1 5 construction of a stress element in 3 dimension

Ngày tải lên: 29/11/2014, 07:00

... thing" -inda is an indeclinable and, linguistically speaking, underivable suffix Greek children played sphairinda-at ball; helkustinda-tug 0' war; streptinda -a throwing game; basilinda­ king of ... jah bZlaikand ina, it is tolerably certain that Gothic expressed play by the same laikan which has fathered the ordinary word for play in the Scandinavian languages, and which also appears in ... cognate with la'at Here, however, apart from meaning play in its proper sense, the word also means laughing and mock­ ing The Arabic la'iba covers playing in general, making mock of, and teasing,...

Ngày tải lên: 14/03/2014, 10:20

... controlling the membrane binding of basic protein domains: phenylalanine 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 and the attachment of the myristoylated alanine-rich C-kinase substrate ... N-terminal fragment of the poneratoxin gene Two others: forward 5 -GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG -3 and reverse 5 -AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGTATCAC GGG -3 were ... end of a signal peptide: 5 -CAGAAGCGGAA GAAAGCATGCAAAGGCAGA -3 (number 2), were used In the second PCR the plasmid pFastBacPx was used as a template with upstream and downstream primers containing,...

Ngày tải lên: 30/03/2014, 13:20

... partially balanced incomplete block designs with two associate classes J Amer Statist Assoc., 47 : 15 1– 18 4, 19 52 [4] A E Brouwer, A M Cohen, and A Neumaier Distance-regular graphs, volume 18 of ... der Mathematik und ihrer Grenzgebiete (3) [Results in Mathematics and Related Areas (3) ] Springer-Verlag, Berlin, 19 89 [5] J De Beule and K Metsch The maximum size of a partial spread in H (5, q ... even dimension, and 1/ 2 if P is a Hermitian variety in odd dimension The number of points in the polar space P is (q d +1+ ǫ + 1) (q d +1 − 1) /(q − 1) The size of a spread in P is equal to q d +1+ ǫ...

Ngày tải lên: 07/08/2014, 21:21

... study was undertaken to explore the use of minocycline as an adjuvant treatment for chronic HIV CD4+ 4 53 267 - 806 CD8+ 1, 009 57 5 - 218 5 - 18 CSF 13 .1 5. 9 - 41. 2 Plasma 13 .4 9.2 - 53 .5 479.2 39 7.9 ... survival and protective effect of antiviral therapy AIDS Clinical Trial Group and Neurological AIDS Research Consortium study team AIDS 19 99, 13 ( 13 ) :16 77 -16 85 doi :10 .11 86 /17 42-64 05- 8 -17 Cite this article ... Updated research nosology for Ho et al AIDS Research and Therapy 2 011 , 8 :17 http://www.aidsrestherapy.com/content/8 /1/ 17 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 HIV-associated...

Ngày tải lên: 10/08/2014, 05:22

... Scaphoid stress fracture in a 13 year old gymnast: A case report J Hand Surg (Am) 2000, 25( 4): 710 -3 Hanks GA, Kalenak A, Bowman LS, Sebastanelli WJ: Stress fracture of the carpal scaphoid, a ... report of cases J Bone Joint Surg Am 19 89, 71( 6): 938 - 41 Brutus JP, Chahidi N: Could this unusual scaphoid fracture occurring in a badminton player be a stress fracture? Chir Main 2004, 23 (1) :52 -4 ... drafted the manuscript as the main author RSUY was involved in reviewing the literature and proof reading of the manuscript RSUY has approved the final manuscript TMK, the Senior author was responsible...

Ngày tải lên: 11/08/2014, 10:22

... 5 -ACTTGATTAGGCAGACGCGTGAGA; DKK1 -33 1F, 5 -ACTTGTGTGCACAGTCAGCGAGTA; DKK1 -33 1R, 5 -TTAATAAATGCAGGCGGCAGCAGG; DKK1 + 33 F, 5 -AAATCCCATCCCGGCTTTGTTGTC; DKK1 + 33 R, 5 -TCTCAGAAGGACTCAAGAGGGAGA Polakowski ... 5 -ACCAGTCGCCTTGTACACAGTCTC; HBZ-S1-F, 5 - TTAAACTTACCTAGACGGCGGACG; HBZ-S1-R, 5 -GCATGACACAGG CAAGCATCGAAA; ACTB-F, 5 -ACCAACTGGGACGACATGGAGAAA; ACTBR, 5 -TAGCACAGCCTGGATAGCAACGTA The DKK1b ... 85% -11 0% and 0.99 -1. 0, respectively Primers used were as follows: DKK1 -18 53 F, 5 TGGAATTTGGGATGGGAAGGACAC; DKK1 -18 54 R, 5 -CACCACCAAGTAAAGCCAGTGACA; DKK1-991F, 5 -CATTCGGAAGCGTTGCGATGTGAT; DKK1-991R, 5 -ACTTGATTAGGCAGACGCGTGAGA;...

