1 3 1 construction of a stress element for axial stress

... Petersburg, FL, USA) followed by PCR with Taq DNA polymerase (Promega, Madison, WT, USA) using the primers 5¢-CACACTACACTGGGAAGCAGAGACTCCAGC -3 and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG3¢ The cDNA was subcloned ... but as an apparent ligand for Patched Proc Natl Acad Sci USA 96, 10 992 10 999 35 Henikoff S & Henikoff JG (19 93) Performance evaluation of amino acid substitution matrices Proteins 17 , 49– 61 36 ... The Authors Journal compilation ª 2007 FEBS 32 9 A negative regulator for palmitoylation of Shh 10 11 12 13 14 15 16 33 0 Y Abe et al polarity gene hh is expressed in tissues with polarizing activity...

Ngày tải lên: 18/02/2014, 16:20

... I 137 A I 138 A N 139 A D14 0A W14 1A V14 2A K14 3A T14 4A H14 5A T14 6A K14 7A M14 9A N15 2A E28 3A E28 5A K32 5A K32 7A PAI-1stab PAI-1stab(E28 5A) 74 91 80 59 74 51 90 57 88 18 52 63 32 88 77 75 87 10 13 33 97 82 ... for at least three independent measurements are given for each variant PAI -1 variant Activity (%) t½ (min) Wild-type T9 6A F10 0A V12 6A F12 8A S12 9A E 130 A V 131 A E 132 A R 133 A R 135 A F 136 A I 137 A I 138 A ... indistinguishable results: wild-type, PAI -1( T9 6A) , PAI1(F10 0A) , PAI -1( V12 6A) , PAI -1( F12 8A) , PAI -1( I 137 A) , PAI -1( I 138 A) , PAI -1( N 139 A) , PAI -1( W14 1A) , PAI1(T14 6A) and PAI -1( M149K) Structural analysis...

Ngày tải lên: 20/02/2014, 11:20

... – 2A – 1A QN + 1A + 2A + 3A + 4A + 5A + 6A + 7A + 8A + 9A Fig Assessment of the contribution of each amino acid residue of K5 to substrate recognition Alanine substitution mutants of K5 were produced as ... 4 91 498 16 Hitomi K, Presland RB, Nakayama T, Fleckman P, Dale BA & Maki M (20 03) Analysis of epidermal-type transglutaminase (transglutaminase 3) in human stratified epithelia and cultured keratinocytes ... Ipswich, MA, USA) [33 ] Briefly, approximately 1. 5 · 10 11 (1st round panning) or · 10 12 ) 13 (2nd to 5th round panning) phage clones were incubated at 37 °C with TGase (10 ngÆlL )1) in 10 mm Tris...

Ngày tải lên: 23/03/2014, 06:20

... Trauma (BOAST), 2007 www.boa.ac.uk (last accessed 09/02/2 011 ) National Hip Fracture Database (NHFD) The National Hip Fracture Database National Report 2 010 www.nhfd.co.uk (last accessed 09/02/2 011 ) ... cohort back to A& E Similarly, cardiovascular and cerbrovascular pathology accounted for 11 % of re-admissions The orthogeriatric team may be able to optimise patients medically in preparation for ... Medical/surgical illness 23 2 22 Cardiovascular Myocardial infarction/ACS Cardiac failure Arrhythmia Infection Chest Urinary tract Skin Wound Septicaemia/sepsis ? cause 19 11 Neurological/Psychiatric...

Ngày tải lên: 20/06/2014, 07:20

... pmol/reaction) for ABCA1 (forward primer 5'-GAAGTACATCAGAACATGGGC -3' and reverse primer 5'GATCAAAGCCATGGCTGTAG -3' with 234 -base pair amplified fragment) and 27-hydroxylase The cholesterol 27-hydroxylase-specific ... arterial endothelium and macrophages J Lipid Res 20 01, 42 :19 13 -19 22 Page 10 of 11 (page number not for citation purposes) 11 Reiss AB, Patel CA, Rahman MM, Chan ES, Hasneen K, Montesinos MC, Trachman ... Chicago, IL, USA) Data was analyzed using the Kruskal-Wallis one-way analysis of variance on ranks Pairwise multiple comparison was made with the Holm-Sidak method Foam cell formation and staining...

