Nhân dòng và biểu hiện gen mã hóa protein ompl1 của chủng leptospira spp trong escherichia coli

BỘ GIÁO DỤC VÀ ĐÀO TẠO VIỆN HÀN LÂM KHOA HỌC VÀ CÔNG NGHỆ VIỆT NAM HỌC VIỆN KHOA HỌC VÀ CÔNG NGHỆ - Nguyễn Văn Huy NHÂN DỊNG VÀ BIỂU HIỆN GEN MÃ HĨA PROTEIN OmpL1 CỦA CHỦNG Leptospira spp TRONG Escherichia coli LUẬN VĂN THẠC SĨ: SINH HỌC THỰC NGHIỆM Hà Nội - 2021 BỘ GIÁO DỤC VÀ ĐÀO TẠO VIỆN HÀN LÂM KHOA HỌC VÀ CÔNG NGHỆ VIỆT NAM HỌC VIỆN KHOA HỌC VÀ CÔNG NGHỆ - Nguyễn Văn Huy NHÂN DỊNG VÀ BIỂU HIỆN GEN MÃ HĨA PROTEIN OmpL1 CỦA CHỦNG Leptospira spp TRONG Escherichia coli Chuyên ngành: Sinh học thực nghiệm Mã số: 8420114 LUẬN VĂN THẠC SĨ SINH HỌC THỰC NGHIỆM NGƯỜI HƯỚNG DẪN KHOA HỌC: GS.TS Nghiêm Ngọc Minh Hà Nội - 2021 i Lời cam đoan Tơi xin cam đoan cơng trình nghiên cứu tơi nhóm nghiên cứu, số liệu, kết nghiên cứu luận văn trung thực chưa có cơng bố cơng trình khác Hà nội, ngày tháng năm 2021 Tác giả Nguyễn Văn Huy ii Lời cảm ơn Để hồn thành luận văn này, tơi xin bày tỏ lịng biết ơn sâu sắc tới GS.TS.Nghiêm Ngọc Minh, Viện Nghiên cứu hệ gen, Viện Hàn lâm Khoa học Công nghệ Việt Nam định hướng nghiên cứu, tận tình hướng dẫn, sửa luận văn tạo điều kiện hóa chất, thiết bị, kinh phí để giúp tơi thực hồn thành luận văn Tơi xin gửi lời cảm ơn chân thành tới tập thể Phòng Hệ gen học vi sinh, Viện Viện Nghiên cứu Hệ gen đặc biệt PGS.TS Võ Thị Bích Thủy bảo, giúp đỡ tận tình cho tơi trình thực nghiệm chia kinh nghiệm chuyên môn Tôi xin gửi lời cảm ơn tới thầy cô giáo thuộc khoa Sinh học, thầy cô giáo Học viện Khoa học Công nghệ với Lãnh đạo Viện Nghiên cứu hệ gen bảo tạo điều kiện giúp đỡ tơi học tập hồn thành đề tài nghiên cứu Cuối cùng, xin dành lời cảm ơn đặc biệt tới gia đình, người thân bạn bè giúp đỡ, tạo điều kiện, động viên suốt thời gian học tập nghiên cứu Tôi xin chân thành cảm ơn! Hà nội, ngày tháng năm 2021 Học viên Nguyễn Văn Huy iii Danh mục ký hiệu chữ viết tắt L L L L L G L Icter L iv Danh mục bảng Bảng 1.1: Một số hệ biểu phổ biến 19 Bảng 2.1: Thành phần phản ứng PCR 25 Bảng 2.2: Chu trình nhiệt phản ứng PCR .25 Bảng 2.3: Trình tự mồi khuếch đại toàn gen OmpL1 25 Bảng 2.4: Thành phần phản ứng gắn gen vào vector nhân dòng 28 Bảng 2.5: Thành phần phản ứng cắt vector 30 Bảng 2.6: Thành phẩn phản ứng nối gen vào vetor 31 Bảng 2.7: Thành phần gel Acrylamide 32 Bảng 2.8: Định lượng protein phương pháp Bradford 33 Bảng 3.1: Trình tự mồi khuếch đại đoạn gen OmpL1 45 Bảng 3.2:Kết đo độ hấp phụ BSA bước sóng 595nm 57 v Danh mục hình vẽ, đồ thị Hình 1.1: Xoắn khuẩn Leptospira interrogans Hình 1.2: Con đường lây truyền bệnh Leptospirosis Hình 1.3: Sơ đồ vector pET32a .22 Hình 3.1: DNA tổng số tách chiết chủng Leptospira 37 Hình 3.2: Kết gióng hàng trình tự chuẩn chủng Leptospira interrogans .41 Hình 3.3: Kết gióng hàng trình tự chuẩn chủng Leptospira interrogans (tiếp) 42 Hình 3.4: Kết dự đoán vùng định kháng nguyên gen OmpL1 năm chủng Leptospira 43 Hình 3.5: Kết gióng hàng trình tự amino acid năm chủng Leptospira 44 Hình 3.6: Điện di đồ sản phẩm PCR đoạn gen OmpL1 45 Hình 3.7: Điện di đồ sản phẩm cắt vector pJET1.2/OmpL1 46 Hình 3.8: Điện di đồ sản phẩm plasmid 47 Hình 3.9: Điện di đồ sản phẩm cắt mở vòng vector pET32a 48 Hình 3.10: Khuẩn lạc E.coli biến nạp vector pET32a/OmpL1 môi trường LB .49 Hình 3.11: Điện di đồ sản phẩm PCR với cặp mồi T7 49 Hình 3.12: Điện di đồ sản phẩm biểu protein OmpL1 E coli BL21 50 Hình 3.13: Điện di đị sản phẩm biểu protein OmpL1 E coli BL21 điều kiện nhiệt độ nuôi cấy cảm ứng khác 52 Hình 3.14: Điện di đồ sản phẩm biểu protein OmpL1 E coli BL21 điều kiện nồng độ cảm ứng IPTG khác 54 vi Hình 3.15: Điện di đồ sản phẩm biểu protein OmpL1 E coli BL21 điều kiện thời