1 3 2 construction of a stress element for plane stress

Báo cáo khoa học: Phenylalanine-independent biosynthesis of 1,3,5,8-tetrahydroxyxanthone A retrobiosynthetic NMR study with root cultures of Swertia chirata docx

Báo cáo khoa học: Phenylalanine-independent biosynthesis of 1,3,5,8-tetrahydroxyxanthone A retrobiosynthetic NMR study with root cultures of Swertia chirata docx

... 1) 56.4( 8a) 1. 5 6.2d 1. 5 1. 4 7 .2 6.0 1. 9 1. 6 1. 2 1. 1 1. 2 1. 2 1. 3 1. 0 1. 2 1. 1 1. 1 4.6 1. 2 5.5 1. 5 1. 0d 1. 1 1. 1 1. 1 14 .3 13 JCHa 16 2( 2) 16 8(4) 16 0(6), 11 (8) 16 1(7) 4.7 4 .3 4.9 4.4 4.5 13 Determined ... 15 9 .36 14 5 .16 95.49 13 8 .33 12 4.68 8a 8b 11 0.48 15 4 .37 10 8. 71 1 02. 81 185.80 a [U- C6]Glucose Coupling constants (Hz) JCCa 73. 0 (2) , 62. 8(8b) 73. 0 (1) , 66 .3( 3) 66.8(4 ,2) 74.7(4), 64 .1( 8b) 66.8( 8a) ... intensities for C- 8a (Fig and % 13 13 C C in Table 1) On the basis of the overall 13 C abundance of C- 8a (4.9%), the molar contribution of [4b, 8a - 13 C2] - 13 was calculated as 1. 0 mol% (see Fig 7A) basis of...

Ngày tải lên: 08/03/2014, 02:21

9 464 0
Báo cáo toán học: "Tilings of the sphere with right triangles II: The (1, 3, 2), (0, 2, n) subfamily" ppt

Báo cáo toán học: "Tilings of the sphere with right triangles II: The (1, 3, 2), (0, 2, n) subfamily" ppt

... journal of combinatorics 13 (20 06), #R49 19 P 10 F G E 2 D C B a F 4’ 1 5’ 6’ 3 8’ 9’ 7’ 10 ’ E H 17 16 10 F B 11 12 18 15 b 20 c E 19 J 2 3 D 4’ 1 5’ 6’ B C 7’ 8’ 9’ 14 11 13 12 21 22 10 ’ ... 14 8’ 7’ B 6’ 11 ’ 13 1 9’ 12 10 3 N O 13 ’ 11 13 6’ 1 12 ’ O M 2 10 ’ 10 3 7’ B 12 2 8’ 11 14 ’ a P’ b Figure 15 : A 24 -tile configuration forced at any (0, 5, 1) vertex Figure 16 : Covering the ... hypotenuse of triangle 18 must be the electronic journal of combinatorics 13 (20 06), #R49 17 Q 20 19 M M 18 17 L 16 N 10 2 P N 15 K 11 ’ D 5’ 1 6’ 7’ C 18 17 L 16 19 a 10 2 P 15 K 11 ’ D 5’ 1 6’ 7’...

Ngày tải lên: 07/08/2014, 13:21

22 419 0
báo cáo khoa học: " FCR (Fludarabine, Cyclophosphamide, Rituximab) regimen followed by 90yttrium ibritumomab tiuxetan consolidation for the treatment of relapsed grades 1 and 2 follicular lymphoma: a report of 9 cases" pot

báo cáo khoa học: " FCR (Fludarabine, Cyclophosphamide, Rituximab) regimen followed by 90yttrium ibritumomab tiuxetan consolidation for the treatment of relapsed grades 1 and 2 follicular lymphoma: a report of 9 cases" pot

... fludarabine at a dose of 25 mg/m2 i.v on days to 3; cyclophosphamide at a dose of gr/m2 i.v on day and rituximab Page of at a dose of 37 5 mg/m2 was given on day of each cycle every 28 days Patients ... Research 2 011 , 30 :16 http://www.jeccr.com/content /30 /1/ 16 Table Patient characteristics Number of patients = Male/Female 3/ 6 Median Age (Range) 63 (46-77) years Disease stage at diagnosis at start of ... statistical analysis Author details Department of Hematology Regina Elena National Cancer Institute, Via Elio Chianesi, 53 0 0 12 8 Rome, Italy 2Department of Nuclear Medicine Regina Elena National Cancer...

