fi c binding sites on the membrane

Báo cáo Y học: Membrane embedded location of Na+ or H+ binding sites on the rotor ring of F1F0 ATP synthases ppt

Báo cáo Y học: Membrane embedded location of Na+ or H+ binding sites on the rotor ring of F1F0 ATP synthases ppt

... positions on the fatty acid chain The uorescence yields depend on the spinlabel position and the concentration of the labelled lipids The relation of these results to the depth of the uorophore can ... known, that the specic reaction of cGlu65 with DCCD can be blocked by prior addition of Na+-ions It is accepted that DCCD reaches the binding site via the hydrophobic part of the membrane [41,51], ... reconstituted the native c- oligomer into lipid vesicles to probe the direct accessibility of the binding site from the aqueous environment The modication of the binding sites by DCCD was specically...

Ngày tải lên: 08/03/2014, 09:20

9 440 0
Báo cáo khoa học: DG-based prediction and experimental confirmation of SYCRP1-binding sites on the Synechocystis genome pot

Báo cáo khoa học: DG-based prediction and experimental confirmation of SYCRP1-binding sites on the Synechocystis genome pot

... TGTGATCC|AGATCACA 0.0 ± 0.0 TGTGATCT|AGATCACA TGTGATCT|GGGTCACA 0.0 ± 0.0 0.3 ± 0.1 GGTGATCT|AGATCACA 0.7 ± 0.2 TGTGATCT|AAATCACC 1.1 ± 0.2 TGTGATCT|CCGTCACC GGTGATTC|TAATCACA TGTGATTA|TTCTCACA ... AATGCTCC|GGGTCACT TGTAATTC|TGAGCACA TGTGACTA|CAACCACA TGTGATTG|AGACCATA 3.2 3.3 3.6 3.7 3.7 3.7 AATGCCCT|GCGTCACA 3.8 ± 0.4 AGTGCTCC|GGAACACT TGTGCTAT|TGCTCACG TGTAATCC|AGGTTACA 3.8 ± 0.5 3.8 ± 0.3 ... TGTGATGA|CCGTCATA 1.6 2.0 2.6 2.8 TGTGTCCT|GGGTCACT GGTGATTA|CTATCACG 3.0 ± 0.3 3.1 ± 0.4 GGTGTTGG|AGATCACA AGTGATGT|TTATCATT 3.1 ± 0.3 3.1 ± 0.4 GGTGACCC|AGACCACT AGTGATTA|TACTCACA AATGCTCC|GGGTCACT...

Ngày tải lên: 30/03/2014, 10:20

10 245 0
Báo cáo khoa hoc:" Application of a biotin functionalized QD assay for determining available binding sites on electrospun nanofiber membrane" pdf

Báo cáo khoa hoc:" Application of a biotin functionalized QD assay for determining available binding sites on electrospun nanofiber membrane" pdf

... Fluorescence emission spectra of PVC-COOH electrospun nanofiber membrane with and without 10% w/w carbon black at 400 nm excitation Fluorescence was measured on an Aminco Bowman II front face spectrophotometer ... nm emission filter set) Control membranes for measurement of fluorescence background and nonspecific binding of the QDs to the nanofibers were also included in the assay The nonspecific binding ... reduced the fiber autofluorescence, especially in the red region, Figure The autofluorescence emission spectrum of PVC-COOH containing 10% CB decreased steadily (nearly linear) moving towards longer...

Ngày tải lên: 11/08/2014, 08:20

7 237 0
Identification of the Pba1 and Pba2 Binding Sites on 20S Core Particle Intermediates

Identification of the Pba1 and Pba2 Binding Sites on 20S Core Particle Intermediates

...  these  precursors  contain the  Ump1   chaperone  protein    Little  is  known  about the  specific  function  of the  Pba1p-­‐Pba2p    In   order  to  assess the  functional  importance ...  CuCl2  Crosslinking  10-­‐Fold     Increase  in  Protien  Concentration     69   Figure  10  A    Pba1p-­‐α6  CuCl2  Crosslinking  10-­‐Fold  Increase  in  Protein     Concentration ...  Crosslinking  Controls:  Pba2p-­‐α7  CuCl2  Crosslinking  10-­‐Fold  Increase  in   Protein  Concentration     76   Figure  14  A    Total  Fractions  of  Pba2p-­‐α7  CuCl2  Crosslinking...

