Nghiên cứu sự lưu hành của các týp huyết thanh và tính nhạy cảm kháng sinh của các chủng phế cầu gây viêm đường hô hấp cấp ở trẻ em nhập viện tại bệnh viện đa khoa tỉnh khánh hòa

ĐẠI HỌC QUỐC GIA HÀ NỘI TRƢỜNG ĐẠI HỌC KHOA HỌC TỰ NHIÊN Lê Thị Kim Anh NGHIÊN CỨU SỰ LƢU HÀNH CỦA CÁC TÝP HUYẾT THANH VÀ TÍNH NHẠY CẢM KHÁNG SINH CỦA CÁC CHỦNG PHẾ CẦU GÂY VIÊM ĐƢỜNG HÔ HẤP CẤP Ở TRẺ EM NHẬP VIỆN TẠI BỆNH VIỆN ĐA KHOA TỈNH KHÁNH HÒA LUẬN VĂN THẠC SĨ KHOA HỌC Hà Nội, 2017 ĐẠI HỌC QUỐC GIA HÀ NỘI TRƢỜNG ĐẠI HỌC KHOA HỌC TỰ NHIÊN Lê Thị Kim Anh NGHIÊN CỨU SỰ LƢU HÀNH CỦA CÁC TÝP HUYẾT THANH VÀ TÍNH NHẠY CẢM KHÁNG SINH CỦA CÁC CHỦNG PHẾ CẦU GÂY VIÊM ĐƢỜNG HÔ HẤP CẤP Ở TRẺ EM NHẬP VIỆN TẠI BỆNH VIỆN ĐA KHOA TỈNH KHÁNH HÒA Chuyên ngành: Sinh học thực nghiệm Mã số: 60420114 LUẬN VĂN THẠC SĨ KHOA HỌC NGƢỜI HƢỚNG DẪN KHOA HỌC:TS Vũ Thị Thu Hƣờng PGS TS Hoàng Thị Mỹ Nhung Hà Nội, 2017 LỜI CẢM ƠN Lời đầu tiên, tơi muốn bày tỏ cảm kích đến PGS.TS Lay Myint Yoshida Bác ngƣời trực tiếp vấn thu nhận tơi vào vị trí trợ lý nghiên cứu cho công việc Vietnam Research Station Đại học Nagasaki, Nhật Bản Công việc đƣa đến cho thay đổi mới, từ sống tơi trở nên tốt đẹp vui vẻ nhiều Bác ngƣời đồng ý, khuyến khích tạo thuận lợi giúp tơi hồn thành khóa học Thạc sỹ Đồng thời Bác đồng hƣớng dẫn tôi, đã tƣ vấn, chỉ dẫn tơi nhiều q trình thực xử lý kết nghiên cứu Tôi xin đƣợc gửi lời cảm ơn sâu sắc nhất đến Bác TS Vũ Thị Thu Hƣờng – Trƣởng PTN Vi khuẩ n ky ̣ khí , Viê ̣n Vê ̣ sinh dich ̣ tễ Trung ƣơng, ngƣời trực tiếp hƣớng dẫn tơi cơng việc thí nghiệm nơi làm việc Với kinh nghiệm phong phú lĩnh vực nghiên cứu phế cầu, Cơ tận tình hƣớng dẫn tơi hồn thành cơng việc Đặc biệt, Cơ ln ngƣời chỉ dẫn sáng suốt cho tơi tơi gặp khó khăn hay lúng túng việc hiểu thực thí nghiệm Nhờ tận tình tài mình, Cơ giúp tơi hồn thành cơng việc thí nghiê ̣m thành đến Cô cách tốt Tôi xin đƣợc gửi lời cảm ơn chân Ngƣời hƣớng dẫn thứ hai, ngƣời đóng vai trị vơ quan trọng nghiệp theo đuổi đƣờng Sinh học tơi, PGS.TS Hồng Thị Mỹ Nhung – Phó chủ nhiệm Bộ môn Sinh học Tế bào , ĐH Khoa ho ̣c Tƣ̣ nhiên Cô ngƣời hƣớng dẫn tơi hồn thành Khóa luận tốt nghiệp đại học Từ ngày đầu đƣợc theo hƣớng dẫn Cơ, niềm u thích nghiêm túc nghiên cứu Sinh học đƣợc thổi bùng lên nhƣ lửa Trong lúc phân vân trƣớc định quan trọng nghiệp, Cô hình ảnh giữ tơi bƣớc thật vững vàng, tự tin Trong suốt trình từ định hƣớng, bắt đầu, đến thực nghiên cứu mình, Cơ giúp đỡ, đƣa chỉ dẫn quan trọng cho tơi, để tơi đến hồn thành Tôi xin đƣợc gửi lời cảm ơn chân thành đến Cơ Tiếp theo, ngƣời đóng vai trị quan trọng nghiệp nghiên cứu ThS Nguyễn Thị Hiền Anh – Trƣởng PTN Phế cầ u , Viê ̣n Vê ̣ sinh Dich ̣ tễ Trung ƣơng Từ tận đáy lịng tơi muốn đƣợc gửi lời cảm ơn chân thành đến Chị Khơng chỉ cơng việc, mà q trình thực hiê ̣n nghiên cứu từ giây phút ban đầu đến giây phút kết thúc cuối cùng, có Chị bên cạnh động viên, chia sẻ, giúp đỡ, hƣớng dẫn Nhờ có diện Chị mà tơi ln có động lực, sức mạnh để hồn thành cơng việc mình, cách tốt Chị ngƣời thầy, ngƣời chị, ngƣời bạn ngƣời sếp quan trọng đời Tôi xin đƣợc gửi lời cảm ơn từ tận đáy lịng đến Chị, cảm ơn chị ln bên tơi Gia đình tơi q nhà ln hậu phƣơng vững chắc, tƣờng thành