Bài tập tổng hợp - C9

Suarez P, Zardoya R, Prieto C, et al.: 1994, Direct detection of the porcine reproductive and respiratory syndrome (PRRS) virus by reverse polymerase chain reaction (RT-PCR). Van Woensel[r]

(1)

Detection of porcine reproductive and respiratory syndrome

virus by reverse transcription–polymerase chain reaction using

different regions of the viral genome

Helena Guarino, Sagar M Goyal, Michael P Murtaugh, Robert B Morrison, Vivek Kapur

Abstract.

Serologic studies have revealed strain variability between American and European isolates and

among American isolates of porcine reproductive and respiratory syndrome virus (PRRSV) The objective of

this study was to develop an assay for the routine diagnosis of PRRSV in field specimens using reverse

transcription–polymerase chain reaction (RT-PCR) amplification of conserved genomic regions Twenty-four

field isolates of PRRSV from different regions of the USA were analyzed in the study Six primer pairs from

open reading frames (ORFs) 4, 6, and of the American strain (ATCC VR-2332) and from ORF 1b of the

Lelystad strain were used for the amplification of the viral genome by PCR Amplification products of the

expected sizes were obtained from all isolates by PCR amplification of ORF 7, the gene encoding the

nucleo-capsid protein Oligonucleotide primers designed to amplify ORFs and detected 92% and 96% of the isolates,

respectively, whereas primers for the amplification of ORF 1b detected 88% of all isolates The specificity of

the amplified products of ORF from field isolates and reference strains was confirmed by chemiluminescent

hybridization using an internal digoxigenin-labeled DNA probe Sequence analysis of this region indicated

variation in the nucleotide sequence of isolates that did not hybridize with the internal probe These results

indicate that ORF may serve as a potential target for the detection of PRRSV strains by RT-PCR and that

genomic variability should be considered when nucleic acid hybridization is used to confirm the specificity of

PCR amplification for diagnostic purposes.

Porcine reproductive and respiratory syndrome

(PRRS) was first reported in 1987 in the USA

and

has subsequently been recognized throughout Europe

and Southeast Asia, including Japan.

The disease

is caused by PRRS virus (PRRSV), which is a small,

enveloped RNA virus belonging to the arterivirus

group, which also includes equine arteritis virus,

lac-tate dehydrogenase elevating virus, and simian

hem-orrhagic fever virus.

The complete nucleotide

se-quence of the European strain of PRRSV (Lelystad

virus) and partial sequences of the American strain

(ATCC VR-2332) have been determined.

The genome of PRRSV consists of open reading

frames (ORFs), of which are expressed by the

for-mation of subgenomic RNAs.

ORFs 1a and 1b

en-code the viral RNA polymerase, and the remaining 6

ORFs encode small polypeptides consisting of 128–

265 amino acids each.

ORFs 2–6 encode structural

proteins, and ORF appears to encode a nucleocapsid

protein.

Serologic studies have revealed strain variability

among PRRSV isolates, mostly between the American

and the European strains but also among American

From the Departments of Veterinary Diagnostic Medicine (Guar-ino, Goyal), Veterinary Pathobiology (Murtaugh, Kapur), and Clin-ical and Population Sciences (Morrison), College of Veterinary Med-icine, University of Minnesota, St Paul, MN 55108

Received for publication May 8, 1997

isolates.

The antigenic variation between

American isolate VR-2332 and the Lelystad virus was

correlated with significant sequence differences,

and

it has been suggested that American and European

strains may represent distinct genotypes of PRRSV.

Polymerase chain reaction (PCR), a sensitive and

specific assay for the diagnosis of many infectious

dis-eases, has recently been described for the detection of

PRRSV in clinical samples, including boar semen.

One of the critical parameters in the PCR technique is

the selection of the primer pairs, because nucleotide

mismatch could lead to false negative results.

