Tài liệu hạn chế xem trước, để xem đầy đủ mời bạn chọn Tải xuống
1
/ 26 trang
THÔNG TIN TÀI LIỆU
Thông tin cơ bản
Định dạng
Số trang
26
Dung lượng
874,2 KB
Nội dung
MINISTRY OF EDUCATION AND TRAINING MINISTRY OF AGRICULTURE AND RURAL DEVELOPMENT VIETNAM ACADEMY OF AGRICULTURAL SCIENCES - QUAN QUOC DANG RESEARCH OF THE RELATIONSHIP BETWEEN GENOTYPE AND PHENOTYPE IN PHU QUOC DOG CONSERVATION Major: Biotechnology Major code: 94 202 01 SUMMARY OF THE DOCTORAL THESIS IN AGRICULTURE HO CHI MINH CITY – 2021 Thesis was completed at: Ho Chi Minh City Supervisors: Dr Chung Anh Dung Assoc Prof Dr Tran Hoang Dung First Reviewer : Second Reviewer : Third Reviewer : The thesis will be defended in front of the Institute-level Thesis Judging Committee in Month Day 2021 The thesis can be found at: National Library Vietnam Academy of Agricultural Sciences Library INTRODUCTION Urgency of study The Phu Quoc Dog is a unique type of dog of Phu Quoc island, Vietnam The distinguishing feature of them to differ from other dogs is the dorsal ridges Phu Quoc dog is one of three dogs breeds with ridges in the world, although not all individuals in this spicies have dorsal ridges Phu Quoc dogs have many different colors coat: black, brown, yellow, brindle, gray and other colors But the most popular colors are black and yellow which have 60% Straight hair style have over 98% Another feature that is very typical for Phu Quoc dogs that noticed is the dorsal ridge, called ridgeback The ridgeback is very diverse and symmetrical in the dorsal, the most common forms can be swords, arrows, saddles, violins and others However, at present, there are only two breeds of ridgeback dog in the world, the African Rhodesian and the Thai Ridgeback recognized by the Fédération Cynologique Internationale (FCI), and Phu Quoc dog is mentioned belong with and considered to be descended from the Thai Ridgeback Nowadays, there is non-scientific for phenotype and genotype basis evidence as a proof for recognition this breed from two others In addition, most customers only base on the type of ridgeback to decide to choose a Phu Quoc dog breed, while not all Phu Quoc dogs have back ridges Therefore, the process of breeding to meet the needs of trading leads to the degeneration of this breed The research about the structural and morphological features of the Phu Quoc dog in order to develop a set of morphological standards which serve for identification this breed is very important and necessary, not only for buyers but also for the breeders and preservers on the Phu Quoc dog Aim of study Develop a set of criteria for identifying Phu Quoc dogs based on morphological dimensions, determine the relationship between genotype and specific dorsal ridgeback phenotype to serve for selection, breeding and conservation Phu Quoc dog Scientific and practical significance of study Provide data on the basic dimensions of Phu Quoc dogs, contributing to standardizing the selection of Phu Quoc dogs through morphological assessment (compared to current evaluation and selection by emotion) Provide scientific data to determine genotypes related to the characteristic ridgeback trait of Phu Quoc dogs, contributing to species conservation in the breeding process Object and scope of study Dogs were born in Phu Quoc island and dogs at Phu Quoc breeders in other regions but have clear origins, both parents from Phu Quoc island This study investigated some morphological parameters of 175 Phu Quoc dogs (96 males, 79 females) in Phu Quoc island and Ho Chi Minh City and surrounding areas, where Phu Quoc dog breeding farms are concentrated Among of them, 32 individuals had non-ridgeback and 143 individuals had ridgeback Analysis of the R gene region for the ridgeback in 15 Phu Quoc dogs with and without ridgeback (both parents have ridgeback) on Phu Quoc island, compared with 03 domestic dogs in Ho Chi Minh City New contributions of study - Phu Quoc dog morphological standard has been developed first time in Vietnam, helping to quickly and accurately identify this breed - The first published to determine the relationship between genotype and ridgeback phenotype in the Phu Quoc dog in the