Ngày tải lên: 10/08/2014, 10:21

5 288 0
Báo cáo khoa học: " Characterization of untranslated regions of the salmonid alphavirus 3 (SAV3) genome and construction of a SAV3 based replicon" ppsx

Báo cáo khoa học: " Characterization of untranslated regions of the salmonid alphavirus 3 (SAV3) genome and construction of a SAV3 based replicon" ppsx

... GGCGCGCCTTACTTGTACAGCTCGTCCATGC TCTAGACCAACCACCGGTGCCACCATGGTGAGCAAG GGGGAGCTCGCTAGCTGGATTTATCCTGATGAGTCCGTGAGGACG AAACTATAGGAAAGGAATTCCTATAGTCGATAAATCCAAAAGC CCCGCCGGCGGAGGGGTTAGCTGTGAGATTTTGCATCATTGATATATG ... CCCGCCGGCGGAGGGGTTAGCTGTGAGATTTTGCATCATTGATATATG TATGCTTTTGGATTTATCGACTATAGGAATTCCTT CCGCGGCCGCTCTAGAT25ATTGAAAATTTTAAAAACC CCGCGGCCGCTCTAGAT23ATATTGAAAATTTTAAAACC EcoRI 3HHribo2 NotIXbaIPolyAR NotIXbaIPolyA3R XbaI SacI HpaI AscI AscI ... CCGAATTCGTTAAATCCAAAAGCATACATATATCAATGATGC CCCGGGGCGGCCCCAAGGTCGAGAACTGAGTTG CCCGGGAGGAGTGACCGACTACTGCGTGAAGAAG GGTCTAGAGTATGATGCAGAAAATATTAAGG GAGCTCATGACTGCGGCTGCC GTTAACCAAGACTTCCTCTTCGGC GGCGCGCCATTCCGGTATATAAA...

Ngày tải lên: 12/08/2014, 04:20

6 270 0
Báo cáo khoa học: " A real-time RT-PCR for detection of clade 1 and 2 H5N1 Influenza A virus using Locked Nucleic Acid (LNA) TaqMan probes" pps

Báo cáo khoa học: " A real-time RT-PCR for detection of clade 1 and 2 H5N1 Influenza A virus using Locked Nucleic Acid (LNA) TaqMan probes" pps

... 92% for clade 2 .1 (Table 1) Table H5N1 clinical samples and rRT-PCR results Samples/virus clade NS TS TA Plas PF Stool Total 0 10 rRT-PCR positive Clade 10 Clade 2 .1 17 0 25 23 Clade 2 .3 2 23 ... 5’-TRTCTTGGGCRTGTGTAACA -3 15 2 -17 1 Probe 11 9 -14 3 5’-FAM-CAGGTTGACACAATAATGGAAAAGBHQ3 -3 a Y = T or C, R = A or G LNA residues in the probe are indicated in bold 5’ FAM = 5’ - carboxyfluorescein, BHQ = Black Hole ... potentially pandemic H5N1 influenza virus in eastern Asia Nature 20 04, 430 (6996) :20 9- 2 13 WHO: Evolution of H5N1 avian influenza viruses in Asia Emerg Infect Dis 20 05, 11 (10 ) :15 15 -15 21 Smith GJ, Naipospos...

Ngày tải lên: 12/08/2014, 04:21

5 460 0
Đại số (1-3), 2 cột mới

Đại số (1-3), 2 cột mới

... sỉ a sai x2 - 2x + x + 2 x -5 -5x2 + 10 x -15 x3 - x + x 23 x3 - 6x2 + x -15 b) (x2 - 2xy + y2).(x - y) = x3 - x2y - 2x2y + 2xy2 + xy2 Gv: Kiãøm tra bi lm ca tỉìng - y = x3 - 3x2y + 3xy2 - y3 hc ... våïi [ ?2] Lm nhán a) C1: (x + 3) .(x2 + 3x - 5) = x.x2 + x.3x + x.(-5) + 3. x2 + 3. 3x + 3. (-5) = x3 + 6x2 + 4x - 15 C2: x2 + 3x - x x + 3x + 9x - 15 + x3 + 3x2 - 5x x3 + 6x2 + 4x - 15 b) (xy - 1) (xy ... -> (2x - 3) .(x2 - 2x + 1) Hs: Hai em lãn bng thỉûc hiãûn, c låïp lm vo våí (2x - 3) .(x2 - 2x + 1) = 2x.(x2 - 2x + 1) - 3. (x2 - 2x + 1) = 2x3 - 4x2 + 2x - 3x2 + 6x - Gv: Nháûn xẹt v HD sỉ a sai...