Ngày tải lên: 09/08/2014, 10:20

... GGCGCGCCTTACTTGTACAGCTCGTCCATGC TCTAGACCAACCACCGGTGCCACCATGGTGAGCAAG GGGGAGCTCGCTAGCTGGATTTATCCTGATGAGTCCGTGAGGACG AAACTATAGGAAAGGAATTCCTATAGTCGATAAATCCAAAAGC CCCGCCGGCGGAGGGGTTAGCTGTGAGATTTTGCATCATTGATATATG ... CCCGCCGGCGGAGGGGTTAGCTGTGAGATTTTGCATCATTGATATATG TATGCTTTTGGATTTATCGACTATAGGAATTCCTT CCGCGGCCGCTCTAGAT25ATTGAAAATTTTAAAAACC CCGCGGCCGCTCTAGAT23ATATTGAAAATTTTAAAACC EcoRI 3HHribo2 NotIXbaIPolyAR NotIXbaIPolyA3R XbaI SacI HpaI AscI AscI ... CCGAATTCGTTAAATCCAAAAGCATACATATATCAATGATGC CCCGGGGCGGCCCCAAGGTCGAGAACTGAGTTG CCCGGGAGGAGTGACCGACTACTGCGTGAAGAAG GGTCTAGAGTATGATGCAGAAAATATTAAGG GAGCTCATGACTGCGGCTGCC GTTAACCAAGACTTCCTCTTCGGC GGCGCGCCATTCCGGTATATAAA GGCGCGCCTTACTTGTACAGCTCGTCCATGC...

Ngày tải lên: 12/08/2014, 04:20

... 11 human caspases has been identified Initiator caspases including caspase -1, 2, 4, 5, 9, 11 and 12 interact with upstream adapter molecules and once activated lead to downstream activation of ... NHE1 34 I.7 Conclusion 35 Chapter II Materials and methods 37 II .1 Chemicals 37 II.2 Cells 37 II .3 cDNA Plasmids and transfections 40 II.4 β-Galactosidase Survival Assay 41 II. 4a Measurement of ... most of the cells, if not all It’s a membrane glycoprotein of approximately 10 0 kDa containing around 815 Amino Acids (membrane domain of about 500 amino acids and a large cytoplasmic “tail” of about...

Ngày tải lên: 16/09/2015, 08:31

... totals Finally, a SAM always has a matrix format 72 because of its emphasis on the identification of source and use of all transactions Summarizing, a SAM in our view serves as an alternative for ... that a SAM is meant to fit into the existing national statistical and planning infrastructure That is to say that, first, a SAM is typically built on the basis of data which are already available ... retabulates the raw data from the surveys, data already available (e.g the 1- 0 table) are scrutinized (e.g the treatment of the interest margin of banks), and data which are lacking are estimated...

Ngày tải lên: 06/03/2014, 21:20

... lawyer firm/investor/analyst bank/firm/station company AVERAGE Hypernym any majority 13 13 10 2 14 14 13 13 0 6 6.6 / 33 .0% 7.8 / 39 .0% Any hypernym majority any 13 13 10 11 17 18 14 14 14 14 ... Very Large Corpora, pages 12 7 - 13 3 Association for Computational Linguistics Christiane Fellbaum, editor 19 98 WordNet: An Electronic Lexical Database MIT Press Marti A Hearst 19 92 Automatic acquisition ... Marcinkiewicz 19 93 Building a large annotated corpus of English: the Penn Treebank Computational Linguistics, 19 : 31 3 -33 0 Fernando Pereira, Naftali Tishby, and Lillian Lee 19 93 Distributional clustering of...

Ngày tải lên: 08/03/2014, 06:20

... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGTTTTCGACACTGG TTTTGTCGACATGGCGCAACACGATGAAGC ... TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT ATCCAAAGTTTAGCCGATGACCCAAGCCAA TTGGCTTGGGTCATCGGCTAAACTTTGGAT AAACGCCTTCGCCCAAAGTTTAAAAGATGA...

Ngày tải lên: 16/03/2014, 01:20

... construction of the poneratoxin gene [11 ] Two oligonucleotides: forward 5¢-GATCCATGTTTCTTCCGCTTCTGATCCTTGGCT CTCTTCTGATGAC -3 and reverse 5¢-CGGCGTCATCA GAAGAGAGCCAAGGATCAGAAGCGGAAGAAA CATG -3 , were used ... N-terminal fragment of the poneratoxin gene Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG -3 and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGTATCAC GGG -3 were ... end of a signal peptide: 5¢-CAGAAGCGGAA GAAAGCATGCAAAGGCAGA -3 (number 2), were used In the second PCR the plasmid pFastBacPx was used as a template with upstream and downstream primers containing,...