gian cảm ứng IPTG khác .55 Hình 3.16: Điện di đồ sản phẩm sau tinh protein OmpL1 56 Hình 3.17: Đồ thị biểu diễn đường hồi quy tuyến tính 57 Hình 3.18: Chuột nhắt trắng sử dụng thử nghiệm 59 Hình 3.19: Phản ứng Western Blot kháng nguyên tái tổ hợp OmpL1 với kháng thể thu từ huyết chuột sử dụng kháng thể thứ cấp HRP Goat Anti-Mouse IgG 60 vii MỤC LỤC Lời cam đoan i Lời cảm ơn ii Danh mục ký hiệu chữ viết tắt iii Danh mục hình vẽ, đồ thị v MỞ ĐẦU CHƯƠNG TỔNG QUAN TÀI LIỆU .3 1.1 GIỚI THIỆU XOẮN KHUẨN LEPTOSPIRA VÀ BỆNH LEPTPSPIROSIS 1.1.1 Xoắn khuẩn Leptospira .3 1.1.2 Thực trạng dịch tễ bệnh Leptospirosis 1.1.2.1 Trên giới 1.1.2.2 Tại Việt Nam 1.2 NGHIÊN CỨU CHẾ TẠO PTOTEIN TÁI TỔ HỢP PHÒNG CHỐNG BỆNH LEPTOSPIROSIS 1.2.1 Đặc điểm gen xoắn khuẩn Leptospira .9 1.2.2 Một số nghiên cứu protein OmpL1 tái tổ hợp 11 1.2.3 Cơ chế tạo kháng thể thể xoắn khuẩn Leptospira 14 1.3 TỔNG QUAN VỀ HỆ THỐNG BIỂU HIỆN GEN 18 1.3.1 Hệ biểu Escherichia coli 18 1.3.1.1 Các hệ biểu 18 1.3.1.1 Hệ biểu Escherichia coli 19 1.3.2 Chủng biểu E coli BL21 (DE3) 20 1.3.3 Vector biểu pET32a 21 64 28 Mariya, R., et al , 2006, Evaluation of a recombinant LipL41 antigen of Leptospira interrogans serovar canicola in ELISA for serodiagnosis of bovine leptospirosis, Comp Immunol Microbiol Infect Dis, 29(5-6), p 269-77 29 Zapata, S., et al , 2010, Characterization of a lipopolysaccharide mutant of Leptospira derived by growth in the presence of an anti-lipopolysaccharide monoclonal antibody, FEMS Microbiol Lett, 309(2), p 144-50 30 Zhang, Y.X., et al , 2005, Identification and classification of all potential hemolysin encoding gens and their products from Leptospira interrogans serogroup Icterohae-morrhagiae serovar Lai, Acta Pharmacol Sin, 26(4), p 453-61 31 Cullen, P.A., et al , 2003, LipL21 is a novel surface-exposed lipoprotein of pathogenic Leptospira species, Infect Immun, 71(5), p 2414-21 32 Palaniappan, R.U., et al , 2002, Cloning and molecular characterization of an immunogenic LigA protein of Leptospira interrogans, Infection and immunity, 70(11), p 5924-5930 33 Palaniappan, R.U., et al , 2006, Immunoprotection of recombinant leptospiral immunoglobulin-like protein A against Leptospira interrogans serovar Pomona infection, Infection and immunity, 74(3), p 1745-1750 34 Faisal, S.M., et al , 2008, Evaluation of protective immunity of Leptospira immunoglobulin like protein A (LigA) DNA vaccine against challenge in hamsters, Vaccine, 26(2), p 277-287 35 Houdebine, L -M., 2009, Production of pharmaceutical proteins by transgenic animals, Comparative immunology, microbiology and infectious diseases, 32(2), p 107-121 36 Egelkrout, E., V Rajan, and J.A Howard, 2012, Overproduction of recombinant proteins in plants, Plant science, 184, p 83-101 37 Untergasser, A., et al , 2012, Primer3￢￢￢ new capabilities and interfaces, Nucleic Acids Research, 40(15), p e115-e115 38 Sanger, F., S Nicklen, and A.R Coulson, 1977, DNA sequencing with chain-terminating inhibitors, Proceedings of the national academy of sciences, 74(12), p 5463-5467 65 39 Ju, J., et al , 1995, Design and synthesis of fluorescence energy transfer dye-labeled primers and their application for DNA sequencing and analysis, Analytical biochemistry, 231(1), p 131-140 40 Michelsen, B.K., 1995, Transformation of Escherichia coli increases 260-fold upon inactivation of T4 DNA ligase, Analytical biochemistry, 225(1), p 172-174 41 Singh, M., et al , 2010, Plasmid DNA transformation in Escherichia Coli: effect of heat shock temperature, duration, and cold incubation of CaCl2 treated cells, International Journal of Biotechnology and Biochemistry, 6(4), p 561-568 42 El Rabey, H., et al , 2017, Isolation, cloning and sequencing of poly 3-hydroxybutyrate synthesis gens from local strain of Bacillus cereus mm7 and expressing them in E coli, J Investig Genomics, 4(1), p 00056 43 Laemmli, U., 1970, SDS-page Laemmli method, Nature, 227, p 680-5 44 Seixas, F.K., et al , 2007, Evaluation of different ways of presenting LipL32 to the immune system with the aim of developing a recombinant vaccine against leptospirosis, Canadian journal of microbiology, 53(4), p 472-479 45 Mahmood, T and P.