In the

present study, we analyzed 24 different field isolates

of PRRSV by single and nested PCR using primer

pairs from different regions of the virus genome The

object was to identify universal primers to amplify the

genome of all or most PRRSV isolates The specificity

of PCR products from ORF was determined by

hy-bridization with a nonradiolabeled oligonucleotide

probe.

Materials and methods

Virus isolates Twenty-four isolates of PRRSV were

ob-tained from 10 different states in the USA (Table 1) These

viruses were isolated from either lungs or sera of clinically

affected pigs in primary porcine alveolar macrophages or in

CL 2621 cells by previously described methods.

The

(2)

Table 1. Source of PRRSV isolates

Location Isolate number*

Illinois Indiana Iowa Kansas Kentucky

IL-4, IL-6 IN-4

IA-1, IA-2, IA-3, IA-15, IA-16 KS-1, KS-2

KY-2

Minnesota MN-1, MN-3, MN-4, SG-1,

SG-3, SG-4, SG-5, HL, WL Missouri

Nebraska Ohio South Dakota

MO-2 NE-1 OH-1 SD-1

* In addition to the above, ATCC VR-2332 and the Lelystad virus were used as reference strains of PRRSV

Table 2. Oligonucleotide primer sets

Primer set Primer sequence (59to 39)

Primer location (bp)

Predicted PCR product (bp) Single PCR (sense/antisense)

P41/42 GACGGCGGCAATTGGTTTC

GCAATCGCGAGCAACAGCC

1,227–1,245 1,842–1,824

615

P71/72 GCTGTTAAACAGGGAGTGG

CGCCCTAATTGAATAGGTGAC

2,867–2,885 3,375–3,355

508

P61/431 GTTTCAGCGGAACAATGGG

GCTGATTGACTGGCTGGCC

2,371–2,389 2,964–2,946

593

PR1b-P1 GACCCCGTCACCAGTGTGTC

GTCCGTTCTGAAACCCAGCA

8,748–8,767 9,005–8,986

257 Nested PCR

8214/8215 TCGTGTTGGGTGGCAGAAAAGC

GCCATTCACCACACATTCTTCC

2,763–2,785 3,247–3,225

484

8216/8217 CCAGATGCTGGGTAAGATCATA

CAGTGTAACTTATCCTCCCTGA

2,885–2,907 3,121–3,099

236

P61/72 GTTTCAGCGGAACAATGGG

CCCTAATTGAATAGGTGAC

2,371–2,389 3,375–3,355

1,004

P71/431 GCTGTTAAACAGGGAGTGG

GCTGATTGACTGGCTGGCC

2,867–2,885 2,964–2,946

97

modified serum neutralization test

was used to titrate these

isolates; the titers ranged from 10

to 10

TCID

/ ml.

Reference strains The American (ATCC VR-2332) and

the European (Lelystad) strains of PRRSV at passages 10

and 7, respectively, were used as reference virus strains.

RNA isolation RNA was extracted from virus isolates

using a commercial silica-based membrane kit.

The samples

(140

m

l) were mixed with lysis buffer containing carrier

RNA to facilitate the extraction of RNA from the samples.

After incubation for 10 at room temperature, the

sam-ples were precipitated with ethanol, added to a spin column,

and centrifuged at 6,000

3

g for The column was

then washed twice to eliminate contaminants, and RNA was

eluted in 50

m

l of DEPC-treated water and kept at

2

70 C

until use Mock-infected cell culture fluid was used as a

neg-ative control.

Effect of virus suspension in serum To determine if PCR

could detect PRRSV present in porcine sera, of 24 field

isolates and the reference strains were diluted 1:5 in a

porcine serum known to be negative for PRRSV and its

an-tibody Viral RNA from these virus-containing serum

sam-ples was extracted and amplified by PCR.

Synthesis of cDNA Reverse transcription (RT) of RNA

was carried out in a 20-

m

l reaction volume containing

ex-tracted RNA and 2.5

m

M of random hexamers.

The RNA

was denatured at 65 C for and then cooled on ice.

