Nghiên cứu phân loại, đặc điểm phân bố và quan hệ di truyền các loài chuột chù (MAMMALIA SORICOMORPHA) ở việt nam TT TIENG ANH

MINISTRY OF EDUCATION AND TRAINING VIETNAM ACADEMY OF SCIENCE AND TECHNOLOGY GRADUATED UNIVERSITY OF SCIENCE AND TECHNOLOGY - Bui Tuan Hai THE STUDY ON TAXONOMY, DISTRIBUTION AND PHYLOGENETIC RELATIONSHIP OF EULIPOTYPHLAN SPECIES (MAMMALIA: SORICOMORPHA) FROM VIETNAM Curriculum: Zoology Major ID number: 42 01 03 SUMMARY OF BIOLOGICAL PhD THESIS Hanoi – 2021 The thesis was completed at: Graduated University of Science and Technology, Vietnam Academy of Science and Technology Supervisor 1: Assoc Prof PhD Le Xuan Canh Supervisor 2: Prof PhD Masaharu Motokawa Reviewer 1: … Reviewer 2: … Reviewer 3: … The thesis are going to be defended in front of Evaluation Council of Graduated University of Science and Technology, Vietnam Academy of Science and Technology on ……… The thesis can be found at: - Library of Graduated University of Science and Technology - National Library of Vietnam INTRODUCTION Rationale The order Eulipotyphla has four families Erinaceidae, Siricidae, Talpidae, and Solenodontidae, containing a total of 530 species and 55 genera (Wilson & Mittermeier, 2018) Under IUCN (2019-2) status the species ranged from 11 Critically Threatened (CR), 41 Endangered (EN), 25 Vulnerable (VU) and 16 Near Threatened (NT) In the last 20 years, the previous studies on Eulipotyphla in Southeast Asia (including Vietnam) focused on discovering new species and improving phylogenetic analyses of its members While the taxonomy and systematic of Eulipotyphla species has long been debated The distribution of some species were explored by administrative units or forest areas, but there is no research assessed by zoogeography, habitats and elevation Moreover, recent studies show that knowledge on phylogenetic relationship of Vietnam’s eulipotyphlan species/populations is still limited Thus, this study, named “The study on taxonomy, distribution and phylogenetic relationship of eulipotyphlan species (MAMMALIA: EULIPOTYPHLA) from Vietnam” aims to assess species composition, diversity, distribution and phylogenetic relationship of gymnures, shrews and moles from Vietnam The research was approached by combining morphological and molecular Purposes 1) Exploring the species diversity of eulipotyphlan mammals (Mammalia, Eulipotyphla) in Vietnam 2) Research on distribution of eulipotyphlan mammals in Vietnam by zoogeography, habitats and elevation 3) Analysis of phylogenetic relationships of populations, species and groups of eulipotyphlan mammals from Vietnam Tasks Task 1: Explore the eulipotyphlan species diversity in Vietnam - Provide the updated checklist of gymnures, shrews and moles - Describe, analysis and compare the external morphology and skull - Provide the identification keys for eulipotyphlan species Task 2: Discover species distribution - Discover species distribution by zoogeography - Discover species distribution by habitats - Discover species distribution by elevation Task 3: Analysis the phylogenetic relationships populations, species and genera of Eulipotyphla between - Analysis the phylogenetic variation among the populations of wide distribution species - Analysis the phylogenetic variation among species and between genera - Construct the phylogenetic trees CHAPTER LITERATURE REVIEW 1.1 Overview of studies on mammal composition in the world Scientific research on mammals is believed to officially begin with Aristotle's findings (384–322 BC) The mammal species composition of the world was studied by a lot of scientists such as Trouessart, Wilson & Reeder, Nowak, Honacki, etc To date, Burgin et al (2018) and the American Society of Zoology (2019) have listed 6495 species (96 extinct, 6399 existent) belonging to 1314 genera, 170 families, 27 orders 1.2 Overview of taxonomic classification of Eulipotyphla in the world The “Insectivora” was used as a wastebasket taxon for a variety of small to very small, relatively unspecialised mammals that feed upon insects by paleontologists Haeckel (1866) reclassified the order Lypotyphla including the families Soricidae, Talpidae, Erinaceidae, Tenrecidae, Chrysochloridae, Solenodontidae and Nesophontidae (extinct) Recently, molecular and evolution studies by Nishihara et al (2009), He et al (2010), Sato et al (2016), Brace et al (2016), Spinger et al (2017, 2018) showed