-C Yang, 2012, Western blot: technique, theory, and trouble shooting, North American journal of medical sciences, 4(9), p 429 46 Dezhbord, M., et al , 2014, Molecular identification of the ompL1 gen within Leptospira interrogans standard serovars, 8(06), p 688-693 66 CÁC CÔNG BỐ LIÊN QUAN ĐẾN LUẬN VĂN International Journal of Zoology and AnimalISSN: Biology2639-216X MEDWIN PUBLISHERS Committed to Create Value for Researchers Expression and Purification of the Recombinant OmpL1 Protein for Potential Vaccine Production against Leptospirosis Nguyen Tuan Hung2,3, Nguyen Van Huy1,3, Nguyen Duc Hieu1, Dang Thi Quynh1,3, Vo Thi Bich Thuy1,3* and Nghiem Ngoc Minh1,3 Institute of Genome Research, Vietnam Academy of Science and Technology, Vietnam VETVACO National Veterinary Joint Stock Company, Vietnam Graduate University of Science and Technology, Vietnam Academy of Science and Technology, Vietnam *Corresponding author: Vo Thi Bich Thuy, Institute of Genome Research, Vietnam Academy of Abstract Leptospirosis is a popular zoonosis caused by pathogenic strains of the p re se nt in mos t pa thoge nic gen era ting s tra ins a nd cons ide r a n i mporta nt fa c to r in the i mmunoge nici ty re s ponse We de scribe here a simple procedure for cloned on Sepharose column with His-tag attached to this protein The recombinant protein OmpL1 induced immunological memory in Escherichia coli laboratory rats, suggesting a potential recombinant vaccine production for using in against Leptospirosis in animals Keywords: rLipL21; Recombinant Protein Vaccine; Leptospira interrogans; Vietnam Abbreviati ns: OMPs: rOmpL1: Recombinant OmpL1 Protein; LB: Luria-Bertani medium; ECM: Extracellular Matrix; WHO: World Health Organization; IPTG: Isopropyl β- d-1-thiogalactopyranoside Introduction from animals to human by the and is one of the most popular zoonoses in the world [1] According the World Health Organization (WHO) and other data sources, each year between and 10 million people suffers from Leptospirosis, with an estimated rate of 0.11/ 100,000 in temperate climates and 10-100 / 100,000 in tropical climates such as South Asia and South East Asia [2,3] Leptospirosis spreads membranes or by direct or indirect contact with mucous membranes, urine, or infected organisms In human, the disease has clinical manifestations such as latent bacterial infection, systemic toxicity syndrome, liver, kidney damage Expression and Purification of the Recombinant OmpL1 Protein for Potential Vaccine Production against Leptospirosis Int J Zoo Animal Biol International Journal of Zoology and Animal Biology amino acids was first reported in 1993 [10] It was shown to appear in 15 standard strains and 163 new pathogenic isolates of several i mmuni ty s ti mula to ry a bili tie s i n the a ni ma l mode l a re due to the OmpL1’s ability to bind to extracellular matrix (ECM) and other serum components based on laminin binding and plasma fibronectin [11] Previous researches showed that recombinant OmpL1 protein (rOmpL1) could create protective immunity in animals [8,10], these indicate the high potential of rOmpL1 in vaccine production