Ngày tải lên: 30/03/2014, 13:20

... C19560S178 C1 211 8S364 ** C16269S320 C 23 019 S 237 7.0 C19560S178 11 .3 C1 515 0S9 31 C40003S97 C1 6 13 6S488 0.0 C19881S196 33 .1 35 .2 C30854S 31 4 C19881S196 19 .0 C1 419 S 31 5 * 39 .8 C1 419 S 31 5 * C16867S4 73 C986S247 ... 99.4 10 0.9 10 2.7 10 4 .1 108.7 11 2.5 11 9.7 12 4 .3 14 1.0 C17479S262 C15084S 136 C24 438 S225 C1 436 4S490 C3724S507 EST007 C14 018 S197 C19797S3 31 C2 715 3S258 C1 836 3S4 21 C 7 13 4S 210 C 139 90S3 41 C29226S2 81 C1 733 0S1 21 ... 41. 3 44.4 C 13 31 5 S 616 C19552S147 C 110 40S 31 2 35 .4 37 .0 C22687S2 31 C1 916 8S356 C294S372 C 139 65S176 C19502S5 41 C1 916 8S356 76 .1 80.0 C 110 40S 31 2 C16499S3 63 44 .1 46.0 48.8 61. 1 63. 7 68.4 C294S372 C 211 64S307...

Ngày tải lên: 09/08/2014, 20:20

... Scaphoid stress fracture in a 13 year old gymnast: A case report J Hand Surg (Am) 2000, 25(4): 710 -3 Hanks GA, Kalenak A, Bowman LS, Sebastanelli WJ: Stress fracture of the carpal scaphoid, a ... sports As non union of a scaphoid fracture can cause degenerative arthritis of the radio-carpal articulation any sports person presenting with wrist pain should be investigated for a scaphoid fracture ... ciated radiocarpal arthritis Scaphoid views showing non union of the scaphoid with assoScaphoid views showing non union of the scaphoid with associated radiocarpal arthritis in the stress fracture...

Ngày tải lên: 11/08/2014, 10:22

... Journal of Immune Based Therapies and Vaccines 2005, 3: 4 Background Cutaneous T cell lymphoma (CTCL) is a malignant expansion of mature, clonal CD4 T cells with an affinity for epidermal localization ... citation purposes) Journal of Immune Based Therapies and Vaccines 2005, 3: 4 http://www.jibtherapies.com/content /3 /1/ 4 Figure Statistical analysis of DC differentiation markers Statistical analysis ... Significance was evaluated with a student's t test the development of a simple rapid means of generating malignant cell-loaded DC could advance the immunotherapy of CTCL and perhaps other malignancies...

Ngày tải lên: 11/08/2014, 10:23

... R1 0 /1 0 /14 0 /3 VI 5/5 8 /12 Rpi-blb2 1/ 1 1/ 5 6/9 VII 3/ 3 9 /12 Rpi1=Rpi-pnt1 0 /1 0/4 0/2 VIII 6/6 12 / 13 RB, Rpi-blb1, Rpipta1, Rpi-plt1, Rpi-sto1 0/5 0/2 3 /11 IX 1/ 1 9 / 13 Rpi-vnt1 .1, Rpivnt1.2, ... Rpi-vnt1 .3, Rpi-phu1, Rpimoc1= Rpi-mcq1 0/5 0/2 1/ 9 X 1/ 1 15 /18 Rber=Rpi-ber1, Rpi-ber2 1/ 2 1/ 8 3/ 6 XI 6/6 14 /15 R 3a, R3b, R5, R6, R7, R8, R9, R10, R 11, Rpi-pcs, Rpistirling 1/ 11 5 /18 3/ 3 XII 1/ 1 10 /10 ... map;/: no map was included because of a lack of common markers b Danan et al BMC Plant Biology 2 011 , 11 :16 http://www.biomedcentral.com /14 71- 2229 /11 /16 Page of 16 c Resistance assay: FF: foliage test...

Ngày tải lên: 11/08/2014, 11:21

... Nat Genet 19 96, 14 :35 7 -36 0 Latham RA, Scott JH: A newly postulated factor in the early growth of the human middle face and the theory of multiple assurance Arch Oral Biol 19 70, 15 :10 97 -11 00 Siebert ... http://www.head-face-med.com/content/5 /1/ 14 Figure Overview of main cranial arteries Overview of main cranial arteries Left oblique view of a rendered 3- D reconstruction of cranial arteries The temporal and ... References 10 11 12 13 14 15 16 17 18 19 20 21 22 Dubourg C, Bendavid C, Pasquier L, Henry C, Odent S, David V: Holoprosencephaly Orphanet J Rare Dis 2007, 2:8 Arnold WH, Sperber GH, Machin GA: Anatomy...