a close relationship of families Soricidae, Talpidae, Erinaceidae and Solenodontidae and classified them in the Eulipotyphla order Synthesizing studies of Eulipotyphla in the world, Wilson & Mittermeier (2018) have listed 530 species, belonging to 55 varieties, families 1.3 Overview of studies on mammals in Vietnam 1.3.1 Before 1945 The history of studying the fauna in Vietnam is considered to have started in the XVIII century with works such as "Van Dai Loai Ngu", "Phu Bien Tap Luc" by Le Quy Don (1724 - 1784) In early XIX century, research on wild mammals from Vietnam has been offically begun with the surveys of Finlayson et al (1826) Then, the specimens of these surveys were studied and published by Dustales (1874, 1893, 1898), Germain (1887) Gurney (1889),… In the late XIX and early XX centuries, studies on the fauna in Vietnam continued to be carried out by European experts such as Milne - Edwards (1868 - 1874), Morice (1875), Brousmiches (1887), Heude (1894), Billet (1896), Pousargues (1898), Pavie (1904), Boutan (1906), Bonhote (1907), Osgood (1932), Blane (1932), Delacour (1934), Bourret (1942) These studies contributed many new species for Vietnamese fauna 1.3.2 The period of 1954 - 1975 During this period, the researches on mammals were widely conducted in the Northern Vietnam A lot of domestic and international articles about mammals were published at that time especially such as Vo Quy et al (1961), Le Hien Hao (1962, 1964, 1969, 1973), Dang Huy Huynh and Vu Dinh Tuan, Dang Huy Huynh and Cao Van Sung (1965, 1973), Dao Van Tien (1966), Le Vu Khoi (1970), Van Peenen et al (1967, 1969, 1970, 1971); Duncan et al (1970, 1971) 1.3.3 The period from 1975 to present After 1975, the studies on biological resources, including mammal fauna were promoted and had great developments with many major national projects and international cooperation The results were published in monographs, domestic and international journals Some typical publications on this duration following: Cao Van Sung et al (1980); Dang Huy Huynh et al (1981, 1994, 2007, 2008, 2010); Dao Van Tien (1985); Cao Van Sung (1989); Le Vu Khoi (2000); Kuznetsov (2006); Dang Ngoc Can et al (2008); Nguyen Xuan Dang and Le Xuan Canh (2009) 1.4 Overview of studies on Eulipotyphla in Vietnam The first record of insectivores in Vietnam was reported by Osgood (1932) with six species Referring to recent studies, Bui Tuan Hai et al (2019) provided the latest updated checklist of Eulipotyphla in Vietnam including 37 species and sub-species, belonging to 12 genera and families Regarding molecular research, Bannikova et al (2011, 2017, 2019), Zemlemerova et al (2013, 2016), Shinohara et al (2014, 2015), He et al (2014, 2018), Abramov et al (2015, 2017a, b, 2018), Li et al (2019) studied on the genera of Crocidura, Blarinella, Chimarrogale, Chodsigoa, Episoriculus, Euroscaptor in Southeast Asia and South China, including samples obtained from Vietnam CHAPTER SUBJECTS, SCOPE, MATERIALS AND METHODOLOGY 2.1 Subjects, scope and materials This study focused on taxonomy, distribution and phylogenetic relationships of insectivores (Mammalia, Eulipotyphla) in Vietnam We examined a total of 831 specimen vouchers including 677 bodies and 778 skulls collected in Vietnam We conducted DNA analysis of a total 87 sequences from 81 specimen vouchers of 23 species Among them, we used our 60 sequences and 125 sequences data from GenBank which were published in earlier studies for reconstructing phylogenetic relationships 2.2 Duration and locations This thesis showed my results from 2012 to 2019 with 40 field surveys, including 407 days in the field (from 2017 to 2019 (PhD course): 21 surveys and 167 days in the field) Among them, a part of the results from 2013 to 2015 were published in my master thesis named “Study on classification and phylogenetic relationship of white-toothed shrews of the genus Crocidura (Mammalia: Soricidae) in Vietnam” which were updated and supplemented in this study The study was carried out based on the specimens collected at 66 locations in 37 provinces and cities in Vietnam Among them, I surveyed and collected new specimens at 33 locations in 21 provinces (Fig 2.1) Fig 2.1 Map of survey and locations of studied specimens Laboratory studies were conducted at the Department of Nature Conservation (Vietnam National Museum of Nature), Department of vertebrate