1 5 construction of a stress element in 3 dimension

... J(t) 10° 10! E 107 & 107 E 10° & 10 kas -21- Shear creep function Log scale khu Nai ủ tuecAvE-TE0E vài 10Yo14o3o30103o03o1o302107110910110210310^10510810710810%0130110116110'4o'5 log ... -3000 -3500 b 100'10%0307030303030310710%10110210°10^1010510710510301401101013014o!5 time (s) Trang 27 -15- y-axis One quarter of the specimen metallic layer 5 polymer x-axis Figure 1.11: The ... ) - 13 - 0.00 đy——Ệ TS —Ờ—— NA (O2 2# Traction BC’s Real Solid 0.05 -0.2o TTT -0.25 -0.30 -0.36 1077011031030 o3o301031030710910”1021021010510810710%10%1014011011011014o!8 time (s) Figure 1.7:

Ngày tải lên: 29/11/2014, 07:00

... Guided Reading, DRA,™ Lexile,® and Reading Recovery™ are provided in the Pearson Scott Foresman Leveling Guide Genre Biography Comprehension Skills and Strategy • Main Idea and Details • Generalize ... Idea and Details • Generalize • Graphic Organizers Biography Text Features • • • • Heads Captions Time Line Glossary Scott Foresman Reading Street 4.1.5 ISBN 0-328-13426-0 ì

Ngày tải lên: 24/04/2017, 15:31

... 10 1.3 Marking scheme 10 1.3.1 What is a marking scheme? 10 1.3.2 Approach to construct a marking scheme 12 1.3.3 Steps to construct a marking scheme .13 1.3.4 ... .13 1.3.4 Types of marking schemes 15 1.3.5 Structure of a marking scheme 17 1.3.6 Available speaking marking schemes .18 1.3.7 Previous studies 20 iv CHAPTER ... primary language of global trade and commerce It is an international means of interaction and communication in almost all countries Proficiency in English is seen as a desirable goal for a lot of people

Ngày tải lên: 19/07/2017, 19:25

... 11826 11811.8 0.12 11623 11811.3 1.59 09:15 a.m 11563 11563.4 0.00 11563 11563.2 0.00 09:30 a.m 11234 11234.5 0.00 11234 11234.5 0.00 09:45 a.m 11765 11723.4 0.35 11758 11723.6 0.29 13:00 p.m 12234 ... 12234 12212.3 0.18 12195 12212.1 0.14 13:15 p.m 12453 12453.8 0.01 12453 12453.4 0.00 13:30 p.m 12345 12345.7 0.01 12345 12345.8 0.01 13:45 p.m 12643 12593.9 0.39 12598 12593.7 0.03 18:00 p.m 4463 ... 4413.9 1.11 4411 4413.8 0.06 18:15 p.m 4425 4425.9 0.02 4425 4425.9 0.02 18:30 p.m 4463 4463.5 0.01 4463 4463.3 0.01 18:45 p.m 4429 4399.2 0.68 4408 4399.4 0.20 21:00 p.m 230 225.7 1.91 225 226.2

Ngày tải lên: 22/05/2020, 01:48

... 114.60 115.50 08AY 115.41 6.97 0.49 13.72 % 114.90 115.90 114.90 115.70 62.10 66.80 58.70 68.90 113.90 115.90 113.20 116.50 16.70 % 114.60 115.30 114.50 115.50 14.76 % 114.70 116.20 114.50 115.80 ... % 2.30 0.32 55 Chr10 133 113.33 0.85 6.69 17 12.78 % 1.86 0.32 32 Chr11 88 112.62 1.28 5.71 24 27.27 % 2.50 0.30 Chr12 273 178.26 0.65 5.07 85 31.14 % 2.85 0.28 37 Chr13 604 185.33 0.31 4.15 44 ... 3.25 −0.13 6.85 % 09AY 52.61 2.10 −0.10 4.52 % 10GY 55.81 1.97 −0.10 4.15 % 51.00 59.90 55.80 55.80 10AY 55.81 2.25 −0.11 5.03 % 54.20 58.30 54.20 58.90 08AY 101.81 2.14 0.12 4.26 % 10ZZ 102.61

Ngày tải lên: 22/05/2020, 04:04

... and tartaric acid plays an important role in maintaining the chemical stability and the color of the wine Tartaric acid has a stronger acidic flavor than malic (pKa: 3.04 vs 3.40), and is also ... low-quality data (reads with > 15% of bases with quality score < 30) The cleaned data were analyzed using a standard RAD-seq analysis pipeline in the software package Stacks [62] Genotypes for each plant ... One of these, a genetic map of a V vinifera cross between Syrah and Pinot Noir, took into account most markers, including 483 SNP, 132 SSR and 379 AFLP markers [31] Wang et al [33] developed a