Master mix consisting of 1

3

PCR buffer, mM MgCl

2.5

U/

m

l of murine leukemia virus reverse transcriptase,

1 U/

m

l

of RNAse inhibitor, and mM each of dATP, dCTP, dTTP,

and dGTP was added at 16

m

l/sample The tubes were kept

at room temperature for 10 to allow extension of the

primers and then incubated in a thermal cycler (GeneAmp

PCR system 9600)

at 42 C for 15 min, 99 C for min, and

5 C for and then stored at C.

PCR primers and probe The nucleotide sequences of

ORFs 4, 6, and of the American strain VR-2332 and ORF

1b of the Lelystad strain were used to select primers for

single PCR These oligonucleotides were designed to

am-plify several regions of the PRRSV genome (Table 2) In

addition to single PCR, two different nested PCR reactions

were also evaluated The design of the primer pairs used for

nested PCR-1 (outer 8214/8215 and inner 8216/8217) and

the internal probe (5

9

-TGTCAGACATCACTTTACCC-3

9

,

nucleotides 3002–3022) was based on ORF of strain

VR-2332.

Nested PCR-2 was performed using P61/P72 as

out-er primout-ers and 431P/P71 as innout-er primout-ers The primout-er

se-quences, their location in the genome, and the expected

frag-ment size of PCR products for each primer set are shown in

Table 2.

PCR reactions For single PCR reactions and for the first

stage of the nested PCR, cDNA was added to a mixture of

2 mM MgCl

1

3

PCR buffer, 0.4

m

M of each primer, and

0.5 U of Amplitaq DNA polymerase

in a total volume of

(3)

Figure 1. Agarose gel electrophoresis of PRRSV reference strain ATCC VR-2332 using primers from different ORFs Lane 1: P41/P42 (615 bp); lane 2: P71/P72 (508 bp); lane 3: P61/P431 (593 bp); lane 4: LV-1b (257 bp); lane 5: P14/P15 (484 bp); lane 6: P16/ P17 (236 bp); lane 7: P61/P72 (1,004 bp); lane 8: P431/P71 (97 bp); lane 9: negative control (PCR mix); MM: molecular weight marker fX174 RF DNA HaeIII.

55 C for 30 sec, and 72 C for 45 sec, ending with a final

extension period of 10 at 72 C The PCR products were

held at C until use The second stage of nested PCR was

performed under the same reaction conditions by amplifying

3

m

l of the outer PCR product with inner primer pairs The

temperature and time for annealing, denaturing, and

exten-sion were the same Mock-infected cell culture fluids and

porcine serum known to be negative for PRRSV and its

an-tibody were included in all experiments as negative controls.

For nested PCR, a nontarget control consisting of 22

m

l of

reaction mix and 3

m

l of water was also included To avoid

cross-contamination among samples, mainly with nested

PCR, precautions were taken using separate rooms for

re-agent preparation, manipulation, and detection of PCR

prod-ucts and using separate supplies and pipettes, lab coats, and

gloves in each room.

Detection of PCR products PCR products were detected

by gel electrophoresis in 1.5% agarose

in TAE buffer (0.04

M Tris-acetate, pH 8.5, with 0.002 M

ethylenediaminetet-raacetic acid), stained with ethidium bromide, and visualized

by photography with ultraviolet (UV) light.

f

X174 RF

DNA/HaeIII

was used as a molecular weight marker The

specificity of PCR products was confirmed by observing the

expected size of the products on ethidium-bromide-stained

gels In addition, specificity of PCR products from field

isolates and reference isolates, amplified by P71/72, was

also confirmed by Southern blotting.

cDNA probe labeling and Southern blot hybridization.

The internal oligonucleotide probe was labeled with

digox-igenin-11-dUTP using a commercial oligolabeling kit.

The

rapid alkaline method was used to transfer PCR products

from denatured gels (0.4 N NaOH, M NaCl for 15 min)

to nylon membranes.

