1  controlling the position of a servo

Tài liệu Báo cáo khoa học: Mapping of the epitope of a monoclonal antibody protecting plasminogen activator inhibitor-1 against inactivating agents pptx

Tài liệu Báo cáo khoa học: Mapping of the epitope of a monoclonal antibody protecting plasminogen activator inhibitor-1 against inactivating agents pptx

... substrate S-2444 and measurement of the increase in absorbance at 405 nm The specific inhibitory activity of PAI-1 was calculated from the amount of PAI-1 that had to be added to inhibit 50% of the ... Mab-1 The EC50 values for binding of each variant to Mab-1 or Mab-2 were determined in parallel with the EC50 value for wt and expressed as a fraction of that The means and standard deviations of ... inhibitory activity of any of the variants, and all variants had IC50 values for inactivation by XR5118 indistinguishable from that of wt (data not shown) Whereas wt PAI-1 was totally resistant to...

Ngày tải lên: 20/02/2014, 11:20

8 547 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... induced simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG ... prosthetic metal Arch Biochem Biophys 313, 296–303 Yamakura, F., Rardin, R.L., Petsko, G .A. , Ringe, D., Hiraoka, B.Y., Nakayama, K., Fujimura, T., Taka, H & Murayama, K (1998) Inactivation and...

Ngày tải lên: 21/02/2014, 01:21

12 741 0
Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx

Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx

... shown Black geometrical shapes are additional domains, as indicated ANOGA, Anopheles gambiae; ASHGOS, Ashbya gossypii; BRARE, Brachydanio rerio; CANDGLA, Candida glabrata; CIONA, Ciona intestinalis; ... translocation to the nucleus Although functional analyses of individual domains have not been addressed, the global context of the domain analyses allows us to draw a more general picture of the ... DIDO-related apoptosis occurs as a result of alterations in DNA regulation caused by chromatin instability Computational analyses Although all splice variants share common domains, long regions of the...

Ngày tải lên: 07/03/2014, 21:20

7 658 0
Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot

Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot

... GAPDH_rev TGAAAGACCTTTCAAACCCCTC GTTTTGCAGTAGGCCACCAC GCCAGGGAAGTCAGAACTTC GTTTTGCAGTAGGCCACCAC CCACAGAAGGAGCAAATACTTC GTTTTGCAGTAGGCCACCAC AGGAGGAGGAGTGGTGCTG GTCCCCAGCAGCAGCAGTA GAGGTGAGCCGATGGAGATTTA ... GAGGTGAGCCGATGGAGATTTA CCTCTCAGGCGCTCAGCTTC TCTCCGGCGAGATGTCCGA GCTCCAGTGAATCCAGGTTG TCTCCGGCGAGATGTCCGA GGCAGCGATCACCAGTAAAC GAAGGGCTCATGACCACAGTCCAT TCATTGTCGTACCAGGAAATGAGCTT Immunoglobulin domain (type ... physiological consequence Again, the ADAM10 transgenes remained without effect in all investigated mouse lines (Fig 5A) G-ratios of ADAM10mo as well as of ADAM10dn mice at postnatal day 17 were identical...

Ngày tải lên: 16/03/2014, 04:20

13 488 0
Báo cáo Y học: The reactivity of a-hydroxyhaem and verdohaem bound to haem oxygenase-1 to dioxygen and sodium dithionite pdf

Báo cáo Y học: The reactivity of a-hydroxyhaem and verdohaem bound to haem oxygenase-1 to dioxygen and sodium dithionite pdf

... (Iwatani, Fukuoka, Japan) All other chemicals used were of analytical grade Formation of a- hydroxyhaem-rHO-1 complex Scheme The resonance structure of a- hydroxyhaem Unless otherwise stated, the ... disappeared, indicates the formation and degradation of a trace amount of the CO-ferrous verdohaem produced from the free a- hydroxyhaem Acidification and extraction of the product into chloroform gave biliverdin, ... Matera et al [26]; the optical spectrum of the ferric form exhibited a rather broad Soret band, whereas the Soret bands of the ferrous and ferrous-CO forms were narrow (Fig 1B) The ratios of the...

Ngày tải lên: 23/03/2014, 21:20

9 502 0
The Confessions of a Caricaturist, Vol. 1 ppt

The Confessions of a Caricaturist, Vol. 1 ppt

... camp fire at a great pow-wow in the wigwam of the excellent Savages, alas! remain The old Grecian Theatre in the City Road was the nursery of many members of the theatrical profession, and authors ... with anxiety as to the fluctuations of the Bank rate Be that as it may, I cannot refrain from citing here the case of another brother artist, who was particular in the extreme as regarded the neatness ... to a quick eye and a ready pencil." I can appreciate the fact that at that early age I had an eye for the "pathetic, and even beautiful," but, alas! I have been misunderstood from the day of...

