATGCAGAAAATATTAAGG GAGCTCATGACTGCGGCTGCC GTTAACCAAGACTTCCTCTTCGGC GGCGCGCCATTCCGGTATATAAA...

Ngày tải lên: 12/08/2014, 04:20

... 92% for clade 2 .1 (Table 1) Table H5N1 clinical samples and rRT-PCR results Samples/virus clade NS TS TA Plas PF Stool Total 0 10 rRT-PCR positive Clade 10 Clade 2 .1 17 0 25 23 Clade 2 .3 2 23 ... 5’-TRTCTTGGGCRTGTGTAACA -3 15 2 -17 1 Probe 11 9 -14 3 5’-FAM-CAGGTTGACACAATAATGGAAAAGBHQ3 -3 a Y = T or C, R = A or G LNA residues in the probe are indicated in bold 5’ FAM = 5’ - carboxyfluorescein, BHQ = Black Hole ... potentially pandemic H5N1 influenza virus in eastern Asia Nature 20 04, 430 (6996) :20 9- 2 13 WHO: Evolution of H5N1 avian influenza viruses in Asia Emerg Infect Dis 20 05, 11 (10 ) :15 15 -15 21 Smith GJ, Naipospos...

Ngày tải lên: 12/08/2014, 04:21

... sỉ a sai x2 - 2x + x + 2 x -5 -5x2 + 10 x -15 x3 - x + x 23 x3 - 6x2 + x -15 b) (x2 - 2xy + y2).(x - y) = x3 - x2y - 2x2y + 2xy2 + xy2 Gv: Kiãøm tra bi lm ca tỉìng - y = x3 - 3x2y + 3xy2 - y3 hc ... våïi [ ?2] Lm nhán a) C1: (x + 3) .(x2 + 3x - 5) = x.x2 + x.3x + x.(-5) + 3. x2 + 3. 3x + 3. (-5) = x3 + 6x2 + 4x - 15 C2: x2 + 3x - x x + 3x + 9x - 15 + x3 + 3x2 - 5x x3 + 6x2 + 4x - 15 b) (xy - 1) (xy ... -> (2x - 3) .(x2 - 2x + 1) Hs: Hai em lãn bng thỉûc hiãûn, c låïp lm vo våí (2x - 3) .(x2 - 2x + 1) = 2x.(x2 - 2x + 1) - 3. (x2 - 2x + 1) = 2x3 - 4x2 + 2x - 3x2 + 6x - Gv: Nháûn xẹt v HD sỉ a sai...

Ngày tải lên: 23/07/2013, 01:27

... totals Finally, a SAM always has a matrix format 72 because of its emphasis on the identification of source and use of all transactions Summarizing, a SAM in our view serves as an alternative for ... that a SAM is meant to fit into the existing national statistical and planning infrastructure That is to say that, first, a SAM is typically built on the basis of data which are already available ... retabulates the raw data from the surveys, data already available (e.g the 1- 0 table) are scrutinized (e.g the treatment of the interest margin of banks), and data which are lacking are estimated...

Ngày tải lên: 06/03/2014, 21:20

... Keys for a Logical Table 11 0 11 2 11 3 Creating and Administering Logical Columns 11 3 Creating and Moving a Logical Column 11 4 Setting Default Levels of Aggregation for Measure Columns 11 5 Associating ... Oracle BI ODBC Data Source Names (DSNs) ODBC Conformance Level 2 61 Third-Party Tools and Relational Data Source Adapters Importing Metadata 25 9 26 2 2 63 Exchanging Metadata with Databases 2 63 ... LDAP Authentication Options 3 21 32 4 Setting Up LDAP Authentication 32 4 Setting Up External Table Authentication 32 6 Setting Up Database Authentication 32 7 About Oracle BI Delivers and Database Authentication...