zoology (Institute of Ecology and Biological Resources, Zoological Institute of Russian Academy of Sciences in Saint-Peterburg and The Kyoto University Museum 2.2.1 General characteristics of nature in Vietnam Vietnam is located in the tropical belt of the Northern Hemisphere, with diverse geological, topographic, climatic and hydrological features, leading to biodiversity and abundance in general and mammal species in particular 2.2.2 Biogeographical zonation of mammals in Vietnam On the basis of factors such as topography, geomorphology, climate, environment, adaptation and distribution of flora and fauna in Vietnam, Nguyen Xuan Dang and Le Xuan Canh (2009) and Le Vu Khoi et al (2015) have divided into biogeographical distribution ranges, including Northeast, Northwest, North Central, South Central and Central Highlands, and Southern 2.3 Methods 2.3.1 Collecting specimens Interviewing and selecting survey areas: Interviewing experts, rangers and villagers to collect information Trapping: The cage traps, Sherman traps, pitfall traps and tunnel traps were set on the trails to collect the specimens with the baits such as dried fishes, earthworms, craps, cereals or mixed instant food for cats Field preparation of specimens: The captured individuals were labeled, photographed and measured The external body measurements were as follow: head and body length (HB), tail length (T), ear length (E), hind foot length (HF1, HF2), fore foot size (FF1, FF2, FFW), bristle hairs (BrH) and weight (Wt) were taken by tapeline and digital caliper Specimens were fixed and preserved in ethanol Other information: Collect the other information about environment, habitats, locations, elevation 2.3.2 Preparing skulls Stripping: Using a scalpel size #11 separate the skulls from the bodies Cleaning: Boil, degrease and remove muscle on the skulls 2.3.3 Comparing classification - Step 1: Perform the tables of skull measurements - Step 2: Calculate descriptive statistics (Max, Min, Average, Stdev) - Step 3: Conduct the Principal components analysis (PCA) using PAST on skull measurements - Step 4: Analyze, argue, compare different characteristics - Step 5: Classify based on the results of morphological comparison, statistical analysis, and BLAST on GenBank 2.3.4 Distribution status Geographical distribution of Eulipotyphla in Vietnam was accessed according to the actual distribution combined with information on the distribution of those species in the vicinity Arrange distribution of Eulipotyphla from Vietnam in habitats as follows: - Group 1: Limestone mountain (NĐV), Other mountain (NĐ) - Group 2: Woody forest (RCG); Bamboo forest (RTN); Shrubs and grass (CBC); Agricultural farm (ĐR); Residential area (DC) - Group 3: Constantly affected by humans (T); Less affected by humans (I) Arrange distribution of Eulipotyphla from Vietnam in altitudinal gradients above the sea level, including: I: : I: - 600m; II: 600 - 1600m; III: 1600 - 2600m; IV: higher than 2600m The division of altitudinal gradients was based on the temperature of the hot season on the basis of the elevational belt in the tropical monsoon climate zone and the sub-monsoonal equatorial climate zone (Vu Tu Lap, 2007) Similarity coefficient was calculated using the formula: H = 2c / (a + b) In particular, “c” is the number of species present in both areas, habitats altitudinal zones “a” and “b” respectively in the number of species present in each region, habitat or altitudinal zone (Sorensen’s index, Shannon Wiener, 1963) 2.3.5 Molecular analysis - Sampling: tissue in the liver or thigh muscles - Studied gene locus: Cytb, 12S and Rag - Primers: Cytb SoriF TGACATGAAAAATCATCGTTG SoriR CCA TCT CTG GTT TAC AAG AC The sequence of the RAG-1 gene was amplified using the primer pair RAG1-F1851 and Rag1-R2486 (Sato et al., 2004) The 12S gene was amplified with the following primer sets: L613 (Mindell et al., 1991) and H1066 (Suzuki et al., 1997) - DNA purification: kit DNeasy Blood and Tissue (QIA gen) - PCR: using Ultra-Pure Taq for cytb, and Dreamtaq for Rag1 and 12S - Gel electrophoresis: using gel agarose 1% - Sequencing: FirstBase Sequencing INT in Malaysia - Sequence alignment and phylogenetic analysis: using MEGA X, Kakusan 4.0, MrBayes 3.2.7, Tracer 1.7.1, Treefinder, Figtree 1.4.4 and Ai CHAPTER RESULTS AND DISCUSSION 3.1 Species composition of Eulipotyphla in Vietnam 3.1.1 Species