Ngày tải lên: 26/05/2020, 23:45

... 10 1.3 Marking scheme 10 1.3.1 What is a marking scheme? 10 1.3.2 Approach to construct a marking scheme 12 1.3.3 Steps to construct a marking scheme .13 1.3.4 ... .13 1.3.4 Types of marking schemes 15 1.3.5 Structure of a marking scheme 17 1.3.6 Available speaking marking schemes .18 1.3.7 Previous studies 20 iv CHAPTER ... primary language of global trade and commerce It is an international means of interaction and communication in almost all countries Proficiency in English is seen as a desirable goal for a lot of people

Ngày tải lên: 23/09/2020, 21:30

... grammar sees grammar as a set of rules which specify all grammatical structures of the language In this approach there is a main focus on making a distinction between grammatical and ungrammatical ... approach that also has a great influence on language research and teaching is functional grammar The theory of functional grammar was originally introduced by M.A.K Halliday in the early 1960s ... use as central features of language That is what makes functional grammar distinctive with other grammarians 1.3 Definition of grammatical subject 1.3.1 From traditional perspective Providing an

Ngày tải lên: 23/09/2020, 22:41

... 10 1.3 Marking scheme 10 1.3.1 What is a marking scheme? 10 1.3.2 Approach to construct a marking scheme 12 1.3.3 Steps to construct a marking scheme .13 1.3.4 ... .13 1.3.4 Types of marking schemes 15 1.3.5 Structure of a marking scheme 17 1.3.6 Available speaking marking schemes .18 1.3.7 Previous studies 20 iv CHAPTER ... primary language of global trade and commerce It is an international means of interaction and communication in almost all countries Proficiency in English is seen as a desirable goal for a lot of people

Ngày tải lên: 05/12/2020, 07:54

... Problem 1.3 Research Questions and Objectives 1.4 Research Methodology 10 1.4.1 Research Site 10 1.4.2 Data Collection 12 1.4.3 Data Analysis 15 1.5 Thesis Organization CHAPTER IITHEORETICAL CONCEPTS ... Associate Professor Dr Jamaree Chiengthong, Assistant Professor Dr Chusak Wittayapak, Dr Pinkeaw Laungaramsri and Dr Wassan Panyagaew, for their interesting and useful lectures in the fields of anthropology ... would also like to express great respect and appreciation to the other lecturers at RCSD My thanks must go to Professor Dr Anan Ganjanapan, Dr Chayan Vaddhanaphuti, Dr Santita Ganjanapan, Associate

Ngày tải lên: 15/04/2021, 14:25

... 10 1.3.1 What is a marking scheme? 10 1.3.2 Approach to construct a marking scheme 12 1.3.3 Steps to construct a marking scheme .13 1.3.4 Types of marking schemes ... 15 1.3.5 Structure of a marking scheme 17 1.3.6 Available speaking marking schemes .18 1.3.7 Previous studies 20 iv TIEU LUAN MOI download : skknchat@gmail.com CHAPTER ... methods and the design of the study Rationale English is the most popular official language in the world and the primary language of global trade and commerce It is an international means of interaction

Ngày tải lên: 28/06/2022, 08:46

... test at Cam Giang High School, a combination of intuitive, qualitative and quantitative approaches was used 1.3.3 Steps to construct a marking scheme According to Mertler (2001) building a marking ... quantitative and qualitative approaches According to Taylor (2011) the process of constructing a marking scheme is took place in three phases: intuitive phase, qualitative phase and quantitative ... indicate a strong correlation r = +1 or -1 indicates a perfect linear relationship: as one variable increases (decreases) in its values, the other variable also increases (decreases) via an exact linear

Ngày tải lên: 05/12/2022, 22:19

... strengthening the tail peduncle, the keels have an important role in decreasing the drag during rapid lateral motion of the tail [15] The main fin of tuna for swimming is its caudal fin Tuna’s caudal ... Travelling wave generated by undulatory motion of fish with the x˙ isofthe cruising heave of the caudalangle fin and W; the instantaneous of attack theaverage caudal fin, α; the undulation amplitude, ... cruising 2.1.4 The Combination of Swimming Characteristics of Tuna and Bird-Wrasse Considering the swimming gait and swimming forces as well as body and fin shape, tuna is an appropriate candi‐ date

Ngày tải lên: 24/12/2022, 14:04

... because because winter because singer really admire very 62 after allow able afraid around because because after avoid ahead although another again decide because because around camping avoid around ... Using Praat Springer Nature Boersma, P., & Van Heuven, V (2001) Speak and unSpeak with PRAAT Glot International, 5(9/10), 341-347 Brown, H D (2000) Principles of language learning and teaching ... admire admire about admire admire admire admire admire always always because admire admire admire because future admire because always city admire advice although person grandpa because because Chinese