After hr, the membranes were

neu-tralized and washed (0.5 M Tris, pH 7.2, M NaCl) in 3

washes each for with agitation, rinsed in water, and

fixed on a UV transilluminator for Prehybridization

was performed for hr at 42 C in 20 ml of prehybridization

solution (5

3

standard saline citrate [SSC], 1% w/v blocking

reagent,

0.1% N lauryl sarcosine, 0.02% sodium dodecyl

sulfate [SDS]) The membranes were hybridized for hr at

42 C in fresh prehybridization solution containing

digoxi-genin-labeled probe in a final concentration of pmol/ml.

After washing twice for in 2

3

SSC, 0.1% SDS and

twice for 15 in 0.5

3

SSC, 0.1% SDC, 0.1% SDS, at

room temperature, hybridization was detected as follows.

Blocking was performed with 2% blocking reagent in 100

mM Tris-HCl, 150 mM NaCl, pH 7.5, for 30 min, and the

membranes were incubated with anti-digoxigenin Fab

frag-ments conjugated with alkaline phosphatase

diluted in fresh

blocking buffer for 30 The membranes were then

washed twice in 100 mM Tris-HCl, 150 mM NaCl, for 15

min and once in 100 mM Tris-HCI, 100 mM NaCI, 50 mM

MgCI

, for After an overnight incubation in the dark

with 700

m

l of Lumi-Phos,

the membranes were exposed to

X-ray film for various periods of time (15–30 min).

Results

The expected size bands were observed in each PCR

product from each primer pair in

ethidium-bromide-stained agarose gels Amplification of VR-2332 with

all the primer pairs used is shown in Fig One of

the reference strains (ATCC VR-2332) could be

de-tected with all primers tested, but the Lelystad virus

was amplified only with primers from ORF 1b

(LV-1b) and with pair of primers from ORF (P71/72).

However, the Lelystad virus could not be amplified

with another primer set (P8214/8215) from ORF

(Ta-ble 3) This result is in agreement with results of

pre-vious studies

that used the same sequences but under

different reaction conditions.

All 24 field isolates and the reference strains could

be detected by RT-PCR when primers from ORF 7

(P71/72) were used for amplification With primer sets

from ORFs and (P41/42 and P61/431), 22 (92%)

and 23 (96%) of the field isolates, respectively, were

amplified The LV-1b primer was the least sensitive,

detecting 21 of 24 isolates (88%) Nested PCR

de-tected all of the isolates No amplification was

ob-served with negative controls or RNA extracted from

pseudorabies virus, transmissible gastroenteritis virus,

and bovine viral diarrhea virus.

To determine if the presence of serum might

inter-fere with PCR, field isolates and reinter-ference strains

were diluted 1:5 in porcine serum and tested by PCR.

Some of the primers (41/42, 61/431, LV-1b) failed to

detect some of the isolates (IL-4, MN-1, MO-2,

SD-1) in diluted serum (Table 4) However, these diluted

isolates (with the exception of the Lelystad virus) were

detected by the nested RT-PCR procedures used

(Ta-ble 4).

(4)

Table 3. Sensitivity of different primer pairs for the detection of PRRSV isolates

Isolate

PCR

41/42 71/72 61/431 LV-1b

Nested PCR-1 8214/8215 8216/8217 Nested PCR-2 61/72 71/431 IL-4 IL-6 IN-4 IA-1 IA-2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 IA-3 IA-15 IA-16 KS-1 KS-2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 KY-2 MN-1 MN-3 MN-4 SG-1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 SG-3 SG-4 SG-5 HL WL 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 MO-2 NE-1 OH-1 1 1 1 1 2 1 1 1 1 1 1 SD-1 VR-2332 Lelystad 1 1 1 2 1 1 1 1 1

Table 4. Effect of swine serum on the sensitivity of PCR for PRRSV detection The isolates were added to porcine serum known to be negative for PRRSV and its antibody Viral RNA from serum samples was extracted and amplified by PCR procedures