composition A total of 37 species and subspecies of insectivore mammals belonging to 13 genera in three families has been recorded from Vietnam (Table 3.1) Table 3.1 Eulipotyphla in Vietnam No Scientific name English name I ERINACEOMORPHA ERINACEOMORPHA A Galericidae Gymnure and Hedgehog a Galericinae Gymnure Hylomys suillus Short-tailed gymnure Neotetracus sinensis Shrew gymnure + Neoymolys hainanensis Hainan gymnure (EN) II TALPOMORPHA TALPOMORPHA A Talpidae Mole a Talpinae Scaptonyx fusicaudus+ Long-tailed mole Mogera latouchei Latouche’s mole Euroscaptor kuznetsovi Kuznetsov’s mole Euroscaptor orlovi Orlov’s mole Euroscaptor parvidens* Small-toothed mole E p ngoclinhensis* Ngoclinh mole 10 Euroscaptor subanura* Short-tailed mole III SORICOMORPHA SORICOMORPHA A Soricidae Shrew a Soricinae Brown-toothed shrew 11 Anourosorex squamipes Chinese mole shrew 12 Blarinella quadraticauda Sichuan short-tailed shrews (NT) 13 Chodsigoa caovansunga Cao Van Sung’s shrew 14 Chodsigoa hoffmanni Hoffmann’s shrew + 15 Chodsigoa parca Lowe’s shrew 16 Chimarrogale himalayica Himalayan water shrew 17 Chimarroalge varennei* Varenne’s water shrew 18 Episoriculus baileyi Bailey’s shrew + 19 Episoriculus macrurus Arboreal Brown-toothed Shrew 20 Episoriculus umbrinus+ Hidden Brown-toothed Shrew b Crocidurinae White-toothed shrew 11 - Dental formula: (I 1/1, U 5/2, P 1/1, M 3/3) (x2) = 32 3.2.3.2 Cao Van Sung’s Shrew - Chodsigoa caovansunga - Diagnosis: T/HB = 88 - 101%, BrH/T = 50% - Dental formula for genus Chodsigoa: (I 1/1, U 3/1, P 1/1, M 3/3) (x2) = 28 3.2.3.3 Hoffmann’s Shrew - Chodsigoa hoffmanni - Diagnosis: Light color-tipped tail, tail length approximately equal to head and body length with bristle hairs covering all tail 3.2.3.4 Lowe’s Shrew - Chodsigoa parca - Diagnosis: dark at the tip with a tuft of hair 3.2.3.5 Bailey’s Shrew - Episoriculus baileyi - Diagnosis: The upper unicuspid row is longer than other Episoriculus species in Vietnam T/HB ~ 100% - Dental formula for genus Episoriculus: (I 1/1, U 4/1, P1/1 M 3/3) (x2) = 30 3.2.3.6 Arboreal Brown-toothed Shrew - Episoriculus macrurus - Diagnosis: Tail longer than head and body Semi-aboreal 3.2.3.7 Hidden Brown-toothed Shrew - Episoriculus umbrinus - Diagnosis: I1 short, I1 talon is lower than that of U1 B Soricinae - Pseudo Brown-toothed Shrews White teeth, larger than other species of Soricidae in Vietnam 3.2.3.8 Mole-shrew - Anourosorex squamipes - Diagnosis: Tiny eyes There are no external ear pinna, forefoot like shrew Very short tail - Dental formula: (I 1/1 U 2/1 P 1/1 M 3/3) (x2) = 26 3.2.3.9 Himalayan Water Shrew - Chimarrogale himalayica - Diagnosis: Hindfeet are lined with prominent fringes of white hairs Posterior borders of the P1 and M1 are deeply concave and the apex of the palatal suture is straight and extends to the level of the M2 - Dental formula for genus Chimarrogale: (I 1/1, U3/1, P1/1, M3/3) (x2) = 28 3.2.3.10 Varenne’s Water Shrew - Chimarrogale varennei - Diagnosis: The moderately prominent protocone and hypocone of the P1 and M1 so the posterior borders are less concave, and the palatal suture extends anteriorly beyond the anterior border of the M2 C Crocidurinae - White-toothed Shrews True white-toothed Suncus murinus is the biggest shrew and Suncus 12 etruscus is the smallest shrew in Vietnam Crocidura species were arranged into three groups on the basis of greatest length of the skull as longer than 23mm, 19-23mm and less than 19mm 3.2.3.11 Etruscan Shrew - Suncus etruscus - Diagnosis: Very small (weight ~ 1.5g), T/HB ~ 60% Tail is covered with bristle hairs - Dental formula for genus Suncus: (I 1/1 U 4/1 P 1/1 M 3/3) (x2) = 30 3.2.3.12 Asian House Shrew - Suncus murinus - Diagnosis: Much larger than S etruscus and most other Vietnamese shrews Tail with scattered vibrissae Color varying from pale grey to dark brown 3.2.3.13 Dracula Shrew - Crocidura dracula - Diagnosis: Tip of the tail is sometimes white In P4, protocone is lower than paracone Occipital foramen is narrow in lower margin - Dental formula for genus Crocidura: (I 1/1, U 3/1, P 1/1, M 3/3) (x2) = 28 3.2.3.14 Southeast Asian Shrew - Crocidura fuliginosa - Diagnosis: Similar in external morphology and skull to C dracula The rostrum is much more slender than C dracula Wide lower margin of occipital foramen 3.2.3.15 Asian Gray Shrew - Crocidura attenuata - Diagnosis: Grayish brown on the dorsal