In this work, we describe the cloning and expression of a novel multi-epitope fusion protein, containing sequences of diverse previously studied OMPs of amplifying the entire spp Co mpone nts of the re a ction PCR include 10X PCR buffer (2.5µL), 2.5mM dNTP (2.5µL), 10 pmol/µL forward or reverse primer (0.5µL), 5U/µL Taq DNA polymerase (0.15µL), 200pmol/µL template (1µL), and sterile distilled water 17.85µL PCR reaction was performed with 25 cycles: denatured at 95 C for 30s, annealed at 55 C for 30s, and e xte nde d a t 72 C for mi n purification and quality control were sequenced on ABI 3500 sequencing machine The obtained and immune model of Materials and Methods Materials Total DNA of five strains of i nc lude s Bataviae), Canicola), ( Icet roha e morrha g ia e L a re c urre ntly use d to produce the ina ctiva te d Leptospira interro gans vaccines in Vietnam, was extraction using GeneJET Genomic DNA Purification Kit (Thermo Scientific, USA) The pJET1.2 / blunt vector (Thermo Fisher Scientific, USA) with size 2,974bp contains ampicillin resistance gene ( ), capable of inserting a gene segment with size from 6bp to 10 kb The pJET1.2/ bl unt ve c to r wa s use d to c re a et Amp pJET1.2OmpL1 Primer Design and PCR The the Ge ne Ba nk/ NCBI Ba se d on the i nfo r ma tion of gene with accession numbers AY622662, using Primer3 software to design a primers pair for the D NA sa mple s we re use d as a te mpla te for PCR re a ctio n, were compared analyzed by BioEdit, BLAST and MEGA 6.06 OmpL1 software and selected suitable gene segment for cloning Expression of rO into pJET1.2 vector The OmpL1 gene f T4 DNA ligase enzyme in VDNA:Vvector ratio is 2:1 Components Cloning OmpL1 of 20µL reaction include: 10x Buffer: 2µL, 50% PEG: 2µL, T4 OmpL1 gene was ligase: 1µL, pET32a vector: 5µL and DNA fragment: 10µL with specifically designed primers The PCR product was The reaction mixture was incubated overnight at C in order cloned to pJET1.2 vector using CloneJET PCR Cloning Kit (Thermo Fisher) to for m pET32a - BL21 The transformed s tra in by he a t s hoc k me thod Re s ul ts of the tra ns fo r ma tion LB medium containing 50µgE.coliampicillin and grown until OmpL1 the optical density (OD) reached 0.6 – 0.8 at 260nm At this into time, 100µl IPTG (1mM) was added into medium and c he c k e d by PCR us ing E.coli incubation continued until hours later at 37 C, shaking 200rpm The cells were collected by centrifugation° and re- same time, the colonies modeling positive PCR reactions suspended by intermittently sonicating in 30 minutes in ice were grown in liquid LB medium supplemented with 50µg/mL of Ampicillin overnight at 37 C, shaking 200rpm The soluble and insoluble fractions were isolated by centrifugation at 9000rpm for 10min Purificat ion of t he rO mpL1 Protein The recombinant OmpL1 protein contains His tag to facilitate purification His tag is found only in the recombinant protein but not in the protein, makes a Pla s mid DNA e xtra c tion che cke d fo r the pre se nce of the XhoI specific ability to adhere to the chromatographicE.coli column a ccord ing to the ma nufa c ture r’s ins tr uc tio ns (T he rmo OmpL1 Fisher, USA) contained Ni2+ Recombinant OmpL1 that have specific interactions with Ni2+ will be mounted on the column, and the non-clinging or nonspecific substances are expelled 3500 se que nci ng ma chine us i ng pJET1.2 Fo rwa rd prime r Purification process uses gel, column and AKATA prime Plus The obtained nucleotide sequence was compared with the automatic chromatography system (GE Healthcare) Vo Thi Bich Thuy, et al Expression and Purification of the Recombinant OmpL1 Protein for