Ngày tải lên: 13/08/2014, 01:20

... simulating different residual variances in F and F Four I situations were investigated, combining all combinations of non-normality in F and increased variance in F (table I) In general, 50 0 F and ... remained equal, as long as genotype probabilities in F remained 1/ 4, 1/ 2 and 1/ 4, and parameter estimates are unbiased (table VII) In case the allele frequency did not average 0 .5, however, parameter ... t = 25 andt = 35 Each point in the figure is on average of 10 0 replicates The power increased with increasing number of observations Increasing the number of observations > 10 00 gave relatively...

Ngày tải lên: 14/08/2014, 20:20

... you are located in some areas The raw materials can be easily sourced, the manpower would easily available and you can save out on transportation costs in case of certain locations Setting up a ... company In some cases, there is a single investor; in others, multiple investors In the latter case, such as a crowdfunding event, the investors participate as a unit, each sharing a proportion of ... determining the "cost" of the new capital when seeking equity additions to the capital structure Simply explained, a company with a $1 million valuation and no debt seeking a new capital of $1 million...

Ngày tải lên: 14/05/2015, 14:38

... CULTURAL CONSTRUCTION OF NANYANG CHINESE COMMUNITY IN LATE QING AND EARLY REPUBLICAN CHINA： DISCOVERY OF A CULTURAL SPACE 薛 莉 清 XUE LIQING (B .A NANJING NORMAL UNIVERSITY) (M .A NATIONAL UNIVERSITY OF ... Landscape appreciation in ancient and early medieval China : the birth of landscape poetry : six lectures given at National Tsing Hua University, February-March 19 95 （Hsin-Chu, Taiwan: Program for ... 74 Joshua A. Fogel, The literature of travel in the Japanese rediscovery of China, 18 62 -19 45 (Stanford, Calif: Stanford University Press, 19 96) 75 Emma Teng, Taiwan's Imagined Geography Chinese...

Ngày tải lên: 09/09/2015, 18:56

... (Gnanasambandam and Rajagopalan 2 010 ; Gnanasambandam and Rajagopalan 2 010 (Accepted for publication)) and (B) Morphology of glycine crystals in methanol/water mixtures predicted from simulations 13 4  ... have earnestly caring father R Gnanasambandam, ever affectionate mother G Rajakumari and lovable husband Dr H Hariharan I am grateful to my sister Dr G Kalarani and her husband Dr M G Mohan and ... relay mechanism (Lahav and Leiserowitz 20 01) 31 Figure 2 .10 Packing arrangement of (R,S) analine by crystal faces (Lahav and Leiserowitz 20 01) 31 Figure 2 .11 Schematic representations...

Ngày tải lên: 11/09/2015, 10:05

... triiodothyronine (T3) and thyroxine (T4) and the activities of aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase (ALP), creatine kinase (CK) and lactate dehydrogenase ... also conditioned with 1ml 10 0% methanol, and 1ml water, after which 1ml of sample was 33 applied The sample in StrataX™ cartridge was washed with 1ml of 5% methanol in water and eluted with 1ml ... popular based machine learning methods, which in contrast to DA and PLS can learn non-linear as well as linear mappings (Bishop C.M., 19 95) 2.2.4 Application of metabolomics in animal studies Metabolic...

Ngày tải lên: 11/09/2015, 21:52

... differentiation and apoptosis 31 1.6 .1. 3 ANXA1 in cancer 33 1. 6 .1. 4 ANXA1 in leukocyte migration 33 1. 6 .1. 5 ANXA1 in signaling 34 1. 6 .1. 6 ANXA1 and stress response 36 1. 7 Autophagy, heat stress and ANXA1 37 ... signaling 22 1. 4 NFkB 25 1. 5 MAPK 26 1. 6 Introduction to Annexin -1 (ANXA1) 27 1. 6 .1 Functions of ANXA1 29 1. 6 .1. 1 ANXA1 in inflammation 29 1. 6 .1. 2 ANXA1 in cellular proliferation, differentiation ... (qPCR) 51 2 .11 mRNA stability assay 52 2 .12 Protein Lysis 53 2 . 13 Protein Quantitation 54 2 .14 Western blotting 54 2 . 15 Confocal Microscopy 55 2 .16 Statistical Data Analysis 57 Chapter 3: Results 58 ...