Isolate

PCR

41/42 71/72 61/431 LV-1b

Nested PCR-1 8214/8215 8216/8217 Nested PCR-2 61/72 71/431 IL-4 IA-1 KS-1 MN-1 MO-2 1 2 1 1 1 1 1 2 1 1 1 1 1 1 OH-1 SD-1 VR-2332 Lelystad 2 1 1 2 1 1 1 1 1

Southern blot hybridization Two of the isolates

(SD-1, IL-4) did not hybridize, although sharp and bright

bands were observed in ethidium-bromide-stained gels

(Fig 2) The membranes were then stripped in 0.2 N

NaOH and 0.1% SDS and reprobed at lower

hybrid-ization temperatures of 37 C and 30 C There was no

appreciable difference in the sensitivity of the

hybrid-ization probe at these temperatures when compared

with hybridization at 42 C (data not shown).

To investigate further, amplified products from

SD-1, IL-4, and MN-3 were sequenced, and the sequence

was aligned to that of VR-2332 The 20-nucleotide

sequence corresponding to the sequence of the internal

probe was also compared Complete identity was

ob-served between MN-3 and VR-2332 sequences, but

nucleotide variability was observed in SD-1 and IL-4.

The sequence of isolate SD-1 exhibited 15% (3/20)

variability, and isolate IL-4 showed 10% (2/20)

nucle-otide divergence when compared with the same region

on VR-2332.

Discussion

(5)

sev-Figure 2. Comparison of PCR detection from PRRSV isolates by agarose gel electrophoresis (A) and Southern blot hybridization using a digoxigenin-labelled oligonucleotide probe (B) Lanes 1–8: isolates IN-4, WL, MN-3, IL-4, IA-1, SD-1, OH-1, and ATCC VR-2332, respectively; lane MM: molecular weight markerfX174 RF DNA/HaeIII; lane ML: molecular weight marker XI labeled with digoxigenin.

eral regions of the viral genome The results of this

study showed that RT-PCR can detect PRRSV RNA

from field isolates but that the sensitivity of detection

depends upon the region of the genome used for

prim-er design Diffprim-erences in detection are probably due to

strain variability; antigenic variability of these isolates

has been reported.

The ORF is a robust target for diagnostic RT-PCR

amplification; primers from this region allowed the

de-tection of the corresponding fragment in all isolates

tested The Lelystad virus could also be detected by 1

pair of primers from ORF (P71/72) but not with

another from the same region (P14/P15) This

infor-mation is useful in the design of studies whose

objec-tive may either be to detect a broad range of PRRSV

isolates or to determine strain differentiation.

The decreased sensitivity of some primers to some

of the isolates diluted in serum may be related to losses

in the RNA extraction procedure or degradation of

RNA by contaminating ribonuclease present in the

se-rum rather than to lower sensitivity of the primers

be-cause the same primers could detect other isolates with

lower viral titers These experiments were repeated at

least times, so the results not appear to be

arti-facts Elsewhere, 2.5–4-fold losses from serum during

extraction procedures have been reported.

The specificity of amplification was confirmed by

including other common swine RNA viruses as

neg-ative controls and by specific Southern blot

hybridiza-tion No hybridization signals were observed in other

RNA virus samples or in negative controls (data not

shown) Confirmation of positive bands by

nonra-dioactive chemiluminescent hybridization was easy

and sensitive The convenience, simplicity, and

spec-ificity of chemiluminescent detection have been

re-ported previously.

The variability found in the

se-quence of isolates explains the lack of hybridization

with the internal probe Oligonucleotide probes are

short, and individual nucleotide changes of the target

genomic sequence can influence the sensitivity of

tection Genomic variability of PRRSV isolates

de-tected by RT-PCR has previously been reported.

(6)

oligonucle-otide probe hybridization to confirm the identity of

PRRSV isolates for diagnostic purposes.