Ngày tải lên: 24/08/2014, 13:48

102 277 0
Tài liệu Báo cáo khoa học: Effect of deletion of the DNase I hypersensitive sites on the transcription of chicken Ig-b gene and on the maintenance of active chromatin state in the Ig-b locus docx

Tài liệu Báo cáo khoa học: Effect of deletion of the DNase I hypersensitive sites on the transcription of chicken Ig-b gene and on the maintenance of active chromatin state in the Ig-b locus docx

... this case, the formation of cell type-speci c DHS again does not occur in the context of a DNase I sensitive chromatin region, or a region with active-type histone modifications Transgenic mice ... of the active chromatin state Results Generation of DT40/Cre cells with a long deletion in one allele of the Ig-b locus To genetically examine the mechanism of B cell-speci c transcription of the ... of region IV was carried out by the introduction of the region IV deletion construct into 16 kb Del cells Genomic Southern hybridization was performed to confirm deletions (Fig 3) For region I (Fig...

Ngày tải lên: 19/02/2014, 16:20

11 639 0
Báo cáo khoa học: Analysis of DNA-binding sites on Mhr1, a yeast mitochondrial ATP-independent homologous pairing protein potx

Báo cáo khoa học: Analysis of DNA-binding sites on Mhr1, a yeast mitochondrial ATP-independent homologous pairing protein potx

... excited at 295 nm The inset shows the relative fluorescence changes at 350 nm against the DNA concentrations of the Mhr1–essDNA complex (filled circle) and Mhr1-unmodified DNA complex (open circle) ... understand the mechanisms of HP, it will be crucial to determine how each HP protein causes a similar structural change in the DNA These investigations should include the identification and characterization ... with mM MgCl the reduction in the efficiency of FRET in the presence of the W71F or W165A mutants was not due to defects in the DNA -binding activities of these mutants DNA -binding activities of...

Ngày tải lên: 06/03/2014, 09:22

13 447 0
Báo cáo khoa học: Protein–protein interactions and selection: generation of molecule-binding proteins on the basis of tertiary structural information potx

Báo cáo khoa học: Protein–protein interactions and selection: generation of molecule-binding proteins on the basis of tertiary structural information potx

... & Vita C (1996) Changing the structural context of a functional beta-hairpin Synthesis and characterization of a chimera containing the curaremimetic loop of a snake toxin in the scorpion alpha ... affinity, but some local library approaches can compensate The identification of the binding site on a protein from visualized tertiary structures can lead to the construction of an efficient library ... interleukin-6, CD40L, and CD28 Conclusions and outlook Accurate structural descriptions of protein–protein complexes provide support for the replacement of binding site sequences and thus binding function...

Ngày tải lên: 06/03/2014, 11:20

9 506 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc

Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc

... forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), GLU H447A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T462A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU ... molecule A 2164 Catalytic site The catalytic reaction of glucoamylases proceeds with inversion of configuration at the anomeric carbon which requires a pair of carboxylic acids at the active B Fig ... to be connected with the catalytic function One explanation lies in the fact that the loop protrudes from the surface of the molecule and does not form any additional contacts with the molecule...

Ngày tải lên: 07/03/2014, 12:20

11 550 0
Báo cáo khoa học: Atrial natriuretic peptide-dependent photolabeling of a regulatory ATP-binding site on the natriuretic peptide receptor-A pptx

Báo cáo khoa học: Atrial natriuretic peptide-dependent photolabeling of a regulatory ATP-binding site on the natriuretic peptide receptor-A pptx

... GGTGAAAGAGGCTCTTCTACACGTGGTTAAGGTA C- 3¢ and 5¢-CTTAACCACGTGTAGAAGAGCCTCTTT CACCTCTCTTGAGTTGC-3¢) was ligated to complete the construction up to amino acid R833 of wild type NPR-A and to include the C- terminal ... induce a conformational change in the intracellular KHD This conformational change would allow ATP binding to the KHD Thus, preincubation of membranes with ANP should increase the speci c photoaffinity ... by vacuum filtration on GF ⁄ C filters, as described in the Experimental procedures *Significant difference when compared with untreated WT Each column is expressed as the percentage of speci c 125I-labeled...

Ngày tải lên: 16/03/2014, 23:20

12 338 0
Báo cáo Y học: High pressure-induced changes of biological membrane Study on the membrane-bound Na+/K+-ATPase as a model system pdf

Báo cáo Y học: High pressure-induced changes of biological membrane Study on the membrane-bound Na+/K+-ATPase as a model system pdf

... are factors for inducing such phase transitions of the lipid bilayer, which is accompanied by changes in thickness and the cross-sectional area of the hydrocarbon region [43,45,46] These changes ... the contact surface between the transmembrane segment and the lipid bilayer to permit to take up of water from the medium H±T exchange could occur on these contact surfaces After release of the ... (1970) Thermodynamics of protein denaturation A calorimetric study of the reversible denaturation of chymotrypsinogen and conclusions regarding the accuracy of the two-state approximation Biochemistry...