Potential Vaccine Production against Leptospirosis Int J Zoo Animal Biol 2020, 3(6): 000252 Copyright© Vo Thi Bich Thuy, et al International Journal of Zoology and Animal Biology The soluble fraction recovered from the centrifugation step described above was applied to a column containing Nisepharose gel Equilibrating the gel column with times the volume of 0.02M phosphate buffer (5mM Imidazol included) and get ready for the next purification step Protein extracts were added to the column at a rate of 0.6mL/min Unbound proteins were cursed with supplemented 0.02M phosphate buffer with the addition of 60mM Imidazol The protein fraction attached to the column was eluted with 0.02M phosphate buffer supplemented with 500mM Imidazol Fractions were analyzed by 12.5% SDSPAGE to detect the presence of rOmpL1 and determine by Bradford method at OD 595nm Pooled proteins were dialyzed three times in phosphate buffer saline and considered to be the final production with 5% skim milk-TBST for hour (or overnight at C) Next, incubated membrane with primary antibody (mice’s° serum in previous step) mixed in blocking solution for 1.5 hours at room temperature then washed times by TBST in minutes The membrane was continued to incubate with second antibodies in 5% nonfat dried milk-TBST solution (ratio 1:1000) for hours, following the repetition of the TBS-T wash as described above The second antibody is goat anti-mouse IgG peroxidase conjugate (Sigma, USA) Results Prediction and Selection of Vaccine Epitopes and Primer Design Based on sequencing result, five Product ion of Ant iserum against rOmpL1 Five to eight-week-old mice were immunized with 10µg purified rOmpL1 and 100µg aluminum (Al(OH) ) The experiments were performed once a week in three 3weeks and mice’s blood was collected in week fourth Serum was collected in supernatant by centrifugation of blood on 6000rpm at 4°C OmpL1 Grippotyphosa with similarity about 99%, second once included strains of a ls o a chie ve d si mi la rity te s up to 98% Us ing I-TAS S ER Western blot for the Evaluation of Antibody Response Total protein from were fractionated by 12.5% SDS-PAGE and was included strains of L Bataviae, L Canicola, and L electroLepto-transferredpia to a PVDF membrane Transferring membrane was performed at 60mA/gel, C, for hours, potential 100V Then, the membrane was blocked° and TM-score tool to integrate finding common ground between two 3D structures of OmpL1 proteins [14] (Figure 1), amino acid sequence from 102 to 316 residues (Table & Figure 2) was selected And PCR was used to amplify the gene fragment coding for OmpL1 102-316 DNA prime r (5’- -3’) siet s TTAGAGCTCGAGTTTATAACCGAATCTGTAGA -3’) containing a XhoI No 19 Start End 40 106 132 148 166 207 226 251 10 265 11 285 12 314 : LipL21 Predicted epitopes Table Vo Thi Bich Thuy, et al Expression and Purification of the Recombinant OmpL1 Protein for Potential Vaccine Production against Leptospirosis Int J Zoo Animal Biol 2020, 3(6): 000252 Copyright© Vo Thi Bich Thuy, et al International Journal of Zoology and Animal Biology Grippotyphosa, L Icterohaemorrhagiae and L Pomo a) In the assay, only one band at 38 kDa position was shown, thus antibody that collected from serum mice could recognize antigen from all of five (The red is similar sequence) 3D construction was combined from five Figure 1: serovars Leptospira Figure 3: SDS-PAGE analysis of the expression of rOmpL1 protein Lane (1) (2) non induced BL21 cells; Lane (3) – (7) pellet and supernatant fractions of lysates from induced BL21 ce lls of five coli Figure 2: Potential B cell epitopes for OmpL1 gene Expression and Purification of