world Dissertation layout Thesis consists 112 pages (excluding the Appendix), including the following parts: Introduction (4 pages), Chapter 1: Literature Review and Scientific Evidence (39 pages), Chapter 2: Materials and Research Methods (13 pages), Chapter 3: Research Results and Discussion (46 pages), Conclusion and Recommendations (1 page), References (9 pages), used Vietnamese and 112 English Published Papers Thesis has 25 Tables, 49 Figures and Appendices, Published Papers Chaper - LITERATURE REVIEW AND SCIENTIFIC EVIDENCE The thesis has consulted and summarized Vietnamese and English published papers, with relevant contents including: Classification and characteristics of Vietnamese Phu Quoc dogs, Origin and morphology of Phu Quoc dogs, Ridgeback trait in Phu Quoc dogs, Genetic studies and ancient documents on Phu Quoc dogs, Necessity of research on morphology and genotype of ridgeback trait on Vietnamese Phu Quoc dogs 1.1 Classification and characteristics of Vietnamese Phu Quoc dogs 1.1.1 Classification In the biological classification system, Phu Quoc dogs have the following classification position: Gender: Animals (Animalia) Sub-Gender: Multicellular animals (Metazoa) Class: Chordata Subphylum: Vertebrates (Vertebrata) Class: Mammal (Mammalia) Order: Carnivores (Carnivora) Family: Dogs (Canidae) Sub-Family: Dogs (Caniae) Breed: Dog (Canis Linnaeus, 1758) Species: Dog (Canis lupus Linnaeus, 1758) 1.1.2 Characteristics The Phu Quoc Dog is a type of unique dog of Phu Quoc island in Vietnam The distinguishing feature of dog breed is a dorsal ridgeback on most of individuals in population This dog breed is one of the three dog breeds with has dorsal ridgeback in the world Phu Quoc dogs are precious with many outstanding characteristics that other dog breeds not have such as: intelligence, agility, ability to hunt and keep good house They are medium sized, easy to raise, suitable for rural areas and rivers The main characteristics of the Phu Quoc dog are different from other breeds: Small dog head suitable for long skull, small and standing ears, black muzzle, brown eyes The body is slim and the chest is enlarged, the belly is slim, especially for male dogs The dog's four legs are strong, the muscles are prominent, straightened when standing, and the feet are webbed Tail with short hair, often in a curved position with a curvature of ẵ to ẳ of a circle 1.2 Origin and morphology of Phu Quoc dogs Phu Quoc dog is one of dog breeds with ridgeback in the world The other two types of ridgeback dogs are the African Rhodesian Ridgeback and the Thai Ridgeback However, at present, there are only two breeds of ridgeback dog in the world, the African Rhodesian and the Thai Ridgeback recognized by the Fédération Cynologique Internationale (FCI), the Phu Quoc dog is mentioned belong with and considered to be descended from the Thai Ridgeback 1.3 Ridgeback trait in Phu Quoc dogs The ridgeback trait is a mutation affecting skin and hair follicle development during infancy in dogs, both of them originate in the ectodermal neural tube The ridgeback trait in South African Ridgeback and the Thai Ridgeback is caused by a mutation on chromosome 18 in which a 133,400 nucleotide of DNA has been duplicated The ridgeback trait consists of a set of genes called R (Ridge) with a normal phenotype r (non-ridgeback) The ridgeback trait is completely dominant 1.4 Genetic studies and ancient documents on Phu Quoc dogs 1.4.1 Current domestic dog genetic studies and Copy Number Variation quantification methods (CNV) Waldo et al proposed a method for homozygous or heterozygous genotyping of the African Ridgeback phenotype based on the quantification of CNVs of the R gene region by Ct quantification through real-time-PCR The results show that, it is possible to determine the ratio between the regions established on the 133kb area containing the gene group for the ridge trait in the African and Thai Ridgebacks 1.4.2 Phenotype ancient documents on Phu Quoc dogs With the ancient documents left by the French, the descriptions and learning about the Phu Quoc dog are quite similar The similarities show that the Phu Quoc dog is a wild