Ngày tải lên: 24/03/2014, 00:21

9 433 0
Báo cáo khoa học: Autoregulatory binding sites in the zebrafish six3a promoter region define a new recognition sequence for Six3 proteins potx

Báo cáo khoa học: Autoregulatory binding sites in the zebrafish six3a promoter region define a new recognition sequence for Six3 proteins potx

... deletion constructs coinjected with six3a mRNA, we observed significant reductions in the numbers of EGFP-expressing cells for three constructs in which the deletions included speci c high-affinity sites ... have a function in vivo, we made several promoter–reporter constructs with small deletions of regions containing particular sites These constructs, which were made 1764 from the construct pS3aPG ... high-affinity sites was significantly higher among the G1-containing sites An additional comparison of the relative strengths of the various high-affinity binding sites conducted with lower amounts of competitor...

Ngày tải lên: 29/03/2014, 08:20

15 349 0
Báo cáo khoa học: Co-operation of domain-binding and calcium-binding sites in the activation of gelsolin pptx

Báo cáo khoa học: Co-operation of domain-binding and calcium-binding sites in the activation of gelsolin pptx

... following mechanism for the activation of gelsolin by calcium Low calcium concentrations are proposed [18,21,22] to ÔunlatchÕ the connection between G2 and G6, but higher concentrations are required ... that the orientation between the two domains is different and the junction more accessible in EGTA Calcium induced change in the G4–6 and G2 domains Conformation changes induced by calcium binding ... J Biochem 270) Fig Effect of calcium on the fluorescence of the FITC labeled G4–6/ G2 complex Maximum fluorescence enhancement (% initial fluorescence) extrapolated to infinite G2 concentration is...

Ngày tải lên: 31/03/2014, 01:20

8 407 0
Báo cáo khoa học: "Histochemical Characterization of the Lectin-binding Sites in the Equine Vomeronasal Organ" potx

Báo cáo khoa học: "Histochemical Characterization of the Lectin-binding Sites in the Equine Vomeronasal Organ" potx

... cartilage The sensory and nonsensory epithelia were located on the medial and lateral walls of the VNO The sensory epithelium consisted of the receptor, supporting cells, and basal cells The J acobson's ... lectin-specific reactivity observed on the VNO microvilli may be due to the presence of glycosylated molecules that are associated with vomeronasal signal transduction The marmoset receptor cells ... with chemoreception Furthermore, it is likely that the differential lectin -binding patterns in the horse reflect the species-specificity of the carbohydrates in the VNO 10 11 References Carter,...

Ngày tải lên: 07/08/2014, 17:22

5 254 0
Báo cáo khoa học: "Characterization of Antigenic Sites on the Rinderpest Virus N Protein Using Monoclonal Antibodies" docx

Báo cáo khoa học: "Characterization of Antigenic Sites on the Rinderpest Virus N Protein Using Monoclonal Antibodies" docx

... competition was found among the sites C, D and E on the N protein of RPV-LATC The sites C and D were sequential while the site E was conformation Characterization of Antigenic Sites on the Rinderpest ... RPV-specific sites on the N protein of the RPV-RBOK, indicating that at least three additional RPV/ PPRV-common antigenic sites may be present on the N protein of the RPV-LATC Non-reciprocal competition ... antigenic differences between virus strains and the preparation of the Mabs depend on the delineation of the sites Therefore, additional information about the antigenic sites on the N protein of the...

Ngày tải lên: 07/08/2014, 17:22

9 280 0
Báo cáo khoa hoc:" Despite WT1 binding sites in the promoter region of human and mouse nucleoporin glycoprotein 210, WT1 does not influence expression of GP210" pptx

Báo cáo khoa hoc:" Despite WT1 binding sites in the promoter region of human and mouse nucleoporin glycoprotein 210, WT1 does not influence expression of GP210" pptx

... specific inner primer (5'CCCGCCGCCAACAGCACCGACAGC3') The conditions for both PCR reactions were as follows: 94 C for one (hot start) followed by 95 C for 20 s, 68 C for 60 s, repeated 35 cycles ... the gene specific outer primer (5'CAGCAGCACTTTGGGGATGTTGAG3'), in the second PCR the inner adapter primer (5'CGCGGATCCGAACACTGCGTTTGCTGGCTTTGATG-3') was used in combination with the gene specific ... the consensus splice donor (GT) and acceptor (AG) sites, except for the splice donor sites of intron (AT) and10 (GC) The introns sizes were between 74 (intron 38) and 20198 bp (intron 1) Introns...