Tail 60-80% of head and body length BrH/T ~ 2/3 3.2.3.16 Taiwanese Gray Shrew - Crocidura tanakae - Diagnosis: Morphologically similar to C attenuata The palatal suture is “m” shaped 3.2.3.17 Sokolov’s Shrew - Crocidura sokolovi - Diagnosis: Equivalent in morphology to C attenuata and C tanakae but tail is longer Tail length 87-93% of head and body 3.2.3.18 Annamite Shrew - Crocidura annamitensis - Diagnosis: Tail bicolored, its length only 57-61% of head and body Bristle hairs is on proximal half of tail 3.2.3.19 Guy’s Shrew - Crocidura guy - Diagnosis: Tail bicolored, 65-79% of head and body length 3.2.3.20 Indochinese Shrew - Crocidura indochinensis - Diagnosis: The tail is stout at the base, tapering at the tip, with bristle 13 hairs present on the proximal about 20% 3.2.3.21 Ke Go Shrew - Crocidura kegoensis - Diagnosis: Tail 54 - 56% of head and body length On first two upper molars, the posterior margins are crescentic 3.2.3.22 Phan Luong’s Shrew - Crocidura phanluongi - Diagnosis: Bristle hairs on 66.7 - 75% of tail length Rostrum is slender, nose and foot are brighter than feather color 3.2.3.23 Phu Quoc Shrew - Crocidura phuquocensis - Diagnosis: Tail bicolored and its length 69 - 87% of head and body with bristle hairs present on the proximal about 60% 3.2.3.24 Chinese White-toothed Shew - Crocidura rapax - Diagnosis: Tail length 63-69% of head and body Buccal side of second upper molar forms a continuous W-shaped 3.2.3.25 Sa Pa Shrew - Crocidura sapaensis - Diagnosis: Tail 65.57 - 75.33% of head and body length Bristle hairs extending along 20-25% of tail length 3.2.3.26 Hainan Island Shrew - Crocidura wuchihensis - Diagnosis: Tail length 62 - 88% of head and body; bristle hairs on about 20% of tail length 3.2.3.27 Zaitsev’s Shrew - Crocidura zaitsevi - Diagnosis: Tail length 54 - 69% of head and body; bristle hairs on about 2/3 of tail length 3.3 Identification key to Eulipotyphla in Vietnam IA Large size, yellowish-brown feathers, big eyes, zygomatic arch is well complete and sharp, > 40 teeth……… …… … Galericidae 1a T > 40% HB ……………… …… Neotetracus siensis 1b T < 40% HB…………… ………………… .…….2 2a 44 teeth……………………………… .… … …Hylomys suillus 2b 42 teeth………… … …… Neohylomys hainanensis IB Small size, small eyes, < 40 teeth II IIA Zygomatic arch is gracile, digging "hands", without unicuspid…………… Talpidae 1a T > 50% HB……… … .Scaptonyx fusicaudus 14 1b T < 50% HB………… 2a 42 teeth…………………… Mogera latouchei 2b 44 teeth…………… Euroscaptor… 3a T < 8% HB…… .….4 3b T > 8% HB ……… ….5 4a Caudal vertebrae – 9.… E subanura 4b Caudal vertebrae 12 – 14 .E parvidens 5a P1 height = P2 height, rostrum is broader… .E kuznetsovi 5b Răng P1 cao P2, rostrum is slender…… E orlovi IIB No zygomatic arch, small forefoot, walk on soles of feet, have unicuspids………… Soricidae 1A Brown toothed… …… .Blarinella, Chodsigoa, Episoriculus 1a Red toothed, unicuspids .…… B quadraticauda 1b Brown toothed, < unicuspids ……… ………2 2a unicuspids……… … Chodsigoa… 2b unicuspids …… … Episoriculus…… 3a No brush of long hair at the tip of tail…… C caovansunga 3b Tail has brush of long hair at the tip……… ….4 4a White hair at the tip of tail…… … C hoffmanni 4b Dark hair at the tip of tail C parca 5a Tail long, > 110% HB…… .…E macrurus 5b Tail ~ 100% < 110% HB… 6a Unevenly thick tympanic rings … E baileyi 6b Evenly thin tympanic rings .…… E umbrinus 1B White-toothed .…Anourosorex, Chimarrogale, Suncus, Crocidura 1a 26 teeth……… A squamipes 1b > 26 teeth ……… 2a 30 teeth………… …… 2b 28 teeth… ….4 3a Very large in size ……… …Suncus murinus 3b Very small in size .………… Suncus etruscus 4a Hind feet are lined with prominent fringes of hairs Chimarrogale 4b Without prominent fringes of hairs on hind feet .….Crocidura….…6 5a Border of P and M1 are deeply concave Chimarrogale himalayica 15 5b Border of P and M1 are less concave .Chi varennei 6a CIL > 23 mm………………… ……….………… .… …………7 6b CIL < 22 mm…………………………… …………… ……… 7a Lambdoid crests developed, narrow occipital foramen C dracula 7b Lambdoid crests flat, wide occipital foramen Crocidura fuliginosa 8a CIL > 19 mm…………………………………… …… ……… 8b CIL < 19 mm……………………………………… …… ……11 9a T > 85% HB ……………… …… … C sokolovi 9b T < 85% HB .C attenuatta & C tanakae… ….10 10a The palatal suture is “n” shaped………… …… … C attenuata 10b The palatal suture is “m” shaped…………….