hunting dog with many great personalities and closely resembles a wolf The most special was the dorsal ridgeback and was passed on to the next generations, a trait that was unlike any other dog breed they knew at that time In the old literature, the measurements were mainly based on very few individuals collected The measurements are therefore not representative of the general population of the former and current Vietnamese Phu Quoc dog populations In addition to some characteristics of temperament, habits, and hunting behavior, phenotypic characteristics are necessary for standardization to have a more complete view of domestic dogs 1.4.3 Recent studies on the morphology and genotype of Phu Quoc dogs in Vietnam Currently in Vietnam, Phu Quoc dogs are very interested In 2000, Dr Nguyen Huu Chiem, Msc Nguyen Van Bien together with staff from Faculty of Agriculture, Can Tho University and Department of Science and Technology of Kien Giang province carried out the project "Investigation, research and conservation of animal genes: Phu Quoc Dog, Kien Giang Province" However, the topic of the Can Tho University team is almost reused at the basic level of investigation, not really going into the assessment of genetic resources to have a specific conservation direction In 2009, Hoang Tuan Thanh and his colleagues from the Institute of Animal Husbandry studied the growth and reproduction ability of Phu Quoc dogs raised in Ho Chi Minh City Since 2012, Tran Hoang Dung and his colleagues, Department of Genomics & Bioinformatics, Nguyen Tat Thanh University have conducted the project "Research on mitochondrial genome sequencing of Phu Quoc dogs to evaluate genetic diversity of Phu Quoc dog breeds in Ho Chi Minh City” produced many outstanding results Research results show that Phu Quoc dogs appear haplotype E, which is a very rare form in the world In 2016, Thai Ke Quan and his colleagues studied the area analysis when using the D-loop area to analyze the genetic characteristics of Phu Quoc dogs living on Phu Quoc Island, This breed dog detected carrying halotype E1 with a very high frequency of more than 15% in the world 1.5 Necessity of research on morphology and genotype of ridgeback trait on Vietnamese Phu Quoc dogs Currently, the problem of recognizing the Phu Quoc dog breed is very difficult because the Phu Quoc Ridgeback and the Thai Ridgeback have similar appearance, live in two relatively close geographical areas and at the same time the Thai Kennel Association successfully registered Thai Ridgeback standard with Fédération Cynologique Internationale (FCI) in 2003 The phenotypic criteria of Phu Quoc dogs are mainly based on ancient documents from E Oustalet and Henri de Bylandt based on only a few individuals brought from Vietnam to France and those criteria are not representative of the Phu Quoc dog population in Vietnam During the development of the Phu Quoc dog herd, the period 2007 witnessed a decrease in mortality caused by epidermoid cysts closely related to the trait of ridgeback, which is an outbreak of the disease Due to the inbreeding process to create individuals according to the needs of buyers, then at the same time, homozygous genotypes will appear to increase the spread and disease expression, which will degrade the Phu Quoc dog population Currently, in Vietnam, there aren’t methods to evaluate and test genotypes of ridgeback trait in Phu Quoc dogs with the aim of determining homozygous and heterozygous genotypes in crossbred parent dogs in order to reduce the incidence of ridgeback Spread rate of dorsal ridgeback phenotype with homozygous dominant genotype in the population Also evaluate the role of the alleles R and r in the development of the captive Phu Quoc dog population Chapter - MATERIALS AND RESEARCH METHODS 2.1 Materials This study surveyed 175 Phu Quoc dogs, including 96 males, 79 females originating in Phu Quoc island district and in Ho Chi Minh City and surrounding areas, where Phu Quoc farms and breeding centers are located Of which 32 individuals without ridgeback and 143 individuals with ridgeback, 32 individuals with ridgeback were collected at breeding facilities in Phu Quoc