Ngày tải lên: 29/03/2014, 22:20

145 331 0
Báo cáo hóa học: " Glycerol conversion to 1, 3-Propanediol is enhanced by the expression of a heterologous alcohol dehydrogenase gene in Lactobacillus reuteri" ppt

Báo cáo hóa học: " Glycerol conversion to 1, 3-Propanediol is enhanced by the expression of a heterologous alcohol dehydrogenase gene in Lactobacillus reuteri" ppt

... relative to the native strain, during the second half of the logarithmic phase (Figure 5) The batch experiment has revealed that 1, 3-PD, acetate and ethanol are growth-associated in both the native ... rate of the recombinant culture (Jarboe et al 2010; Zhu et al 2009) The decreased μmax of the recombinant strain could also be attributed to the metabolic load imposed by the recombinant plasmid ... http://www.amb-express.com/content/1/1/37 a Page of b Figure Time course of metabolite formation by recombinant (open circles) and native strain (triangles) strains of L reuteri in batch cultivation a lactate (• ― •), acetate (―) and...

Ngày tải lên: 20/06/2014, 23:20

8 400 0
A Critical Examination Of The Position Of Mr. Darwin''''s Work ppt

A Critical Examination Of The Position Of Mr. Darwin''''s Work ppt

... related to one another in just the same way as the genera of a family, and the groups themselves as the families of an order, or the orders of a class; while all have the same sort of structural ... of the other subkingdoms For similar reasons men and horses are arranged as members of the same Class, 'Mammalia'; men and apes as members of the same Order, 'Primates'; and if there were any animals ... you have reason to believe there has also been a great lapse of time or a great change of conditions The animals, for instance, of the newest tertiary rocks, in any part of the world, are always,...

Ngày tải lên: 28/06/2014, 19:20

87 330 0
Bài 1 - The parts of a letter (Thành phần của một bức thư)-phần2 docx

Bài 1 - The parts of a letter (Thành phần của một bức thư)-phần2 docx

... "Thanh Hoa" hay "Nguyen Thanh Hoa" Điều cấm kị nên bạn thật lưu tâm THE SUPERSCRIPTION (PHẦN Đ A CHỈ TRÊN B A THƯ) Các bạn lưu ý gửi thư cho người phụ nữ phải viết phần tên hiệu phần đ a b a thư ... Bởi chữ ký phần quan trọng mang tính biểu trưng thay cho bạn nên cần phải thống thư từ hay văn giấy tờ Ví dụ, tên Nguyen Thanh Hoa bạn không nên gửi thư cho người ký tên "Hoa" sau thư gửi đến người ... thư thân mật không trang trọng thường dùng: Yours sincerely, Yours very sincerely, Yours cordially, Yours faithfully, Yours gratefully, Yours affectionately, Very affectionately yours, Yours lovingly,...

Ngày tải lên: 12/07/2014, 01:20

13 597 2
Bài 1 - The parts of a letter (Thành phần của một bức thư)-phần3 docx

Bài 1 - The parts of a letter (Thành phần của một bức thư)-phần3 docx

... Dear Mai Anh, Tuy nhiên, thư thương mại, trao đổi công việc bạn không nên sử dụng dấu phẩy đằng sau "Dear" Thay vào đó, theo văn phong Anh Mỹ bạn sử dụng dấu hai chấm Còn theo văn phong Anh Anh ... Nhưng bạn gửi đến công ty "The National Cash Register Company" bạn không nên dùng: "Messrs National Cash Register Company" Mà dùng "The National Cash Register Company." "Messrs." phần viết tắt ... thay dùng "Mr." người Mỹ Tên hiệu "Messrs." dùng để hai hay nhiều người cộng tác kinh doanh Ví dụ: "Messrs Le Minh and Ngoc Lam" Hoặc "Messrs Le Minh & Ngoc Lam" Nhưng bạn gửi đến công ty "The...

Ngày tải lên: 12/07/2014, 01:20

7 475 0
Bài 1 - The parts of a letter (Thành phần của một bức thư)-phần3 pdf

Bài 1 - The parts of a letter (Thành phần của một bức thư)-phần3 pdf

... Dear Mai Anh, Tuy nhiên, thư thương mại, trao đổi công việc bạn không nên sử dụng dấu phẩy đằng sau "Dear" Thay vào đó, theo văn phong Anh Mỹ bạn sử dụng dấu hai chấm Còn theo văn phong Anh Anh ... Nhưng bạn gửi đến công ty "The National Cash Register Company" bạn không nên dùng: "Messrs National Cash Register Company" Mà dùng "The National Cash Register Company." "Messrs." phần viết tắt ... thay dùng "Mr." người Mỹ Tên hiệu "Messrs." dùng để hai hay nhiều người cộng tác kinh doanh Ví dụ: "Messrs Le Minh and Ngoc Lam" Hoặc "Messrs Le Minh & Ngoc Lam" Nhưng bạn gửi đến công ty "The...