… … C tanakae 11a BrH/T < 60% .12 11b BrH/T > 60……………………………………… ………… 18 12a BrH/T ~ 50% .13 12b BrH/T < 25% .16 13a T/HB > 62% C guy & C rapax 14 13b T/HB < 62% C annamitensis & C kegoensis 15 14a CIL > 17mm…………………………… … …… C rapax 14b CIL < 16 mm…………… C guy 15a Ears and snout are brighter than feathers .C annamitensis 15b Ears and snout are darker than feathers …… C kegoensis 16a Large M3 …………………… .C indochinensis 16b Small M3 … .C sapaensis & C wuchihensis… 17 17a Occipital bone curved, narrow occipital foramen C wuchihensis 17b Occipital bone flat, narrow occipital foramen … … .C sapaensis 18a CIL < 16.5 mm……………… .C zaitsevi 18b CIL > 16.5 mm… C phanluongi & C phuquocensis… …19 19a Parastype of P4 lower than U3 .C phanluongi 19b Parastype P4 and U3 similar in height… .C phuquocensis 16 3.4 Geographic distribution 18 18 13 10 NO RT HW ES T NO RT HE AS T N AN NA M IT E M AN NM AI TE SA NN AM IT E SO UT HW ES T No species No typical species Fig 3.8 (Left) Geographic distribution ranges of Eulipotyphlan in Vietnam Fig 3.9 (Right) Number of species and number of typical species in geographic distribution ranges Insectivores from Vietnam were arranged into geographic distribution ranges (fig 3.8), including: - The Northwest (TB): From the west bank of the Red River to the western border, the South to the Ca River - The Northeast (ĐB): From the east bank of the Red River to the eastern border - The North Annamite (BTS): From the Ca River to the Bach Ma range - The Middle Annamite (TTS): From Bach Ma range to Da Rang river basin, including the plateaus of Kon Tum, Mang Den, Kon Ha Nung and Pleiku - The South Annamite (NTS): From the Da Rang River basin to the East bank of the Mekong River, including the plateaus of M'Drak, Dak Lak, Mo Nong, Lam Vien and Di Linh and the Southeast Delta - The Southwest (TNB): From the west bank of Mekong river to the southernmost (Ca Mau cape), including the coastal islands 17 3.5 Distribution according to the habitats 25 25 22 18 3.6 Distribution according to the altitudinal gradients 23 23 23 20 20 18 < 600M NĐV NĐ RCGRTN CBC ĐR DC T I Fig 3.10 Ratio chart of Insectivores distributed by habitats 600 1600M 1600 2600M No species > 2600M No typical species Fig 3.11 Ratio chart of Insectivores distributed by altitudinal gradients Table 3.25 Distribution information of Eulipotyphla in Vietnam No Species H suillus N sinensis N hainanensis1 S fusicaudus2 M latouchei E kuznetsovi E orlovi E parvidens E ngoclinhensis G r Habitats TB, ĐB, NĐV, NĐ - RCG, BTS, TTS, RTN, CBC, ĐR - T, I NTS, TNB TB NĐV - RCG, CBC - I ĐB ĐB NĐV, NĐ - RCG, TB, ĐB RTN, CBC, ĐR - T NĐV, NĐ - RCG, ĐB RTN, CBC - T, I NĐV - RCG, RTN, TB CBC - T, I NĐ - RCG, RTN, NTS CBC - T, I NĐV, NĐ - RCG, BTS, TTS RTN, CBC - T, I A g I, II, III, IV II, III, IV I, II II II, III II III I, II I, II, III 18 No Species G r TB, ĐB, BTS 10 E subanura 11 A squamipes TB, ĐB 12 B quadraticauda TB, ĐB 13 C caovansunga ĐB 14 C hoffmanni ĐB 15 C parca3 16 C himalayica 17 C verennei 18 19 20 21 E baileyi E macrurus4 E umbrinus5 C annamitensis6 22 C attenuata TB TB, ĐB, BTS BTS, TTS, NTS TB TB TB BTS Habitats NĐV, NĐ - RCG, RTN, CBC - T, I NĐV - RCG, RTN, CBC - T, I NĐV - RCG, CBC T, I NĐV - RCG, RTN, CBC - T, I NĐV - RCG, RTN, CBC - T, I A g I II, III, IV II, III II, III II, III III NĐV, NĐ - RCG, RTN, CBC - T, I NĐV, NĐ - RCG, RTN, CBC - T, I NĐV - CBC - I I, II, III I, II IV IV III II ĐB NĐV, NĐ - RCG, RTN, CBC - T, I I, II, III C tanakae TB, ĐB, BTS, TTS, NTS NĐV, NĐ - RCG, RTN, CBC - T, I I, II, III 24 C dracula TB, ĐB, BTS 25 26 27 C fuliginosa C guy5 C indochinensis4 28 C wuchihensis 29 C sapaensis 30 31 C kegoensis C phanluongi 23 TNB ĐB NTS TB, ĐB, BTS TB BTS NTS NĐV, NĐ - RCG, RTN, CBC, ĐR, DC T, I NĐ - RCG - T NĐV, NĐ - RCG, RTN, CBC - T, I NĐV - RCG, RTN, CBC - T, I NĐ - RCG - T I, II, III I I II I, II II, III I I 19 No Species 32 C phuquocensis7 33 C rapax6 34 C sokolovi 35 C zaitsevi 36 S etruscus 37 S murinus G r Habitats TNB TTS, NTS TTS NĐ - RCG - I BTS, TTS, NĐV, NĐ - RCG, NTS RTN, CBC - T, I TB, ĐB, NĐV, NĐ - RCG, BTS, TTS, RTN, CBC - T, I NTS,TNB TB, ĐB, NĐV, NĐ - RCG, BTS, TTS, RTN, CBC, ĐR, DC NTS,TNB T, I A g I I, II, III II I, II, III I, II I Notes: 1: Abramov et al (2018); 2: Lunde et al (2003); 3: Osgood (1932); 4: Abramov et al (2013b); 5: Abramov et al (2017a); 6: Jenkins et al (2009); 7: Abramov et al (2008b) G r.: Geographic ranges, A g.: Altitudinal gradients In general, Eulipotyphlan mammals in Vietnam