and 143 individuals with and without ridgeback were obtained at natural and seminatural breeding establishments originating in Ho Chi Minh City and surrounding areas The surveyed individuals must be at least 18 months old, sexually mature and have relatively stable body sizes and have both parents are Phu Quoc dogs Blood samples were collected from a total of 18 dogs, including 03 control dogs originating in Ho Chi Minh City and 15 individuals of Phu Quoc dogs (with and without ridgeback were collected from Phu Quoc and Ho Chi Minh City) 2.2 Research Section Section 1: Research and evaluate the specific body characteristics of Phu Quoc dogs Section 2: Research and establish morphological indexes to select Phu Quoc dogs based on morphological characteristics Section 3: Study on the relationship between genotype and ridgeback phenotype in Phu Quoc dogs Section 4: Study on improving conservation models (insitu-in vivo and exsitu-in vivo) of Phu Quoc dogs based on a set of morphological criteria 10 Spanish dog Evaluate the correlation between body height at withers and body length, chest circumference and waist circumference Set the morphological indexes according to the formulas: Body Index = body length x 100/ chest circumference (BI = BL x 100/ChC) Proportionality Index = body height at withers x 100/ body length (PI = BHW x 100/BL) Section 3: Study on the relationship between genotype and ridgeback phenotype in Phu Quoc dogs The method of determining the homozygous or heterozygous genotype of the African Ridgeback phenotype by real-time PCR proposed by Waldo et al., when performed on Thai and African Ridgebacks Relative Number Copy calculated according to Livak's formula modified by Pfaffl: RCN = 2∆Ct(C/Tg-T/Tg)/2∆Ct(C/Ref-T/Ref) Table 0.1 Primer pairs were used to quantify Ct by RT-PCR Forward Reverse Set TGCCGCTCAGATGATCAAC TCTGCTTTTCTCTGCTCCC3 Set ATTGGCAGTGTCCGTGTGAG AAGCCCCGCAGACAATGAAC Set GCATCCACCTAAGCAATCTG CCCTATTCTCTTCCACCCATC Set GCTTCTGCTTTGATACCCTTC GTTCTGCAACAGCATCTCC β-actin CATGGATGCCGCAGGATT GTTCCGCTGCCCAGAGG Section 4: Study on improving conservation models (insitu-in vivo and exsitu-in vivo) of Phu Quoc dogs based on a set of morphological characteristic Developing a set of information conventions on Phu Quoc dogs, consulting on semi-conservative farming models Phu Quoc dogs were recruited into the farm based on the phenotypic criteria advised to the owners Establish a guide on how to identify homozygous and heterozygous genotypes of back vortex trait through population genetic relationships, keeping individuals with appropriate genetic resources to preserve Phu Quoc dogs 11 Chapter - RESEARCH RESULTS AND DISCUSSION 3.1 Research and evaluate the specific body characteristics of Phu Quoc dogs From the survey results on basic body measurements of Phu Quoc dogs, it is possible to determine the characteristic parameters of these morphological characteristics as follows: body weight: 19,5-19,6kg; body length: 50,2-50,6cm; body height at withers: 45,3-45,9cm; muzzle length: 10,2-10,3cm; chest circumference: 55,3-55,9cm; waist circumference: 45,1-45,6cm; ear length: 9,8cm; tail length: 28,1-28,9cm; cranial length: 20,3-20,4cm; cranial wide 20,3cm Table 0.1 Basic characteristics observed in Phu Quoc dogs (n=175, 𝑋̅ ± σ) No Body characteristics Sex Male Female Body weight (BW, kg) 19,6 ± 2,3 19,5 ± 2,2 Body length (BL, cm) 50,6 ± 6,4 50,2 ± 6,5 Body height to shouder (BHW, cm) 45,9 ± 6,3 45,3 ± 6,2 Muzzle length (ML, cm) 10,3 ± 0,6 10,2 ± 0,5 Chest circumference (ChC, cm) 55,9 ± 8,0 5,3 ± 7,9 Waist circumference (WC, cm) 45,6 ± 6,9 45,1 ± 6,8 Ear lenght (EL, cm) 9,8 ± 0,8 9,8 ± 0,8 Tail length (TL, cm) 28,9 ± 3,0 28,1 ± 2,3 Cranial length (CrL, cm) 20,4 ± 1,2 20,3 ± 1,0 10 Cranial wide (CrW, cm) 20,3 ± 1,2 20,3 ± 1,0 Phu Quoc dog features: - Coat color: black or yellow coat color, brindle color ratio is quite small; The ridgeback shape is mostly sword or violin; - Eyes: black and brown - Ears: pointed and erect 12 - Tongue: has black spots occupying about 40% of the tongue area - Legs: have 1-2 claws on both front and hind legs and have swimming membranes - Tail: curved up 2/4 to 3/4 circle