Recombinant OmpL1 The to make pET32aBL21 PCRs confirmed the accuracy of recombinant plasmids extracted from five colonies after culture Furthermore, PCR Figure 4: Characterization of the expressed of OmpL1 protein using Western Blot analysis M: Marker, Lane (1 - 5): Antigen-antibody reactions between five se rova rs (a s a ntige n, i ncl udi ng product sequences were completely similar to previous calculation (data not shown) The rOmpL1 was expressed from IPTG induction The recombinant proteins after purification showed a single band in the gel in SDS‐PAGE assay (Figure 3), indicating that the purified proteins could become antigens for subsequent experiments After injected with purified rOmpL1, the white mice were in good-health conditions until day twenty first A respective ly) and antiserum (as antibody of Gri po yphos , L Icterohaemorrhagiae Discussion The focus of our research is producing a recombinant protein from the gene of pathogenic serovars in order toOmpL1make vaccine against these Leptospirastrainsin animals We have been trying to develop an Western blot assay was done with the total protein of five pathogenic optimal process to create the protein as our goal Although combining two or more recombinant proteins in one vaccine has been shown to be effective [12], we found that it was still necessary to Vo Thi Bich Thuy, et al Expression and Purification of the Recombinant OmpL1 Protein for Potential Vaccine Production against Leptospirosis Int J Zoo Animal Biol 2020, 3(6): 000252 Copyright© Vo Thi Bich Thuy, et al International Journal of Zoology and Animal Biology References Adler B, de la Peña Moctezuma A (2010) evaluate the protective ability of OmpL1 independently for a more comprehensive view about serovars in Vietnam In this study, we have selected a potential sequence from Leptospira and leptospirosis Veterinary microbiology 140(3-4): 287-296 CurrHaakeTopD, MicrobiolLevettPNImmunol(2015) 387:Leptospirosis65-97 in humans tha t the re we re 77 diffe re nce s i n se que nce be twe e n two OmpL1 Verma AK, Kumar A, Dhama K, Deb R, Rahal A, et al 10% T he re fo re , we a na ly ze d the a mi no a cid se que nce s Leptospira of both groups carefully by using the 3D construction tool I-TASSER combined with TM-Score tool The results found that the similarity from amino acid 102 residues to amino acid 316 residues We have cloned for rOmp L1 i nto pJET1.2 ve cto r a nd tra ns fo r me d i nto DH10b Normally, the DNA fragments are easily degraded so should be kept in the plasmids because they are more stable Furthermore, the generation of multiple plasmid copies through culturing is a n e ffe ctive wa y of ge ne mul tip lica tion to a void the ris k of undesirable mutations in PCR We have also expressed rOmpL1 in c hoos i ng the se sys et ms a re protein expressed will be high similar to increase immunological efficiency The rOmpL1 was purified by affinity tags since they help collecting large amounts of highly target proteins [14] In present, there are some widely affinity tag such as maltosebinding protein, elastin-like polypeptide tag, glutathione-Stransferase, but we used his-tags because of population Moreover, his-tag does not affect to protein activities The fact that purified rOmpL1 made immunized mice to produce antibody against OmpL1 protein of ne e d to mo re i n v ivo e xpe ri me nts to de et rmine a bil ity of the protein and removing his-tag is necessary for higher amount Overall, we believe that a description of a process for expression of rOmpL1may be useful for producing a work recombinant vaccine against Acknowledgement This research was funded by the VETVACO Join