Ngày tải lên: 07/03/2014, 01:20

... lawyer firm/investor/analyst bank/firm/station company AVERAGE Hypernym any majority 13 13 10 2 14 14 13 13 0 6 6.6 / 33 .0% 7.8 / 39 .0% Any hypernym majority any 13 13 10 11 17 18 14 14 14 14 ... simple algorithm: in depth-first order, # nouns 22 95 51 1 51 1 13 22 6 10 9 47 88 10 ,26 6 6,056 60 13 5 18 8 34 8 30 0 13 0 30 6 35 Table 1: The children of the root node examine the children of each internal ... Santorini, and Mary Ann Marcinkiewicz 19 93 Building a large annotated corpus of English: the Penn Treebank Computational Linguistics, 19 : 31 3 -33 0 Fernando Pereira, Naftali Tishby, and Lillian Lee 19 93...

Ngày tải lên: 08/03/2014, 06:20

... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGTTTTCGACACTGG TTTTGTCGACATGGCGCAACACGATGAAGC ... TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT ATCCAAAGTTTAGCCGATGACCCAAGCCAA TTGGCTTGGGTCATCGGCTAAACTTTGGAT AAACGCCTTCGCCCAAAGTTTAAAAGATGA...

Ngày tải lên: 16/03/2014, 01:20

... construction of the poneratoxin gene [11 ] Two oligonucleotides: forward 5¢-GATCCATGTTTCTTCCGCTTCTGATCCTTGGCT CTCTTCTGATGAC -3 and reverse 5¢-CGGCGTCATCA GAAGAGAGCCAAGGATCAGAAGCGGAAGAAA CATG -3 , were used ... N-terminal fragment of the poneratoxin gene Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG -3 and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGTATCAC GGG -3 were ... end of a signal peptide: 5¢-CAGAAGCGGAA GAAAGCATGCAAAGGCAGA -3 (number 2) , were used In the second PCR the plasmid pFastBacPx was used as a template with upstream and downstream primers containing,...

Ngày tải lên: 30/03/2014, 13:20

... 91. 9 98 .1 99.6 10 5.8 11 2 .3 C2 627 1S4 03 C188S 31 8 * C10862S2 53 C17498S 226 ** C28595S 225 C38503S 228 C1 511 1S2 82 C 224 27S2 23 C27 925 S 129 C1 517 6S465 C3 4 12 4S 511 C16 9 12 S265 C19002S3 23 C19 7 13 S 134 C20998S 134 ... C14 31 9 S 510 C1 422 6S5 23 C 136 48S 225 C 226 43S340 C20 821 S 4 13 C2 039 9S 426 C 129 02S674 Apam3 _16 6 C25444S1 73 C14487S1 91 C 133 54S446 C 134 86S 116 C25 23 4 S280 C 23 7 34S3 91 C1 535 1S256 C15493S507 C2 21 0 9S3 91 C25 536 S 620 C15056S244 ... C29463S468 C27 026 S4 72 C 115 20 S 633 C16774S7 91 C 23 0 85S1 83 C19 533 S2 41 C 21 9 14S2 31 C 115 35 S 517 C1 917 8S 536 C 111 4S 124 C 133 94S 333 C15 415 S 23 2 C16 634 S406 C 4 13 4S257 C5 23 9 4S280 C 225 26S 224 C 137 9 Wang et al R 126 .6 L6-M...

Ngày tải lên: 09/08/2014, 20:20

... Scaphoid stress fracture in a 13 year old gymnast: A case report J Hand Surg (Am) 20 00, 25 (4): 710 -3 Hanks GA, Kalenak A, Bowman LS, Sebastanelli WJ: Stress fracture of the carpal scaphoid, a ... report of cases J Bone Joint Surg Am 19 89, 71( 6): 938 - 41 Brutus JP, Chahidi N: Could this unusual scaphoid fracture occurring in a badminton player be a stress fracture? Chir Main 20 04, 23 (1) : 52- 4 ... sports As non union of a scaphoid fracture can cause degenerative arthritis of the radio-carpal articulation any sports person presenting with wrist pain should be investigated for a scaphoid fracture...