Ngày tải lên: 01/10/2015, 17:27

... costaverage 9,480 ,5 61 11, 058 , 052 8, 050 ,268 5, 237 ,17 2 7,296 ,12 6 3, 4 23, 990 O&Maverage Debtaverage 1, 694 , 15 4 1, 4 45 ,14 9 1, 8 53 , 856 2 ,54 9,2 35 2, 31 6 ,777 2,772,422 Taxaverage LRC 1, 4 45, 5 43 1, 172 ,38 8 1, 670 ,30 2 ... 1, 670 ,30 2 Dv 12 , 914 ,39 2 12 ,884, 050 11 , 232 ,3 85 Source: own elaboration Itens S3 32 ,760,000 6,6 41, 31 7 5, 9 65, 568 3, 377,906 1, 010 ,34 9 1, 57 7, 31 3 920, 733 5, 766,604 Table 15 Comparison in percentage values ... - 25. 00% 25. 00% -4 .34 % 3 .58 % 16 .64% - 15 .09% 39 . 31 % -34 .62% -14 .70% 9. 43% -9 .12 % 8.76% -18 .90% 15 .55 % -0. 23% - 13 .02% S3 -30 .00% -34 .87% -37 .08% - 35 . 50% -40 .36 % -38 . 13 % -36 . 31 % -55 . 35 % If the investor...

Ngày tải lên: 05/09/2013, 14:59

... Robotics and Automation, Atlanta, GA, 19 93, pp 54 5 55 0 18 H Maaref, C Barret / Robotics and Autonomous Systems 38 (2002) 1 18 H Maaref received his Ph.D in 19 90 Since 19 90, he is Assistant Professor ... in presence of unknown obstacles (Fig 22(d)) is very close to the one obtained after including the unknown obstacle in the data base and starting again the planning [ 15 ] In fact the main penalization ... control of simple dynamic plant, Proceedings of the IEEE 12 1 (12 ) (19 74) [17 ] P.J McVicar, D Whelan, Fuzzy sets for man–machine interaction, International Journal of Man–Machine Studies 15 (19 76)...

Ngày tải lên: 23/10/2013, 15:15

... TD(DS#)n-m (kJÆmol )1) Native G26 1A G26 1A/ Y26 9A 12 12 4 23 31 0 42.8 10 6 .5 45 .1 52 .48 54 .96 55 .69 40. 45 10 4 . 15 42. 75 )12 . 03 49 .19 )12 .94 )2.48 )3. 21 ) 63. 7 )2 .3 ) 61. 22 0. 91 233 4 K Mavromatis et al (Eur J Biochem ... 5 -d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG) -3 The upstream primer containing the NdeI restriction site (underlined) was: 5 -d(GCTAGCATATGAAGCTTAAA AAAATTG) -3 and the downstream primer containing the ... AGCCCAATCTATTTGAG) -3 ; Gly262 to Ala, upper primer 5 -d(ATAGATTGGGGTGCCCATGCAAATAA TGCA) -3 , lower primer 5 -d(ATTATTTGCATGGGCA CCCCAATCTATTTG) -3 ; Tyr269 to Ala, upper primer Fig Partial alignment of alkaline...

Ngày tải lên: 22/02/2014, 04:20

... accounts totals Finally, a SAM always has a matrix format 72 because of its emphasis on the identification of source and use of all transactions Summarizing, a SAM in our view serves as an alternative ... raw data from the surveys, data already available (e.g the 1- 0 table) are scrutinized (e.g the treatment of the interest margin of banks), and data which are lacking are estimated provisionally, ... certainly mean a manifold increase of the workload as well Particularly, interregional linkages are difficult to trace since statistical sources are usually absent (see also Pyatt and Round, 19 85) ...

Ngày tải lên: 06/03/2014, 21:20

... lawyer firm/investor/analyst bank/firm/station company AVERAGE Hypernym any majority 13 13 10 2 14 14 13 13 0 6 6.6 / 33 .0% 7.8 / 39 .0% Any hypernym majority any 13 13 10 11 17 18 14 14 14 14 ... labeled ancestor We compress the tree using the following very simple algorithm: in depth-first order, # nouns 22 95 51 1 51 1 13 226 10 9 47 88 10 ,266 6, 056 60 13 5 18 8 34 8 30 0 13 0 30 6 35 Table 1: ... and Martha Evens 19 88 Parsing vs text processing in the analysis of dictionary definitions In Proceedings of pages 11 10 -11 16 the 29th Annual Meeting of the Association for Computational Linguistics,...

Ngày tải lên: 08/03/2014, 06:20

... transduction using strain CE1224 as the recipient and strains IQ 85 and strain MM 152 , respectively, as donor strains To obtain strain CE1 51 3 , strain MM88 was used as Table Bacterial strains and plasmids ... thi argE lacY galK xyl rpsL supE ompR F–, DlacU169 araD 139 rpsL thi relA F–, DlacU169 araD 139 thiA rpsL relA leu::Tn10 secAtsA 51 F–, DlacU169 araD 139 rpsL thi relA ptsF 25 deoC1 lamBD60 MC 410 0 ... translocon In the Na2CO3 supernatant, at least three major crosslinking adducts, of apparent molecular mass  11 0,  65 and  55 kDa, could be detected (Fig 4A, lane 5) In addition, several cross-linking...

Ngày tải lên: 08/03/2014, 09:20