Ngày tải lên: 11/08/2014, 08:20

11 274 0
Báo cáo y học: "InSite: a computational method for identifying protein-protein interaction binding sites on a proteome-wide scale" pot

Báo cáo y học: "InSite: a computational method for identifying protein-protein interaction binding sites on a proteome-wide scale" pot

... predictions: one for each direct protein interaction in the complex and each motif on each of the two proteins Among the 123 potential predictions, 68 (55.3%) are actually binding according to the ... explicitly computes the confidence that a specific motif occurrence mediates the binding of a specific interacting protein pair These finer-grained predictions allow us to identify the specific ... mutation that occurs by chance in the cancer cell Even for driver mutations, the mechanism by which it leads to cancer is often unknown We considered those mutations that fall in InSite predicted binding...

Ngày tải lên: 14/08/2014, 08:20

18 251 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

... OMCA-KO-F OMCA-KO-R OMCB-KO-F OMCB-KO-R OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC ... TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R OMCB-PBAD-F OMCB-PBAD-R ... Fe(III)-nitrilotriacetic acid concentration, and Ks is the halfvelocity constant As we have determined the OmcA and OmcB concentrations present in omcB– and omcA– cells, respectively, and because omcA– omcB–...

Ngày tải lên: 07/03/2014, 09:20

11 732 0
Báo cáo khoa học: The ‘pair of sugar tongs’ site on the non-catalytic domain C of barley a-amylase participates in substrate binding and activity potx

Báo cáo khoa học: The ‘pair of sugar tongs’ site on the non-catalytic domain C of barley a-amylase participates in substrate binding and activity potx

... 5Â-GATCGGGTCCAGGGCCGACGTC -GG-3Â; Y380M, 5Â-GATCGGGTCCAGGATGGACGT CGG-3Â; Y380F, 5Â-GATCGGGTCCAGGTTCGAC GTCGG-3Â (underlined mutant codon) coding for the sense strand, and 5Â-TTTGGTACCTCAGTTCTTCTCCCAGA ... a-glucan chains were accommodated at the active site and at the two surface sites [21], one cannot on a structural basis, model interactions in the multiple attack mechanism showing the substrate chain ... Standard cloning techniques were used [46] Site-directed mutagenesis was done by the mega-primer method [47] using for S378P, 5Â-GATCGGGCCCAGGTACGACGTC GG-3Â; S378T, 5Â-GATCGGGACCAGGTACGACGTCG G-3Â;...

Ngày tải lên: 23/03/2014, 07:20

13 385 0
Báo cáo y học: "Tetra-O-methyl nordihydroguaiaretic acid (Terameprocol) inhibits the NF-B-dependent transcription of TNF-a and MCP-1/CCL2 genes by preventing RelA from binding its cognate sites on DNA" ppsx

Báo cáo y học: "Tetra-O-methyl nordihydroguaiaretic acid (Terameprocol) inhibits the NF-B-dependent transcription of TNF-a and MCP-1/CCL2 genes by preventing RelA from binding its cognate sites on DNA" ppsx

... (forward:5’-TCTCAAGCTGCTCTGCCTTC-3’; reverse:5’CACCAGGATTCTGTGGCAAT-3’) RANTES/CCL5: (Forward:5’-TGGAGGGCAGTTAGAGGCAGAG-3’; reverse:5’-AGCCAGGGTAGCAGAGGAAGTG-3’) and MCP-1/CCL2:(Forward:5’-ATTCTTCCCTCTTTCCC CCCCC-3’;reverse:5’-TCCGCTGAGTAAGTGCAGA ... AGA GGC ACT CCC CCA AAA 3’; sense: 5’ CCG AAG TTC AGT AGA CAG AAG AGC G 3’]; MCP-1/CCL2 [sense: 5’ CAC TAT GCA GGT CTC TGT CAC G 3’; antisense: 5’ GAT CTC ACT TGG TTC TGG TCC A 3’]; RANTES/CCL5: ... primers specific for murine GAPDH, TNF-a, MCP-1/CCL2, and RANTES/ CCL5 genes Primer combinations are GAPDH [antisense: 5’ ATG TCA GAT CCA CAA CGG ATA GAT 3’; sense: 5’ ACT CCC TCA AGA TTG TCA GCA AT...

Ngày tải lên: 11/08/2014, 03:20

11 622 0
w