The size measurements have partially quantified the external morphology of the surveyed Phu Quoc dogs and are representative of the population However, each individual may have a different overall size, so to standardize the size based on an index may not be accurate, but must be based on the average ratio between the basic measurements (body length , body height at withers, , cranial length/wide ) will more accurately reflect the characteristic physical structure of that species 3.2 Research and establish morphological criteria to select Phu Quoc dogs based on characteristic morphological characteristics (Morphological Indexes) In the world, dog breed identification has long been applied in clinical veterinary medicine, including in administrative procedures for breed certification and the information required from owners about dog breeds, in treatment programs or health assessment, certification of disease in domestic dogs The process of identifying the Phu Quoc dog breed in Vietnam is currently quite vague and unclear, leading to the appearance of mixed breeds from many different sources The most difficult part in the identification process is that it is not possible to identify the parents of the hybrid, then the process of determining the breed is mainly based on the basic phenotypic manifestations Evolutionary genetic studies have shown a very small association between the known genotype and the associated behavioral phenotype Thus, the identification of dog breeds provides information that helps owners think about different directions of breeding from the original breed 13 3.2.1 Determine and normalize the ratio of cranial to muzzle length Observational size and initial statistics in this study show that Phu Quoc dogs belong to the average head group with almost equal length and width of the cranial with a ratio nearly 1:1; while the ratio of muzzle length to cranial length is close to 1:2 The individuals in Phu Quoc dog population observed has vary size, but the ratio between body sizes is always stable Therefore, determining the size ratios obtained from section is an important to build and standardize the specific size ratios for the representative sample of observed Phu Quoc dogs Table 0.2 Summary of proportions and shapes normalizing of basic characteristics Characteristics Size, Color and Shape ̅ ± σ , CI 95%, unit: cm) (X Muzzle length (ML, cm) 10,3±0,6 Cranial length (CrL, cm) 20,4±1,1 Cranial wide (CrW, cm) 20,3± 1, Cranial length / Cranial wide 1:1 Muzzle length / Cranial length 1:2 Correlation function of muzzle length / ML=0,5CrL + 0,6, R2=0,875729 cranial length with R coefficient Ear length and shape 9-11cm, ears are straight forward 3.2.2 Determine and standardize the proportions of the body, chest, waist; body height to shouder/body length ratio The body height at withers (BHW)/body length (BL) ratio and chest circumference (ChC)/ waist circumference (WC) are common indicators used in the calculation and construction of specific sizes for domestic dog 14 Table 0.3 Ratio of body height at withers/body length and chest circumference/waist circumference of Phu Quoc dog samples (n=175, 𝑋̅ ± σ, CI 95%) Characteristics Size Function Body length (BL) 50,6 ± 6,4 BL = 0,9xBHW + 8,4 R2=0,80 Body length at withers (BHW) 45,9 ± 6,3 Chest circumference (ChC) 55,9±8,0 ChC = 1,1xWC + 5,5 R2=0,88 Waist circumference (WC) 45,5±6,9 3.2.3 Determination of morphological indexes in Phu Quoc dogs a) Body Index (BI) The analysis results show that the average body index of Phu Quoc dogs is 92,44±1,72 in male and 92,06±1,91 in female; The results of statistical analysis comparing the t-test with different variances showed that there was no difference in body index between male and female Phu Quoc dogs b) Proportionality Index (PI) The analysis results show that the average body ratio coefficient is 90,86±0,57 in male and 90,59±0,61 in female; The results of statistical analysis comparing t-tests with different variances showed that there was no difference in body coefficient between male and female Phu Quoc dogs Bảng 0.4 Summary Body Index and Proportionality Index of Phu Quoc dogs (n=175) Medium