Ngày tải lên: 12/07/2014, 01:20

7 575 1
Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc

Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc

... primers (Pharmacia, Woerden, The Netherlands) and reverse transcriptase (Pharmacia) For reverse transcription PCR, human Cyp7b sense (GTCCTGGAGAAATATTATGTGCAG) and antisense (CGCACACAGTAGTCCCCGG) ... M: Mammalian MAP kinase signalling cascades Nature 2001, 410:37-40 Palanki MS: Inhibitors of AP-1 and NF-kappa B mediated transcriptional activation: therapeutic potential in autoimmune diseases ... 7α-hydroxy-dehydroepiandrosterone (7α-OH-DHEA) is expressed as the percentage [3H]-7α-OH-DHEA of the total amount of [3H]label measured Results are expressed as the mean ± standard error of the mean of triplicate...

Ngày tải lên: 09/08/2014, 07:20

10 462 0
Báo cáo y học: " Construction of doxycyline-dependent mini-HIV-1 variants for the development of a virotherapy against leukemias" pps

Báo cáo y học: " Construction of doxycyline-dependent mini-HIV-1 variants for the development of a virotherapy against leukemias" pps

... AAA GGA CCA GCA AAG CTC CTC TGG AAA GGT 3') and WS3 (5'TAG AAT TCA AAC TAG GGT ATT TGA CTA AT) The same PCR was performed on DNA from a vpU-deletion construct [pDR2484, [39]] The PCR fragments ... (vpU startcodon inactivation) and rtTAΔ6B (vpU deletion) As part of the vpU inactivation strategy, the Y2 6A inactivating mutation in the tat gene of HIV-rtTA is replaced by the wt tat gene of the ... left panel) Surprisingly, replication of the minimized rtTAΔ 6A and rtTAΔ6B variants is significantly faster than that of the parental HIV-rtTA virus and even faster than the wild type LAI virus...

Ngày tải lên: 13/08/2014, 09:20

12 318 0
Báo cáo y học: "Over-expression of glutamine synthase in focal nodular hyperplasia (part 1): Early stages in the formation support the hypothesis of a focal hyper-arterialisation with venous (portal and hepatic) and biliary damage" pps

Báo cáo y học: "Over-expression of glutamine synthase in focal nodular hyperplasia (part 1): Early stages in the formation support the hypothesis of a focal hyper-arterialisation with venous (portal and hepatic) and biliary damage" pps

... formation there are various features: a) at the border, there were abnormal portal tracts, which were more fibrotic, and there was also an absence of portal veins and ducts and arterial proliferation, ... Diagnosis of focal nodular hyperplasia: not so easy Am J Surg Pathol 2001, 25:1322-1325 Wanless IR, Sapp H, Guindy M, Olshansky D, Takayama A: The pathogenesis of focal nodular hyperplasia/ an ... (portal and hepatic) and in all other features described by Wanless et al [5] Disappearance of bile ducts may lead to cholestasis, and therefore to ductular reaction and fibrosis The aim of this...

Ngày tải lên: 13/08/2014, 13:20

28 230 0
Mark the letter a, b, c, or d on your answer sheet to indicate the word that differs from the rest in the position of the main stress in each of the following questions

Mark the letter a, b, c, or d on your answer sheet to indicate the word that differs from the rest in the position of the main stress in each of the following questions

... discuss? A The architecture of early America Indian buildings B The movement of American Indians across North America C Ceremonies and rituals of American Indians D The way of life of American Indian ... questions wandered the dry and mountainous lands between the Rocky Mountains and the Pacific Ocean They gathered seeds and hunted small animals such as rabbits and snakes In the Far North, the ancestors ... following animals was most important to the Plains Indians? A The salmon B The caribou C The seal D The buffalo Question 80 Which of the following is NOT mentioned by the author as a dwelling place of...

Ngày tải lên: 08/10/2014, 16:46

13 3,6K 0
Mark the letter a  b  c or d on your answer sheet to indicate the word that differs from the rest in the position of the main stress in each of the following questions

Mark the letter a b c or d on your answer sheet to indicate the word that differs from the rest in the position of the main stress in each of the following questions

... by the weather A Because of the bad weather, our excursion to London was put off later B Our plans for an excursion to London have fallen through because the weather was so bad C The bad weather ... enough, so he failed in the exam A The reason why he failed in the exam was that he didn’t work hard enough B The reason he failed in the exam was because he didn’t work hard enough C The reason for ... weather was the reason that made our excursion to London have been fallen over D Our plans for an excursion have fallen away because the weather was bad Question 44 : Everyone started complaining the...

Ngày tải lên: 08/10/2014, 16:46

15 4,2K 0
homomorphisms of the fundamental group of a surface into psu(1,1), and the action of the mapping class group

homomorphisms of the fundamental group of a surface into psu(1,1), and the action of the mapping class group

... thank my friends of many years Avra Charalambous, Georgia Papageorgiou and Anna Sidera for their continual support and the great summers I spent with them I thank my grandparents Panagiota and ... brothers Michael-Zenios and Charalambos Finally I thank the Department of Mathematics at the University of Arizona 5 DEDICATION To my parents, Andreani and Savvas Konstantinou, who made all ... Maria Agrotis, Lisa Berger, Arlo Caine, Derek Habermas, Selin Kalaycioglu, Alex Perlis and Sacha Swenson Also many thanks to the wonderful staff of the Department of Mathematics I give a special...

Ngày tải lên: 13/11/2014, 09:14

88 324 0
w