Ngày tải lên: 11/08/2014, 10:22

... Journal of Immune Based Therapies and Vaccines 20 05, 3: 4 Background Cutaneous T cell lymphoma (CTCL) is a malignant expansion of mature, clonal CD4 T cells with an affinity for epidermal localization ... Definition of TCR epitopes for CTL-mediated attack of cutaneous T cell lymphoma J Immunol 20 03, 17 1 :2 714 -27 24 Ackerman AL, Kyritsis C, Tampé R, Cresswell P: Access of soluble antigens to the endoplasmic ... 29 : 12 47 - 12 55 Reichardt VL, Brossart P, Kanz L: Dendritic cells in vaccination therapies of human malignant disease Blood Rev 20 04, 18 : 23 5 -2 43 Gong J, Koido S, Chen D, Tanaka Y, Huang L, Avigan D, Anderson...

Ngày tải lên: 11/08/2014, 10:23

... XI XII 12 2 10 2 11 1 83 14 3 10 8 67 12 1 13 0 98 76 10 0 cM cM cM cM cM cM cM cM cM cM cM cM :22 :25 :22 :22 :25 : 21 :20 : 23 : 23 :24 :24 :22 Potato chromosomes Length in cM : Number of integrated individual ... R1 0 /1 0 /14 0 /3 VI 5/5 8 / 12 Rpi-blb2 1/ 1 1/ 5 6/9 VII 3/ 3 9 / 12 Rpi1=Rpi-pnt1 0 /1 0/4 0 /2 VIII 6/6 12 / 13 RB, Rpi-blb1, Rpipta1, Rpi-plt1, Rpi-sto1 0/5 0 /2 3 /11 IX 1/ 1 9 / 13 Rpi-vnt1 .1, Rpivnt1 .2, ... map;/: no map was included because of a lack of common markers b Danan et al BMC Plant Biology 2 011 , 11 :16 http://www.biomedcentral.com /14 71- 22 29 /11 /16 Page of 16 c Resistance assay: FF: foliage...

Ngày tải lên: 11/08/2014, 11:21

... 26 27 References 10 11 12 13 14 15 16 17 18 19 20 21 22 Dubourg C, Bendavid C, Pasquier L, Henry C, Odent S, David V: Holoprosencephaly Orphanet J Rare Dis 20 07, 2: 8 Arnold WH, Sperber GH, Machin ... implications for normal and abnormal facial development J Craniofac Genet Dev Biol 19 82, 1: 3 81- 38 9 Wellik DM: Hox patterning of the vertebrate axial skeleton Dev Dyn 20 07, 23 6 :24 54 -24 63 Knight ... Mechanisms of doubling of the eye Doc Ophthalmol 19 92, 79 :2 01- 21 9 Arnold WH, Kleiner A: 3D reconstruction of the cardiovascular and central nervous system of a human embryo Carnegiestage 15 – case report...

Ngày tải lên: 11/08/2014, 20:20

... 0 0 15 6 12 1 65.8 51. 1 H17L NS10 × H17L H17L × R 130 94 94 16 6 12 2 0 0 0 0 16 6 12 2 70.0 51. 5 R 130 H17L × R 130 HR × R 130 94 18 8 12 6 7 92 0 10 9 0 10 0 12 6 10 01 - 27 2 WF1680 27 2 × WF1680 27 2 × WF1680 ... pV 27 7 24 4 27 7 24 0 22 8 ( 82 .3) 2 01 ( 83. 8) 504.6 (60 .3) 5 31 . 6 ( 63. 5) 2. 2 2. 6 27 2 WF1680 32 5 23 4 32 5 23 4 2 13 (65.5) 12 7 (54 .3) 829 .0 (99 .1) 5 71. 9 (68.4) 3. 9 4.5 NS10 H17L 27 7 28 8 19 6 19 5 18 0 ( 91. 8) ... 0. 41 (0.0 13 .6) 0. 71 LG3 11 9 .3 86.9 (22 .1 10 9.0) 22 6 22 47 29 5 (35 ) 0.40 (0.0–7 .1) 0.67 LG4 11 7.9 10 2. 2 (3. 8 10 6.0) 21 0 31 33 - 27 4 (39 ) 0. 43 (0.0–8 .3) 0.69 LG5 12 0.7 78 .1 ( 42. 6 12 0.7) 15 2 27 26 ...