Ngày tải lên: 23/07/2013, 01:27

9 281 0
GUIDELINES TO THE CONSTRUCTION OF A SOCIAL ACCOUNTING MATRIX ppt

GUIDELINES TO THE CONSTRUCTION OF A SOCIAL ACCOUNTING MATRIX ppt

... totals Finally, a SAM always has a matrix format 72 because of its emphasis on the identification of source and use of all transactions Summarizing, a SAM in our view serves as an alternative for ... that a SAM is meant to fit into the existing national statistical and planning infrastructure That is to say that, first, a SAM is typically built on the basis of data which are already available ... retabulates the raw data from the surveys, data already available (e.g the 1- 0 table) are scrutinized (e.g the treatment of the interest margin of banks), and data which are lacking are estimated...

Ngày tải lên: 06/03/2014, 21:20

30 520 0
Oracle® Business Intelligence Server Administration Guide: Version 10.1.3.2 ppt

Oracle® Business Intelligence Server Administration Guide: Version 10.1.3.2 ppt

... Keys for a Logical Table 11 0 11 2 11 3 Creating and Administering Logical Columns 11 3 Creating and Moving a Logical Column 11 4 Setting Default Levels of Aggregation for Measure Columns 11 5 Associating ... Oracle BI ODBC Data Source Names (DSNs) ODBC Conformance Level 2 61 Third-Party Tools and Relational Data Source Adapters Importing Metadata 25 9 26 2 2 63 Exchanging Metadata with Databases 2 63 ... LDAP Authentication Options 3 21 32 4 Setting Up LDAP Authentication 32 4 Setting Up External Table Authentication 32 6 Setting Up Database Authentication 32 7 About Oracle BI Delivers and Database Authentication...

Ngày tải lên: 07/03/2014, 01:20

432 7,6K 1
Báo cáo khoa học: "Automatic construction of a hypernym-labeled noun hierarchy from text" docx

Báo cáo khoa học: "Automatic construction of a hypernym-labeled noun hierarchy from text" docx

... lawyer firm/investor/analyst bank/firm/station company AVERAGE Hypernym any majority 13 13 10 2 14 14 13 13 0 6 6.6 / 33 .0% 7.8 / 39 .0% Any hypernym majority any 13 13 10 11 17 18 14 14 14 14 ... simple algorithm: in depth-first order, # nouns 22 95 51 1 51 1 13 22 6 10 9 47 88 10 ,26 6 6,056 60 13 5 18 8 34 8 30 0 13 0 30 6 35 Table 1: The children of the root node examine the children of each internal ... Santorini, and Mary Ann Marcinkiewicz 19 93 Building a large annotated corpus of English: the Penn Treebank Computational Linguistics, 19 : 31 3 -33 0 Fernando Pereira, Naftali Tishby, and Lillian Lee 19 93...

Ngày tải lên: 08/03/2014, 06:20

7 418 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGTTTTCGACACTGG TTTTGTCGACATGGCGCAACACGATGAAGC ... TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT ATCCAAAGTTTAGCCGATGACCCAAGCCAA TTGGCTTGGGTCATCGGCTAAACTTTGGAT AAACGCCTTCGCCCAAAGTTTAAAAGATGA...

Ngày tải lên: 16/03/2014, 01:20

9 444 0
Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot

Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot

... construction of the poneratoxin gene [11 ] Two oligonucleotides: forward 5¢-GATCCATGTTTCTTCCGCTTCTGATCCTTGGCT CTCTTCTGATGAC -3 and reverse 5¢-CGGCGTCATCA GAAGAGAGCCAAGGATCAGAAGCGGAAGAAA CATG -3 , were used ... N-terminal fragment of the poneratoxin gene Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG -3 and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGTATCAC GGG -3 were ... end of a signal peptide: 5¢-CAGAAGCGGAA GAAAGCATGCAAAGGCAGA -3 (number 2) , were used In the second PCR the plasmid pFastBacPx was used as a template with upstream and downstream primers containing,...