Standard error t - estimate t - compare P value -0,15015 1,9743 0,88 -0,33021 1,9741 0,74 Body Index Male 92,44 1,72 Female 92,06 1,91 Proportionality Index Male 90,86 0,57 Female 90,59 0,61 15 3.3 Study on the relationship between genotype and ridgeback phenotype in Phu Quoc dogs 3.3.1 Evaluating the primers effectiveness of set to set and β-actin gene Well 1: ladder (100bp) Well - 16: primer from set to set and β-actin for three domestic dogs (1, 2, 3) Well 17: empty (a) Checking primer sequence of CD1, CD2, CD3 Well 1: ladder (100bp) Well - 16: primer from set to set and β-actin for three Phu Quoc dogs (4, 11, 12) Well 17: empty (b) Checking primer sequence of PQ4, PQ11, PQ12 Well 1: ladder (100bp) Well - 16: primer from set to set and β-actin for three Phu Quoc dogs (5, 6, 13) Well 17: empty (c) Checking primer sequence PQ5, PQ6, PQ13 16 Well 1: ladder (100bp) Well - 16: primer from set to set and β-actin for three Phu Quoc dogs (7, 8, 9) Well 17: empty (d) Checking primer sequence PQ7, PQ8, PQ9 Well 1: ladder (100bp) Well - 16: primer from set to set and β-actin for three Phu Quoc dogs (10, 17, 18) Well 17: empty (e) Checking primer sequence PQ10, PQ17, PQ18 Well 1: ladder (100bp) Well - 16: primer from set to set and β-actin for three Phu Quoc dogs (14, 15, 16) Well 17: empty (f) Checking primer sequence PQ14, PQ15, PQ16 Figure 0.1 Checking primer sequence the samples All 18 dogs including domestic and Phu Quoc dogs are numbered from to for domestic dogs (symbol: control dog - CD), to 18 for Phu Quoc dogs (symbol: Phu Quoc dog - PQ ) Because ridgeback ridge trait is an autosomal dominant mutation, it is not possible to distinguish the sex of the individual dogs 17 that are used as a model for evaluation Each electrophoresis tank consists of samples with a scale and an empty well final Each individual runs on pairs of primers: including sets of primers from to into the wells in order, the last pair is the primer of β-actin 3.3.2 Evaluation of the frequency of R and r genes in the observed sample using Pfaffl's improved Livak method Total 18 DNA samples were extracted from the collected dog blood samples In which, there are domestic control dogs, 13 Phu Quoc dogs with and Phu Quoc dogs without ridgeback (Male=M, Female=F, with ridgeback: w/r, without ridgeback; wt/r) Table 0.3 Threshold and phenotype for genotype estimation (n=15) Phenotype Genotype Frequency No Code RCN PQ4 1.422299 F, w/r Rr RR 5/15 33% PQ5 1.331038 F, w/r Rr Rr 7/15 47% PQ6 1.242135 M, w/r Rr rr 2/15 13% PQ7 0.880758 M, wt/r rr NA 1/15 7% PQ8 (âm tính) M, w/r NA Difference PQ9 2.370577 M, w/r RR RR Rr rr PQ10 2.440037 M, w/r RR 33% 47% 13% PQ11 2.058692 M, w/r RR 25% 50% 25% PQ12 2.012307 F, w/r RR +7% -3% -12% 10 PQ13 1.626127 M, w/r Rr 11 PQ14 1.240628 M, w/r Rr 12 PQ15 1.349758 M, w/r Rr 13 PQ16 1.792784 F, w/r RR 14 PQ17 1.503264 M, w/r Rr 15 PQ18 0.892569 M, wt/r rr 18 According to the experimental and observational results from the process of Waldo et al on the African Ridgeback and combining phenotypes, it is possible to initially determine the frequency of the ridgeback gene in Phu Quoc dogs RCN 2,5 1,5 0,5 R/R R/r r/r Kiểu gen RCN 2,5 1,5 0,5 R/R R/r Kiểu gen r/r Hình 0.2 The relative copy number (RCN) of the observed individuals (top) and the mean of them (bottom) of homozygous dominant (RR), heterozygous (Rr), homozygous recessive (rr) genotype of R gene in Phu Quoc dogs (n=15) The ridgeback mutation of the African and Thai ridgeback is located in the 133kb region on chromosome 18, based on the method of Waldo et al., 19 identified in the Phu Quoc dog also has similar segments of the two breed dogs studied before According to previous studies on the condition of the African Ridgeback, it has been confirmed that the Phu Quoc dog has a similar genotype for this trait This study opens a new direction in conservation and breeding of Phu Quoc dogs in order to limit the spread of DS by determining the homozygous or heterozygous genetic resources of the parents' ridgeback trait It is necessary to combine phenotype and mitochondrial and phenotypic genomic studies to identify specific biomarkers of this rare breed 3.4 Study on