Stock Company, Vietnam interestConflict of Interest: All authors have no conflict of (2012) Leptospirosis-persistence of a dilemma: an overview with particular emphasis on trends and recent advances in vaccines and vaccination strategies Pakistan journal of biological sciences: PJBS 15(20): 954-963 Lindsay KW, Bone I, Fuller G (2010) Neurology and neurosurgery illustrated e-book In: 5th (Edn.), Elsevier Health Sciences, pp: 612 Mariya R, Chaudhary P, Kumar A, Thangapandian E, Amutha R, et al (2006) Evaluation of a recombinant LipL41 antigen of Leptospira interrogans serovar Canicola in ELISA for serodiagnosis of bovine leptospirosis Comparative immunology, microbiology and infectious diseases 29(5-6): 269-277 Bulach DM, Kalambaheti T, de la Peña-Moctezuma A, Adler B (2000) Functional Analysis of Genes in the rfbLocus of Leptospira borgpetersenii Serovar Hardjo Subtype Hardjobovis Infection and immunity 68(7): 3793-3798 Jorge S, Kremer FS, Oliveira NRd, Navarro GdOSV, Guimarães AM, et al (2018) Whole-genome sequencing of Leptospira interrogans from southern Brazil: genetic features of a highly virulent strain Memórias Instituto Oswaldo Cruz 113(2): 80-86 Dong H, Hu Y, Xue F, Sun D, Ojcius DM, et al (2008) Characterization of the ompL1 gene of pathogenic Leptospira species in China and cross-immunogenicity of the OmpL1 protein BMC microbiology 8(1): 223 Flannery B, Costa D, Carvalho FP, Guerreiro H, Matsunaga J, et al (2001) Evaluation of recombinant Leptospira antigen-based enzyme-linked immunosorbent assays for the serodiagnosis of leptospirosis Journal of clinical microbiology 39(9): 3303-3310 10 Haake DA, Champion CI, Martinich C, Shang ES, Blanco DR, et al (1993) Molecular cloning and sequence analysis of the gene encoding OmpL1, a transmembrane outer membrane protein of pathogenic Leptospira spp J Bacteriol 175(13): 4225-4234 11 Barnett JK, Barnett D, Bolin CA, Summers TA, Wagar EA, et al (1999) Expression and distribution of leptospiral outer membrane components during renal infection of hamsters Infect Immun 67(2): 853-861 12 Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, et al (2012) Primer3—new capabilities and interfaces Nucleic acids research 40(15): e115-e115 13 De Jonghe K, Morio S, Maes M (2013) First outbreak of Chrysanthemum stem necrosis virus (CSNV) on potted Vo Thi Bich Thuy, et al Expression and Purification of the Recombinant OmpL1 Protein for Potential Vaccine Production against Leptospirosis Int J Zoo Animal Biol 2020, 3(6): 000252 Copyright© Vo Thi Bich Thuy, et al International Journal of Zoology and Animal Biology Chrysanthemum in Belgium New Disease Reports Current strategies for the use of affinity tags and tag 28(14): 2044-0588 14 Arnau J, Lauritzen C, Petersen GE, Pedersen J (2006) removal for the purification of recombinant proteins Protein expression and purification 48(1): 1-13 Vo Thi Bich Thuy, et al Expression and Purification of the Recombinant OmpL1 Protein for Potential Vaccine Production against Leptospirosis Int J Zoo Animal Biol 2020, 3(6): 000252 Copyright© Vo Thi Bich Thuy, et al ... KHOA HỌC VÀ CÔNG NGHỆ VIỆT NAM HỌC VIỆN KHOA HỌC VÀ CÔNG NGHỆ - Nguyễn Văn Huy NHÂN DÒNG VÀ BIỂU HIỆN GEN MÃ HÓA PROTEIN OmpL1 CỦA CHỦNG Leptospira spp TRONG Escherichia coli Chuyên... OmpL1 năm chủng Leptospira interrogans 37 3.1.3 Nhân dòng đoạn gen OmpL1 vào vector pJET1.2 45 3.2 BIỂU HIỆN PROTEIN TÁI TỔ HỢP OmpL1 47 3.2.1 Chuyển gen OmpL1 vào vector biểu pET32a... 2.2.9 Gắn gen vào vector biểu pET32a Gen mã hóa protein OmpL1 gắn vào vector pET32a enzyme T4 ligase tạo plasmid pET32a /OmpL1 Vector có chứa vùng kích thích biểu protein giúp việc việc biểu đạt