Ngày tải lên: 13/11/2023, 15:49

... https://www.academia.edu/7719276/Designing_Criteria_to_Assess_Speaking_Skills Shohamy, E (1990) Discourse analysis in language testing, Annual Review of Taylor, L (2011) Examining Speaking Research and prctice in assessing second language speaking: Cambridge ... populations and purposes To ensure reliability, raters are typically trained in the application of these proficiency scales (David et al., 1999, pp: 153-154).A rating scale encompasses the areas ... 71-86 Association of Language Testers in Europe (ALTE) (1998) Multilingual Glossary of Language Testing Terms, Studies in language Testing 6, Cambridge: Bachman, L.F and Palmer, A S (1996): Language

Ngày tải lên: 17/12/2023, 02:35

... costaverage 9,480,561 11,058,052 8,050,268 5,237,172 7,296,126 3,423,990 O&Maverage Debtaverage 1,694,154 1,445,149 1,853,856 2,549,235 2,316,777 2,772,422 Taxaverage LRC 1,445,543 1,172,388 1,670,302 ... 1,670,302 Dv 12,914,392 12,884,050 11,232,385 Source: own elaboration Itens S3 32,760,000 6,641,317 5,965,568 3,377,906 1,010,349 1,577,313 920,733 5,766,604 Table 15 Comparison in percentage values ... -25.00% 25.00% -4.34% 3.58% 16.64% -15.09% 39.31% -34.62% -14.70% 9.43% -9.12% 8.76% -18.90% 15.55% -0.23% -13.02% S3 -30.00% -34.87% -37.08% -35.50% -40.36% -38.13% -36.31% -55.35% If the investor

Ngày tải lên: 05/09/2013, 14:59

... thing" -inda is an indeclinable and, linguistically speaking, underivable suffix Greek children played sphairinda-at ball; helkustinda-tug 0' war; streptinda -a throwing game; basilinda­ king of ... jah bZlaikand ina, it is tolerably certain that Gothic expressed play by the same laikan which has fathered the ordinary word for play in the Scandinavian languages, and which also appears in ... cognate with la'at Here, however, apart from meaning play in its proper sense, the word also means laughing and mock­ ing The Arabic la'iba covers playing in general, making mock of, and teasing,...

Ngày tải lên: 14/03/2014, 10:20

... controlling the membrane binding of basic protein domains: phenylalanine 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 and the attachment of the myristoylated alanine-rich C-kinase substrate ... N-terminal fragment of the poneratoxin gene Two others: forward 5 -GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG -3 and reverse 5 -AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGTATCAC GGG -3 were ... end of a signal peptide: 5 -CAGAAGCGGAA GAAAGCATGCAAAGGCAGA -3 (number 2), were used In the second PCR the plasmid pFastBacPx was used as a template with upstream and downstream primers containing,...

Ngày tải lên: 30/03/2014, 13:20

... 5 -ACTTGATTAGGCAGACGCGTGAGA; DKK1 -33 1F, 5 -ACTTGTGTGCACAGTCAGCGAGTA; DKK1 -33 1R, 5 -TTAATAAATGCAGGCGGCAGCAGG; DKK1 + 33 F, 5 -AAATCCCATCCCGGCTTTGTTGTC; DKK1 + 33 R, 5 -TCTCAGAAGGACTCAAGAGGGAGA Polakowski ... 5 -ACCAGTCGCCTTGTACACAGTCTC; HBZ-S1-F, 5 - TTAAACTTACCTAGACGGCGGACG; HBZ-S1-R, 5 -GCATGACACAGG CAAGCATCGAAA; ACTB-F, 5 -ACCAACTGGGACGACATGGAGAAA; ACTBR, 5 -TAGCACAGCCTGGATAGCAACGTA The DKK1b ... 85% -11 0% and 0.99 -1. 0, respectively Primers used were as follows: DKK1 -18 53 F, 5 TGGAATTTGGGATGGGAAGGACAC; DKK1 -18 54 R, 5 -CACCACCAAGTAAAGCCAGTGACA; DKK1-991F, 5 -CATTCGGAAGCGTTGCGATGTGAT; DKK1-991R, 5 -ACTTGATTAGGCAGACGCGTGAGA;...

Ngày tải lên: 13/08/2014, 01:20

... simulating different residual variances in F and F Four I situations were investigated, combining all combinations of non-normality in F and increased variance in F (table I) In general, 50 0 F and ... remained equal, as long as genotype probabilities in F remained 1/ 4, 1/ 2 and 1/ 4, and parameter estimates are unbiased (table VII) In case the allele frequency did not average 0 .5, however, parameter ... t = 25 andt = 35 Each point in the figure is on average of 10 0 replicates The power increased with increasing number of observations Increasing the number of observations > 10 00 gave relatively...

Ngày tải lên: 14/08/2014, 20:20