improving conservation models (insitu-in vivo and exsitu-in vivo) of Phu Quoc dogs based on a set of morphological characteristic The results of research and standardization of phenotypic sizes and body proportions and genotypes of the ridgeback trait show that the important role of selection of leading dogs plays an important role and determines the development of the herd during rearing, breeding and conservation The selection process should follow morphological characteristic and ratios, along with homozygous or heterozygous allele testing on ridgeback trait 3.4.1 Building distribution map on Phu Quoc island Table 0.4 Number of Phu Quoc dogs in breeding camps No Group Locate 1-20 Cửa Dương 15 1-20 Gành Dầu 20-30 >30 Total Dogs Male Female Captive 17 Captive 11 Dương Đông 22 Captive 10 12 Dương Tơ 32 Semi-wild 18 14 41 45 86 Feeding methods In the semi-wild environment, dogs are allowed to roam freely in an area that includes their respective species of flora and fauna, they tend to use the 20 plants as a remedy for intestinal and digestive ailments, this is a natural behavior that needs to be preserved because it is not found in captive dogs 3.4.2 Design and arrange farms according to the natural behavior and optimal living conditions for Phu Quoc dogs on Phu Quoc Island Phu Quoc dogs are genealogy determined to avoid inbreeding before took into the mating area to pair up and conceive During this process, the father and mother dogs need to be tested for genetics simultaneously for diseases The principle in mating is to limit the homozygous dominant traits and try to maintain a stable population with heterozygous individuals With the research results showing that the construction of crossbred scenarios is reasonable control their genetics while also reassessing the effects of environment and nutrition on culture Figure 0.3 Phu Quoc dog sanctuary The results of the crosses obey the laws of inheritance of dominant traits that are completely sex-unrelated There are 09 combinations, which 05 combinations give 100% phenotype with ridgeback trait; 01 combination gives a phenotypic ratio with/without ridgeback trait of 3:1; 02 combinations give a 21 phenotypic ratio with/without ridgeback trait of 1:1; 01 combination gives 100% phenotypic ratio without ridgeback trait Table 0.5 Crossbred Model on Phu Quoc dogs Ridgeback trait Father gene RR R100% RR Mother gene R r Rr Rr 50% RR 100% Rr (100% with 50% Rr (100% with ridgeback) ridgeback) (100% with ridgeback) R50% RR 25% RR 50% Rr 50% Rr 50% Rr 50% rr (100% with 25% rr (50% with ridgeback ridgeback) (75% with ridgeback 50% without ridgeback) 25% without ridgeback) r100% Rr r 50% Rr 100% rr (100% with 50% rr (100% without ridgeback) ridgeback) (50% with ridgeback 50% without ridgeback) Normally, according to crossbred models, individuals with dominant traits will be crossed with homozygous recessive individuals for genotyping, but this method has the disadvantages of taking a long time and ethically Animal bioethics does not allow With the results from the analysis by real-time PCR method, the breeder can collect and send analysis samples of the individuals after crossing with the ridgeback trait phenotype to determine the homozygous dominant or heterozygous genotype as well as possible Previous studies have shown that it is necessary to limit the homozygous dominant phenotype in the herd because of its association with fatal DS and many health related diseases for individual Breeders need to breed and retain heterozygous individuals with ridgeback phenotype while minimizing the spread and spread of DS, as well as other physical diseases 22 3.4.3 Implant and attach electronic chip Staff prepare anesthetics in syringes, cotton swabs and rubbing alcohol and other tools Anesthesia must be prepared, the anesthetic dose is 3cc (Ketamine) Check electronic chip: Each chip has a unique code This check ensures that the chips are readable and in good working order Two days before chip implantation took, it is necessary to inform the owner not to feed their dog one day before the chip is inserted to avoid the case of weak dogs in shock, vomiting, food in their stomachs, and