are widely distributed in different geographic distribution ranges, habitats and altitudinal gradients The results showed that the competition in habitat selection, environmental changes, or effects of frequent interactions with humans have not too strong influence on the distribution insectivores from Vietnam However, insectivores are highly sensitive and short-lived mammals Thus, consideration should be given to each species or genus when assess the factors affecting the distribution Based on morphological and molecular approaching, our results suggested that C dracula and C fuliginosa are allopatric species within Southern China and Southeast Asia C dracula was distributed in China, Laos, and Vietnam limited to the East bank of the Mekong River On the contrary, C fuliginosa occurred in the westside of Mekong River throughout Malay Peninsula and Myanmar including the Vietnamese southernmost mainland and coastal islands, Cambodia, and Thailand Esselstyn et al (2009) indicated that the lineage divergence of the most recent common ancestor to C dracula sensu lato was taken place in nearly 20 mya Nie et al (2018) suggested that the Mekong River have started to drain since about 17 mya during the middle Miocene Therefore, we speculated that the speciation of these two sister species may relate to geographical isolation by the Mekong River 20 Fig 3.12 A: Distribution range of Crocidura fuliginosa (IUCN) B: Distritubion ranges of C dracula & C fuliginosa (Bui Tuan Hai et al 2020) 3.7 Phylogenetic relationships among species and among genera of Eulipotyphla in Vietnam Fig 3.13 showed that Eulipotyphlan species in Vietnam are clearly divided into groups with clades (Talpidae - clade A, Galericidae clade B, Soricidae Clades C and D) Clades B, C and D with low posterior probabilities The genetic distances from 21% to 34% Fig 3.13 BI/ML tree of cytb gene for families and genera of Eulipotyphla in Vietnam 21 Fig 3.14 BI/ML tree of cytb gene for Galericidae species in Vietnam The Galericidae species in Vietnam includings N sinensis (clade H), N hainanensis (clade I) and H suillus (clade L) show the sister relationship with low probability of bootstrap support Proportional distances of cytb among them were from 23% to 28% Specimen number Motokawa 624 may belong to not described yet genus Fig 3.15 BI/ML tree of cytb gene for Mole species in Vietnam The moles in Vietnam were clearly divided into clades Specimens of Euroscaptor in the North are located on clade D Specimens from Annamite belong to clades E and F Genetic distances among mole species were about - 29% E p ngoclinhensis should be the valid species E ngoclinhensis Populations in Cham Chu and Tay Con Linh are likely new taxa 22 Fig 3.18 BI/ML tree of cytb gene for Brown-toothed shrews in Vietnam The Brown-toothed shrews in Vietnam are divided into clades belonging to groups B quadraticauda and A squamipes are located on clade A (Group 1) Group include clades B, C and D: C himalayica, C varrnei, Ch hoffmanni, Ch parca, Ch caovansunga, E umbrinus, E baileyi, E macrurus The genetic distances: 12 - 23% Fig 3.19 BI/ML tree of cytb gene for White-toothed shrews in Vietnam The genetic distance between species in the genus Suncus ranges from 14 % to 21% While Suncus species show marked genetic variation, species in the genus Crocidura present a complexity and diversity of genetic relationship Genetic differences among Crocidura species from 3% to 17% 23 CONCLUSIONS AND RECOMMENDATIONS 4.1 Conclusions This study have recorded, described and performed the identification keys for 37 mammal species and subspecies belonging to 13 genera, families and suborders in the order Eulipotyphla distributed in Vietnam Out of that, there are 11 species and subspecies that have only been recorded in Vietnam According to IUCN, there are Endangered (EN) and Near Endangered (NT) species The distribution of Eulipotyphlan mammals were arranged into geographic ranges as Northwest (18 species, typical species), Northeast (18 species, typical species), North Annamite (13 species, typical species), Middle Annamite (9 species, typical species), South Annamite (10 species, typical species) and Southwest (5 species, typical species) C dracula is distributed to the east of the Mekong River, and C fulignosa is distributed to the west of the Mekong River Shrews, moles and gymnures in Vietnam are widely distributed