Acknowledgements

We thank Tom Molitor and Jane Christopher-Hennings for

information on primer and probe sequences, Margaret Elam

and Elida Bautista for oligonucleotide synthesis and helpful

discussions, Dennis Foss for valuable technical assistance,

and Judy Laber for DNA sequencing This project was

fund-ed in part by the National Pork Producers Association and

the Minnesota Agricultural Experiment Station.

Sources and manufacturers

c Dr J Christopher-Henning, South Dakota State University, Brookings, SD

d Ransom Hill Bioscience, Ramona, CA

e NuSieve agarose, FMC Bioproducts, Rockland, ME f GIBCO BRL, Gaithersburg, MD

g Boehringer Mannheim, Indianapolis, IN h Magnagraph, MSI, Westboro, MA

References

1 Akin A, Wu CC, Lin TL, Keirs RW: 1993, Chemiluminescent detection of infectious bursal disease virus with a PCR-gener-ated nonradiolabeled probe J Vet Diagn Invest 5:166–173 Bautista EM, Choi CS, Ayad S, et al.: 1994, Antigenic diversity

within porcine epidemic abortion and respiratory syndrome (PEARS) virus isolates Int Pig Vet Soc Meet 1994:63 Bautista EM, Goyal SM, Yoon IJ, et al.: 1993, Comparison of

porcine alveolar macrophages and CL 2621 for the detection of porcine reproductive and respiratory syndrome (PRRS) virus and anti-PRRS antibody J Vet Diagn Invest 5:163–165 Christopher-Hennings J, Nelson EA, Nelson JK, et al.: 1995,

Detection of porcine reproductive and respiratory syndrome vi-rus in boar semen by PCR J Clin Microbiol 33:1730–1734 Conzelmann KK, Visser N, Van Woensel P, Thiel HJ: 1993,

Molecular characterization of porcine reproductive and respi-ratory syndrome virus, a member of the Arterivirus group Vi-rology 193:329–339

6 Drew T, Meulenberg JM, Sands J, Paton D: 1995, Production, characterization and reactivity of monoclonal antibodies to por-cine reproductive and respiratory syndrome virus J Gen Virol 76:1361–1369

7 Goyal SM: 1993, Porcine reproductive and respiratory syn-drome J Vet Diagn Invest 5:656–664

8 Goyal SM: 1995, Strain variation in PRRS virus: implication in diagnosis, epidemiology and control Res Invest Rep Natl Pork Prod Counc 1995:55–60

9 Heino P, Hukkanen V, Arstila P: 1994, Digoxigenin labeled probes and their use in the laboratory diagnosis of virus infec-tions Appl Virol Res 3:101–104

10 Henchal EA, Polo SL, Vorndam V, et al.: 1991, Sensitivity and specificity of a universal primer set for the diagnosis of Dengue virus infections by polymerase chain reaction and nucleic acid hybridization Am J Trop Med Hyg 45:418–428

11 Kapur V, Elam MR, Pawlovich TM, Murtaugh MP: 1996, Ge-netic variation in PRRS virus isolates in the midwestern United States J Gen Virol 77:1271–1276

12 Keffaber KK: 1989, Reproductive failure of unknown etiology Am Assoc Swine Pract Newsl 1:1–10

13 Kwang J, Kim HS, Joo HS: 1994, Cloning, expression, and

sequence analysis of the ORF4 gene of the porcine reproductive and respiratory syndrome virus MN-1b J Vet Diagn Invest 6: 293–296

14 Mardassi H, Mounir S, Dea S: 1994, Identification of major differences in the nucleocapsid protein genes of a Quebec strain and European strains of porcine reproductive and respiratory syndrome virus J Gen Virol 75:681–685

15 Mardassi H, Mounir S, Dea S: 1995, Molecular analysis of the ORFs to of porcine reproductive and respiratory syndrome virus, Quebec reference strain Arch Virol 140:1405–1418 16 Mardassi H, Wilson L, Mounir S, Dea S: 1994, Detection of

porcine reproductive and respiratory syndrome virus and effi-cient differentiation between Canadian and European strains by reverse transcription and PCR amplification J Clin Microbiol 32:2197–2203