Ngày tải lên: 30/03/2014, 13:20

10 696 0
Báo cáo y học: "Construction of a high-resolution genetic linkage map and comparative genome analysis for the reef-building coral Acropora millepora" ppt

Báo cáo y học: "Construction of a high-resolution genetic linkage map and comparative genome analysis for the reef-building coral Acropora millepora" ppt

... 91. 9 98 .1 99.6 10 5.8 11 2 .3 C2 627 1S4 03 C188S 31 8 * C10862S2 53 C17498S 226 ** C28595S 225 C38503S 228 C1 511 1S2 82 C 224 27S2 23 C27 925 S 129 C1 517 6S465 C3 4 12 4S 511 C16 9 12 S265 C19002S3 23 C19 7 13 S 134 C20998S 134 ... C14 31 9 S 510 C1 422 6S5 23 C 136 48S 225 C 226 43S340 C20 821 S 4 13 C2 039 9S 426 C 129 02S674 Apam3 _16 6 C25444S1 73 C14487S1 91 C 133 54S446 C 134 86S 116 C25 23 4 S280 C 23 7 34S3 91 C1 535 1S256 C15493S507 C2 21 0 9S3 91 C25 536 S 620 C15056S244 ... C29463S468 C27 026 S4 72 C 115 20 S 633 C16774S7 91 C 23 0 85S1 83 C19 533 S2 41 C 21 9 14S2 31 C 115 35 S 517 C1 917 8S 536 C 111 4S 124 C 133 94S 333 C15 415 S 23 2 C16 634 S406 C 4 13 4S257 C5 23 9 4S280 C 225 26S 224 C 137 9 Wang et al R 126 .6 L6-M...

Ngày tải lên: 09/08/2014, 20:20

17 269 0
Báo cáo y học: "Non union of scaphoid fracture in a cricketer – possibility of a stress fracture: a case report" ppsx

Báo cáo y học: "Non union of scaphoid fracture in a cricketer – possibility of a stress fracture: a case report" ppsx

... Scaphoid stress fracture in a 13 year old gymnast: A case report J Hand Surg (Am) 20 00, 25 (4): 710 -3 Hanks GA, Kalenak A, Bowman LS, Sebastanelli WJ: Stress fracture of the carpal scaphoid, a ... report of cases J Bone Joint Surg Am 19 89, 71( 6): 938 - 41 Brutus JP, Chahidi N: Could this unusual scaphoid fracture occurring in a badminton player be a stress fracture? Chir Main 20 04, 23 (1) : 52- 4 ... sports As non union of a scaphoid fracture can cause degenerative arthritis of the radio-carpal articulation any sports person presenting with wrist pain should be investigated for a scaphoid fracture...

Ngày tải lên: 11/08/2014, 10:22

2 222 0
Báo cáo y học: "Rapid construction of a dendritic cell vaccine through physical perturbation and apoptotic malignant T cell loading" pot

Báo cáo y học: "Rapid construction of a dendritic cell vaccine through physical perturbation and apoptotic malignant T cell loading" pot

... Journal of Immune Based Therapies and Vaccines 20 05, 3: 4 Background Cutaneous T cell lymphoma (CTCL) is a malignant expansion of mature, clonal CD4 T cells with an affinity for epidermal localization ... Definition of TCR epitopes for CTL-mediated attack of cutaneous T cell lymphoma J Immunol 20 03, 17 1 :2 714 -27 24 Ackerman AL, Kyritsis C, Tampé R, Cresswell P: Access of soluble antigens to the endoplasmic ... 29 : 12 47 - 12 55 Reichardt VL, Brossart P, Kanz L: Dendritic cells in vaccination therapies of human malignant disease Blood Rev 20 04, 18 : 23 5 -2 43 Gong J, Koido S, Chen D, Tanaka Y, Huang L, Avigan D, Anderson...