Ngày tải lên: 11/08/2014, 20:20

... Yoshikawa M, Taketa M, Hayashi M, Pedrosa A, Onda R, Imaizumi-Anraku H, Bachmair A, Sandal N, Stougaard J, Murooka Y, Tabata S, Kawasaki S, Kawaguchi M, Harada K: Construction of a genetic linkage ... 0 0 15 6 12 1 65.8 51. 1 H17L NS10 × H17L H17L × R 130 94 94 16 6 12 2 0 0 0 0 16 6 12 2 70.0 51. 5 R 130 H17L × R 130 HR × R 130 94 18 8 12 6 792 0 10 9 0 10 0 12 6 10 01 - 272 WF1680 272 × WF1680 272 × WF1680 ... Gilliam TC, Ott J: Molecular and statistical approaches to the detection and correction of errors in genotype data base Am J Human Genet 19 93, 53 :11 37 -11 45 Hayashi M, Miyahara A, Sato S, Kato...

Ngày tải lên: 12/08/2014, 03:20

... References 10 11 12 13 14 15 16 17 18 19 Stein IL, Leventhal ML: Amenorrhea associated with bilateral polycystic ovaries Am J Obstet Gynecol 19 35 , 29 :18 1 -19 1 Goodarzi MO, Azziz R: Diagnosis, epidemiology, ... regulation are Gadd45 (growth arrest and DNA-damage-inducible) alpha and beta, geminin, proliferating cell nuclear antigen, CDK6, and S-phase kinase associated protein isoform a; whilst SET translocation ... J, Beausoleil SA, Bakalarski CE, Elledge SJ, Gygi SP: A quantitative atlas of mitotic phosphorylation Proc Nat Acad USA 2008, 10 5( 31 ) :10 762 -10 767 Kraft C, Herzog F, Gieffers C, Mechtler K, Hagting...

Ngày tải lên: 13/08/2014, 16:20

... TB 11/ 38 TB 11/ 39 TB 11/ 40 TB 11/ 41 22.6cM 12 .6cM 90.6cM TB 11/ 32 TB 11/ 7 TB 11/ 33 TB 11/ 10 TB 11/ 11 TB 11/ 13 TB 11/ 34 TB 11/ 35 TB 11/ 36 TB 11/ 15 TB 11/ 37 TB 11/ 42 9.7cM 6.7cM 2.9cM 73. 1cM TB 11/ 21 TB 11/ 43 TB 11/ 44 ... 22 . 13 0 .35 7 46.90 1. 65 35 .08 0.40 11 11 5.60 2 .30 19 .88 0.95 10 73 .10 2 .10 28.67 0.65 10 c 12 76 .10 2.50 32 .85 1. 08 11 21 88 .30 3. 42 38 .76 0. 71 24.40 0. 61 Average Total 11 9 733 .10 17 .89 aTotal ... TB1 /3 TB1/7 TB1/4 TB1/5 TB1/6 TB1/8 Volume 9, Issue 6, Article R1 03 3 .1 TB1 /1 TB1/2 TB1/4 TB1/6 TB1 /14 3 .1 6 .1 46Kb/cM 32 Kb/cM 11 Kb/cM 10 .4 3. 3 3 .1 Cooper et al R1 03. 8 Genetic map (cM) T.b.gambiense...

Ngày tải lên: 14/08/2014, 20:22

... Si (11 1)-7×7 surface at 11 0 K: (a) condensed d3 acetonitrile multilayer on 3- chloro -1- propanol chemisorbed on Si (11 1)-7×7 surface; and (b) after irradiating sample (a) using 19 3 nm laser for 30 ... to form the Si-C and Si-N σ bonds [11 1, 11 2] The attachment of phenylacetylene and diacetylene on Si (10 0)-2 1 and Si (11 1)-7×7 surfaces were investigated by Tao et al [14 4, 14 5] and Huang et al ... 11 1 Chapter Laser-induced cyano group attachment onto the 3- chloro-1propanol modified Si (11 1)-7×7 13 1 6 .1 Attachment of 3- chloro -1- propanol on Si (11 1)-7×7 13 2 6 .1. 1 High resolution...

Ngày tải lên: 14/09/2015, 08:43