in different habitats They appear mostly at altitudes of 600 - 1600m (25 species, typical species) followed by belts below 600m (20 species, typical species), 1600 - 2600m (18 species, typical species), respectively They appear least at altitudes above 2600m (5 species, typical species) The genetic distance of cytb gen among families or genera of Eulipotyphla in Vietnam showed the large range of 14 - 34% Genetic differences among species were about - 29% The smallest distance between species in same genus was 3% and the largest one was 23% The specimens collected in Sa Pa may be belong to new Gymnure genus 4.2 Recommendations - Conduct follow-up studies to clarify taxonomy, distribution, genetic relationships, biology and ecology of Eulipotyphla in Southeast Asia and South China - Focus on studying the Euroscaptor mole to clarify the species composition and taxonomic position - Assess the conservation status of endangered species and species in negatively impacted areas 24 NEW CONTRIBUTIONS OF THIS STUDY The present study, for the first time, provided an updated checklist of 37 Eulipotyphlan species/subspecies in Vietnam based on the combination of classical and modern methods This study also presented the description, morphology measurements and identification keys for insectivore mammals in Vietnam Our research divided the distribution of Eulipotyphla in Vietnam into geographic ranges Moreover, we also provided additional information and discussed on distribution, habitats and altitudinal gradients This study investigated phylogenetic relationship among populations, among species and among genera from specimens of 34/37 species/subspecies of Eulipotyphla in Vietnam Our results suggested that C dracula and C fuliginosa are allopatric species within Southern China and Southeast Asia The speciation of these two sister species may relate to geographical isolation by the Mekong River This research contributed initial information on one new gymnure genus and three new taxa of mole We also suggested that E p ngoclinhensis should be the valid species E ngoclinhensis Our research would be an important reference in the data books on the fauna of Vietnam PUBLICATIONS RELATED TO THIS THESIS Bui Tuan Hai, Masaharu Motokawa, Shin-ichiro Kawada, Alexei V Abramov, Nguyen Truong Son Skull variation in Asian moles of the genus Euroscaptor (Eulipotyphla: Talpidae) in Vietnam Mammal Study 45 (4), 2020 Bui Tuan Hai, Motokawa Masaharu, Ninh Thi Hoa and Le Xuan Canh A revision of the geographical distributions of the Southeast Asian shrews (Crocidura dracula & C fuliginosa) based on new collection in Vietnam Proceeding of the 4th National Scientific conference on Biological research and teaching in Vietnam: 3-10 2020 Bui Tuan Hai, Ly Ngoc Tu, Vu Thuy Duong, Le Duc Minh, Nguyen Thi Tham, Nguyen Truong Son Supplementary data of Insectivores (Mammalia, Eulipotyphla) in Vietnam Tap chi Sinh hoc, 41(2se1&2se2): 393– 407 2019 Nguyen Truong Son, Ly Ngoc Tu, Vu Thuy Duong, Bui Tuan Hai, Nguyen Thi Tham, Lam Hai Dang, Lam Quang Ngon Mammals (mammalia) recorded in the My Phuoc area (Soc Trang Province) and Tram Chim National Park (Dong Thap Province) Tap chi Sinh hoc, 41(2se1&2se2): 177–187 2019 Ly Ngoc Tu, Bui Tuan Hai, Masaharu Motokawa, Tatsuo Oshida, Hideki Endo, Alexei V Abramov, Sergei V Kruskop, Nguyen Van Minh, Vu Thuy Duong, Le Duc Minh, Nguyen Thi Tham, Ben Rawson, Nguyen Truong Son Small mammals of the Song Thanh and Saola Quang Nam Nature Reserves, central Vietnam Russian Journal of Theriology 18 (2): 54-70, 2019 Bui Tuan Hai, Ly Ngoc Tu, Vu Thuy Duong, Nguyen Truong Son Geographic variation in skull size and shape of Crocidura dracula (Mammalia: Soricidae) in Vietnam Hội nghị Khoa học toàn quốc Sinh thái Tài nguyên sinh vật lần thứ 7: 670 - 677 ... eulipotyphlan species Task 2: Discover species distribution - Discover species distribution by zoogeography - Discover species distribution by habitats - Discover species distribution by elevation... ranges, A g.: Altitudinal gradients In general, Eulipotyphlan mammals in Vietnam are widely distributed in different geographic distribution ranges, habitats and altitudinal gradients The results... research divided the distribution of Eulipotyphla in Vietnam into geographic ranges Moreover, we also provided additional information and discussed on distribution, habitats and altitudinal gradients