17 Meng XJ, Paul PS, Halbur PG: 1994, Molecular cloning and nucleotide sequencing of the 39-terminal genomic RNA of the porcine reproductive and respiratory syndrome virus J Gen Vi-rol 75:1795–1801

18 Meng XJ, Paul PS, Halbur PG, Lum MA: 1995, Phylogenetic analyses of the putative M (ORF 6) and N (ORF 7) genes of porcine reproductive and respiratory syndrome virus (PRRSV): implication for the existence of two genotypes of PRRSV in the U.S.A and Europe Arch Virol 140:745–755

19 Meulenberg JJM, Hulst MM, de Meuer EJ, et al.: 1993, Lelystad virus, the causative agent of porcine epidemic abortion and re-spiratory syndrome (PEARS), is related to LDV and EAV Vi-rology 192:62–72

20 Meulenberg JJM, Hulst MM, de Meijer EJ, et al.: 1994, Lelystad virus belongs to a new virus family, comprising lactate dehy-drogenase-elevating virus, equine arteritis virus, and simian hemorrhagic fever virus Arch Virol Suppl 9:441–448 21 Meulenberg JJM, Petersen-den Besten A, de Kluyver EP, et al.:

1995, Characterization of proteins encoded by ORFs to of Lelystad virus Virology 206:155–163

22 Morozow I, Meng XJ, Paul PS: 1995, Sequence analysis of open reading frames (ORFs) to of a U.S isolate of porcine re-productive and respiratory virus Arch Virol 140:1313–1319 23 Murtaugh MP, Elam MR, Kakach LT: 1995, Comparison of the

structural protein coding sequences of the VR-2332 and Lelys-tad virus strains of the PRRS virus Arch Virol 140:1451–1460 24 Musiani M, Zerbini M, Gentilomi G, et al.: 1992, Detection of CMV DNA in clinical samples of AIDS patients by chemilu-minescence hybridization J Virol Methods 38:1–10

25 Nelson EA, Christopher-Hennings J, Drew T, et al.: 1993, Dif-ferentiation of U.S and European isolates of porcine reproduc-tive and respiratory syndrome virus by monoclonal antibodies J Clin Microbiol 31:3184–3189

26 Poon H, Jimenez E, Jacobs RM, et al.: 1993, Detection of bo-vine leukemia virus RNA in serum using the polymerase chain reaction J Virol Methods 41:101–112

27 Shimizu M, Yamada S, Murakami Y, et al.: 1994, Isolation of porcine reproductive and respiratory syndrome (PRRS) virus from Heko-Heko disease of pigs J Vet Med Sci 56:2, 389–391 28 Suarez P, Zardoya R, Prieto C, et al.: 1994, Direct detection of the porcine reproductive and respiratory syndrome (PRRS) virus by reverse polymerase chain reaction (RT-PCR) Arch Virol 35: 89–99

29 Van Woensel P, Van Der Wouw J, Visser N: 1994, Detection of porcine reproductive and respiratory syndrome virus by the polymerase chain reaction J Virol Methods 47:273–278 30 Wensvoort G, de Kluyver EP, Luijtze EA, et al.: 1992, Antigenic

(7)

31 Wensvoort G, Terpstra C, Pol JMA, et al.: 1991, Mystery swine disease in the Netherlands: the isolation of Lelystad virus Vet Q 13:121–130

32 Yoon IJ, Joo HS, Christianson WT, et al.: 1992, An indirect fluorescent antibody test for the detection of antibody to swine infertility and respiratory syndrome virus in swine sera J Vet Diagn Invest 4:144–147

33 Yoon IJ, Joo HS, Goyal SM, Molitor TW: 1994, A modified serum neutralization test for the detection of antibody to porcine reproductive and respiratory syndrome virus in swine sera J Vet Diagn Invest 6:289–292