Ngày tải lên: 11/08/2014, 10:23

16 251 0
báo cáo khoa học: " Construction of a potato consensus map and QTL meta-analysis offer new insights into the genetic architecture of late blight resistance and plant maturity traits" pps

báo cáo khoa học: " Construction of a potato consensus map and QTL meta-analysis offer new insights into the genetic architecture of late blight resistance and plant maturity traits" pps

... XI XII 12 2 10 2 11 1 83 14 3 10 8 67 12 1 13 0 98 76 10 0 cM cM cM cM cM cM cM cM cM cM cM cM :22 :25 :22 :22 :25 : 21 :20 : 23 : 23 :24 :24 :22 Potato chromosomes Length in cM : Number of integrated individual ... R1 0 /1 0 /14 0 /3 VI 5/5 8 / 12 Rpi-blb2 1/ 1 1/ 5 6/9 VII 3/ 3 9 / 12 Rpi1=Rpi-pnt1 0 /1 0/4 0 /2 VIII 6/6 12 / 13 RB, Rpi-blb1, Rpipta1, Rpi-plt1, Rpi-sto1 0/5 0 /2 3 /11 IX 1/ 1 9 / 13 Rpi-vnt1 .1, Rpivnt1 .2, ... map;/: no map was included because of a lack of common markers b Danan et al BMC Plant Biology 2 011 , 11 :16 http://www.biomedcentral.com /14 71- 22 29 /11 /16 Page of 16 c Resistance assay: FF: foliage...

Ngày tải lên: 11/08/2014, 11:21

17 593 0
báo cáo khoa học: " 3-D reconstruction of a human fetus with combined holoprosencephaly and cyclopia" pptx

báo cáo khoa học: " 3-D reconstruction of a human fetus with combined holoprosencephaly and cyclopia" pptx

... 26 27 References 10 11 12 13 14 15 16 17 18 19 20 21 22 Dubourg C, Bendavid C, Pasquier L, Henry C, Odent S, David V: Holoprosencephaly Orphanet J Rare Dis 20 07, 2: 8 Arnold WH, Sperber GH, Machin ... implications for normal and abnormal facial development J Craniofac Genet Dev Biol 19 82, 1: 3 81- 38 9 Wellik DM: Hox patterning of the vertebrate axial skeleton Dev Dyn 20 07, 23 6 :24 54 -24 63 Knight ... Mechanisms of doubling of the eye Doc Ophthalmol 19 92, 79 :2 01- 21 9 Arnold WH, Kleiner A: 3D reconstruction of the cardiovascular and central nervous system of a human embryo Carnegiestage 15 – case report...

Ngày tải lên: 11/08/2014, 20:20

11 292 0
báo cáo khoa học: " Construction of a consensus linkage map for red clover (Trifolium pratense L.)" docx

báo cáo khoa học: " Construction of a consensus linkage map for red clover (Trifolium pratense L.)" docx

... 0 0 15 6 12 1 65.8 51. 1 H17L NS10 × H17L H17L × R 130 94 94 16 6 12 2 0 0 0 0 16 6 12 2 70.0 51. 5 R 130 H17L × R 130 HR × R 130 94 18 8 12 6 7 92 0 10 9 0 10 0 12 6 10 01 - 27 2 WF1680 27 2 × WF1680 27 2 × WF1680 ... pV 27 7 24 4 27 7 24 0 22 8 ( 82 .3) 2 01 ( 83. 8) 504.6 (60 .3) 5 31 . 6 ( 63. 5) 2. 2 2. 6 27 2 WF1680 32 5 23 4 32 5 23 4 2 13 (65.5) 12 7 (54 .3) 829 .0 (99 .1) 5 71. 9 (68.4) 3. 9 4.5 NS10 H17L 27 7 28 8 19 6 19 5 18 0 ( 91. 8) ... 0. 41 (0.0 13 .6) 0. 71 LG3 11 9 .3 86.9 (22 .1 10 9.0) 22 6 22 47 29 5 (35 ) 0.40 (0.0–7 .1) 0.67 LG4 11 7.9 10 2. 2 (3. 8 10 6.0) 21 0 31 33 - 27 4 (39 ) 0. 43 (0.0–8 .3) 0.69 LG5 12 0.7 78 .1 ( 42. 6 12 0.7) 15 2 27 26 ...