obstructing the respiratory tract Do not let the dog drink water and take bath for one day before and after inserting the chip to avoid reacting with the drug To avoid confusion and cross-check the chip readings before and after implantation simultaneously to check that the chip has been implanted in the animal, it is imperative to hold the reader and double-check the readings on the electronic board After chip implanting, it is necessary to immediately monitor the health of the Phu Quoc ridgeback dogs Strong ones can slowly return to normal after half an hour Dogs that show signs of difficulty breathing need veterinarian intervention and immediate treatment 23 CONCLUSION AND RECOMMENDATIONS Conlusions Based on the the thesis research results were obtained, the following conclusions can be reached: Important typical Phu Quoc dogs phenotypic characteristics have been identified: body weight 19.5-19.6kg; body length 50.2-50.6cm; body height to withers 45.3-45.9cm; muzle length 10.2-10.3cm; chest circumference 55.355.9cm; waist circumference 45.1-45.6cm; ear length 9.8cm; tail length 28.128.9cm The first time developed a set of morphological standards to make out Phu Quoc dogs which to serve selection and conservation, based on the following measurements: Cranial index is 1:1 (length: width of cranial) and 1:2 (muzle length:cranial length); Body index (body length/chest circumference) is 92.06-92.44 and Proportionality Index (body height to withers/body length) is 90.59-90.86 Affirming the relationship between the genotypes related to the characteristic ridgeback phenotype of Phu Quoc dogs is similar to the recognized other dogs in the world, the Thai Ridgeback and the African Ridgeback This phenotype is caused by a completely dominant gene located on chromosome 18, denoted R (ridge), where R is the phenotype with ridgeback and r is the phenotype without ridgeback The study proposed a method of using morphological criteria combined with genotyping of ridgeback trait to select Phu Quoc dogs before being introduced into conservation and breeding camps Recommendations Continuing to conduct related studies between R genotype and nutrition provided during rearing and breeding; as well as evaluate the impact of different environmental conditions on the development and reproduction of Phu Quoc dogs 24 LIST OF SCIENTIFIC PAPERS PUBLISHED National Quan Quốc Đăng, Trần Hồng Dũng, Chung Anh Dũng, Phạm Cơng Hoạt (2017) Xác định tần suất kiểu gen đồng hợp dị hợp kiểu hình xốy lưng chó xốy Phú Quốc (Canis familiaris) Việt Nam kỹ thuật real-time PCR Tạp chí Khoa học Cơng nghệ Việt Nam, Số B, ISSN: 1859 – 4794, Số 22(11), trang: 32-37 International Quoc-Dang Quan, Anh-Dung Chung, Hoang-Dung Tran (2016) Initially observed some important morphological characteristics on Phu Quoc Ridgeback dogs (Canis familiaris) in Vietnam International Journal of Science and Research (IJSR), ISSN (Online): 2319-7064, Volume Issue 7, 719 – 725 DOI: 10.21275/ART2016291 Quoc-Dang Quan, Hoang-Dung Tran and Anh-Dung Chung (2017) The relation of body score (body height/body length) and haplotype E on Phu Quoc Ridgeback dogs (Canis familiaris) Journal of Entomology and Zoology Studies , E-ISSN: 2320-7078, P-ISSN: 2349-6800, Vol 5(1), 388-394 Quan, Q.D., Nguyen, T.C., Tran, B.H., Chung, A.D and Tran, H.D.(2019) Based zoometric description of adult Phu Quoc Ridgeback dog (Canis familiaris) International Journal of Agricultural Technology 2019 Vol 15(5):753-768 Available online http://www.ijat-aatsea.com ISSN 2630-0192 (Online) Scopus Indexed ... to quantify Ct by RT-PCR Forward Reverse Set TGCCGCTCAGATGATCAAC TCTGCTTTTCTCTGCTCCC3 Set ATTGGCAGTGTCCGTGTGAG AAGCCCCGCAGACAATGAAC Set GCATCCACCTAAGCAATCTG CCCTATTCTCTTCCACCCATC Set GCTTCTGCTTTGATACCCTTC... PAPERS PUBLISHED National Quan Quốc Đăng, Trần Hoàng Dũng, Chung Anh Dũng, Phạm Công Hoạt (2017) Xác định tần suất kiểu gen đồng hợp dị hợp kiểu hình xốy lưng chó xốy Phú Quốc (Canis familiaris)... initially determine the frequency of the ridgeback gene in Phu Quoc dogs RCN 2,5 1,5 0,5 R/R R/r r/r Kiểu gen RCN 2,5 1,5 0,5 R/R R/r Kiểu gen r/r Hình 0.2 The relative copy number (RCN) of the observed