Ngày tải lên: 12/08/2014, 03:20

... Malaysia National Science Fellowship (NSF) References 10 11 12 13 14 15 16 17 18 19 Stein IL, Leventhal ML: Amenorrhea associated with bilateral polycystic ovaries Am J Obstet Gynecol 19 35 , 29 :18 1 -19 1 ... Endocrinol Metab 20 07, 92 : 32 8 -33 7 http://www.tbiomed.com/content/6 /1/ 18 20 21 22 23 24 25 26 27 28 29 30 31 32 Wood JR, Dumesic DA, Abbott DH, Strauss JF III: Molecular abnormalities in oocytes from ... Biochem Sci 20 05, 30 (11 ): 630 -6 41 Innocente SA, Abrahamson JL, Cogswell JP, Lee JM: p 53 regulates a G2 checkpoint through cyclin B1 Proc Natl Acad Sci USA 19 99, 96: 21 4 7- 21 5 2 Reed MJ, Meszaros K, Entes...

Ngày tải lên: 13/08/2014, 16:20

... TB9 / 12 TB9 /14 9.1cM TB9 /22 46.9cM TB 11/ 38 TB 11/ 39 TB 11/ 40 TB 11/ 41 22 .6cM 12 .6cM 90.6cM TB 11/ 32 TB 11/ 7 TB 11/ 33 TB 11/ 10 TB 11/ 11 TB 11/ 13 TB 11/ 34 TB 11/ 35 TB 11/ 36 TB 11/ 15 TB 11/ 37 TB 11/ 42 9.7cM 6.7cM 2. 9cM ... 90.60 1. 20 13 .29 0.74 42. 40 0.94 22 . 13 0 .35 7 46.90 1. 65 35 .08 0.40 11 11 5.60 2 .30 19 .88 0.95 10 73 .10 2 .10 28 .67 0.65 10 c 12 76 .10 2. 50 32 .85 1. 08 11 21 88 .30 3. 42 38 .76 0. 71 24 .40 0. 61 Average ... TB8 /20 9.1cM TB5 /18 5.7cM 13 .0cM TB8 /19 TB10 /28 TB10 /29 TB10 /19 20 .3cM TB5 /16 TB10 /14 TB10 /26 TB10 /27 12 .6cM TB2/7 TB2/9 TB2 /10 TB2 / 12 16 .3cM 16 .3cM TB5 /15 6.1cM TB10 /24 TB10 /25 TB10 / 12 TB8 /18 29 .4cM...

Ngày tải lên: 14/08/2014, 20:22

... adjacent adatom-rest atom on the Si (11 1)-7×7 surface via the [2+ 2]-like cycloaddi8 Chapter tion in a stepwise diradical manner [ 12 2] as evidenced by STM [14 0], XPS [11 9, 13 3] , HREELS [14 1, 14 2] , ... to form the Si-C and Si-N σ bonds [11 1, 11 2] The attachment of phenylacetylene and diacetylene on Si (10 0) -2 1 and Si (11 1)-7×7 surfaces were investigated by Tao et al [14 4, 14 5] and Huang et al ... Si (11 1)-7×7 surface at 11 0 K: (a) condensed d3 acetonitrile multilayer on 3- chloro -1- propanol chemisorbed on Si (11 1)-7×7 surface; and (b) after irradiating sample (a) using 19 3 nm laser for 30 ...

Ngày tải lên: 14/09/2015, 08:43