Ngày tải lên: 12/08/2014, 03:20

11 251 0
Báo cáo y học: " Construction of a polycystic ovarian syndrome (PCOS) pathway based on the interactions of PCOS-related proteins retrieved from bibliomic data" docx

Báo cáo y học: " Construction of a polycystic ovarian syndrome (PCOS) pathway based on the interactions of PCOS-related proteins retrieved from bibliomic data" docx

... Malaysia National Science Fellowship (NSF) References 10 11 12 13 14 15 16 17 18 19 Stein IL, Leventhal ML: Amenorrhea associated with bilateral polycystic ovaries Am J Obstet Gynecol 19 35 , 29 :18 1 -19 1 ... Endocrinol Metab 20 07, 92 : 32 8 -33 7 http://www.tbiomed.com/content/6 /1/ 18 20 21 22 23 24 25 26 27 28 29 30 31 32 Wood JR, Dumesic DA, Abbott DH, Strauss JF III: Molecular abnormalities in oocytes from ... Biochem Sci 20 05, 30 (11 ): 630 -6 41 Innocente SA, Abrahamson JL, Cogswell JP, Lee JM: p 53 regulates a G2 checkpoint through cyclin B1 Proc Natl Acad Sci USA 19 99, 96: 21 4 7- 21 5 2 Reed MJ, Meszaros K, Entes...

Ngày tải lên: 13/08/2014, 16:20

7 358 0
Báo cáo y học: "Genetic analysis of the human infective trypanosome Trypanosoma brucei gambiense: chromosomal segregation, crossing over, and the construction of a genetic map" doc

Báo cáo y học: "Genetic analysis of the human infective trypanosome Trypanosoma brucei gambiense: chromosomal segregation, crossing over, and the construction of a genetic map" doc

... TB9 / 12 TB9 /14 9.1cM TB9 /22 46.9cM TB 11/ 38 TB 11/ 39 TB 11/ 40 TB 11/ 41 22 .6cM 12 .6cM 90.6cM TB 11/ 32 TB 11/ 7 TB 11/ 33 TB 11/ 10 TB 11/ 11 TB 11/ 13 TB 11/ 34 TB 11/ 35 TB 11/ 36 TB 11/ 15 TB 11/ 37 TB 11/ 42 9.7cM 6.7cM 2. 9cM ... 90.60 1. 20 13 .29 0.74 42. 40 0.94 22 . 13 0 .35 7 46.90 1. 65 35 .08 0.40 11 11 5.60 2 .30 19 .88 0.95 10 73 .10 2 .10 28 .67 0.65 10 c 12 76 .10 2. 50 32 .85 1. 08 11 21 88 .30 3. 42 38 .76 0. 71 24 .40 0. 61 Average ... TB8 /20 9.1cM TB5 /18 5.7cM 13 .0cM TB8 /19 TB10 /28 TB10 /29 TB10 /19 20 .3cM TB5 /16 TB10 /14 TB10 /26 TB10 /27 12 .6cM TB2/7 TB2/9 TB2 /10 TB2 / 12 16 .3cM 16 .3cM TB5 /15 6.1cM TB10 /24 TB10 /25 TB10 / 12 TB8 /18 29 .4cM...

Ngày tải lên: 14/08/2014, 20:22

12 281 0
Adsorption of halogenated organic molecules and photo induced construction of a covalently bonded second organic layer on silicon surfaces

Adsorption of halogenated organic molecules and photo induced construction of a covalently bonded second organic layer on silicon surfaces

... adjacent adatom-rest atom on the Si (11 1)-7×7 surface via the [2+ 2]-like cycloaddi8 Chapter tion in a stepwise diradical manner [ 12 2] as evidenced by STM [14 0], XPS [11 9, 13 3] , HREELS [14 1, 14 2] , ... to form the Si-C and Si-N σ bonds [11 1, 11 2] The attachment of phenylacetylene and diacetylene on Si (10 0) -2 1 and Si (11 1)-7×7 surfaces were investigated by Tao et al [14 4, 14 5] and Huang et al ... Si (11 1)-7×7 surface at 11 0 K: (a) condensed d3 acetonitrile multilayer on 3- chloro -1- propanol chemisorbed on Si (11 1)-7×7 surface; and (b) after irradiating sample (a) using 19 3 nm laser for 30 ...

Ngày tải lên: 14/09/2015, 08:43

207 640 0

Bạn có muốn tìm thêm với từ khóa:

w