kiên cố ngăn cản sóng gió sống quá trình học tập tơi Tơi biết gia đình ln dõi theo ủng hộ nẻo đƣờng Ngày hồn thành cơng việc nghiên cứu, tơi muốn đƣợc nói lời cảm ơn đến gia đình mình: Con cảm ơn bố mẹ, anh chị, em, cháu… động viên ủng hộ dù hồn cảnh nào, để ln ln phía trƣớc Tơi xin đƣợc gửi lời cảm ơn đến anh chị, bạn bè đồng nghiệp Viện Vệ sinh Dịch tễ Trung ƣơng, Sở Y tế Khánh Hòa Bệnh viện Đa khoa Khánh Hịa tinh thần trách nhiệm nỗ lực việc thực đề tài Mọi ngƣời luôn sẵn sàng giúp đỡ, chỉ dẫn cho để tơi hồn thành cơng việc cách thuận lợi Cuối cùng, muốn đƣợc gửi lời cảm ơn đến ngƣời bạn Những ngƣời đồng hành sống công việc Dù họ không bên tơi thực cơng việc mình, nhƣng họ ln biết hiểu khó khăn tơi san sẻ với , ngƣời thấy niềm vui công việc họ vui Tôi xin đƣợc cảm ơn bạn Người viết lời cảm ơn Lê Thị Kim Anh MỤC LỤC LỜI MỞ ĐẦU CHƢƠNG - TỔNG QUAN 1.1 Viêm đƣờng hô hấp cấp tính (Acute Respiratory Infection-ARI) 1.1.1 Tình hình nhiễm khuẩn hơ hấp cấp trẻ em dƣới tuổi .3 1.1.2 Căn ngun gây nhiễm khuẩn hơ hấp cấp tính trẻ em dƣới tuổi .4 1.2 Phế cầu khuẩn (Streptococcus pneumoniae) 1.2.1 Đặc điểm vi sinh, nuôi cấy định danh phế cầu khuẩn .8 1.2.2 Đặc điểm dịch tễ học và phân bố týp huyế t phế cầu khuẩn 10 1.2.3 Các thành phần bề mặt Streptococcus pneumoniae 11 1.2.4 Các yếu tố độc lực phế cầu khuẩn 12 1.2.5 Sƣ̣ cƣ trú và gây bê ̣nh của Streptococcus pneumoniae 22 1.2.6 Sƣ̣ thay thế týp huyế t của Streptococcus pneumoniae .25 1.2.7 Tính kháng kháng sinh Streptococcus pneumoniae 26 1.2.8 Mố i liên ̣ giƣ̃a týp huyế t và sƣ̣ kháng kháng sinh của Streptococcus pneumoniae 28 1.3 Vắ c xin phế cầ u 31 1.3.1 Vắ c xin polysaccharide (Polysaccharide vaccines) .32 1.3.2 Vắ c xin cô ̣ng hơ ̣p polysaccharide (Polysaccharide conjugate vaccines) .32 1.3.3 Các kháng nguyên vắ c xin mới tƣơng lai 33 CHƢƠNG - ĐỐI TƢỢNG VÀ PHƢƠNG PHÁP NGHIÊN CỨU 34 2.1 Thời gian, điạ điể m nghiên cứu 34 2.2 Đối tƣợng nghiên cứu 35 2.3 Cỡ mẫu nghiên cƣ́u .36 2.3 Thiế t kế nghiên cƣ́u 36 2.4 Hóa chất, sinh phẩ m trang thiết bị 36 2.5 Các phƣơng pháp tiế n hành 36 2.5.1 Sơ đồ nghiên cứu 36 2.5.2 Phƣơng pháp thu thập mẫu dich ̣ ty ̣ hầ u 37 2.5.3 Phƣơng pháp nuôi cấ y phân lâ ̣p Streptococcus pneumoniae .38 2.5.4 Phƣơng pháp tách chiế t ADN 39 2.5.5.Phƣơng pháp sàng lọc phế cầu khuẩn PCR đa mồi 39 2.5.6 Phƣơng pháp đinh ̣ týp huyế t phế cầ u bằ ng PCR đa mồ i 40 2.5.7 Xác định nồng độ kháng sinh tối thiểu ức chế vi khuẩn (MIC) 41 2.5.9 Xƣ̉ lý và phân tích số liê ̣u 45 2.5.10 Các biến số nghiên cứu 45 CHƢƠNG - KẾT QUẢ .46 3.1 Kết xác định tỷ lệ mangStreptococcus pneumoniae trẻ em mắc ARI 46 3.1.1 Kết thu thập mẫu đặc điểm ca trẻ mắc ARI 46 3.1.2 Kế t quả nuôi cấ y đinh ̣ danh Streptococcus pneumoniae .46 3.1.3 Kết sàng lọc phế cầu PCR đa mồi 47 3.2 Kết xác định phân bố týp huyế t của phế cầ u 48 3.3 Kết xác định nồ ng đô ̣ kháng sinh tố i thiể u ƣ́c chế vi khuẩ n (MIC) 51 3.3.1 Kết tổng quát mức độ nhạy cảm kháng sinh phế cầu 51 3.3.2 Kế t quả mƣ́c đô ̣ nha ̣y cảm kháng sinh của phế cầ u theo týp huyế t 53 BÀN LUẬN 56 KẾT LUẬN 59 KIẾN NGHI 60 ̣ TÀI LIỆU THAM KHẢO .61 PHỤ LỤC 70 DANH MỤC HÌNH ẢNH Hình 1.1: Phế cầ u khuẩ n dưới kính hiể n vi quang ho ̣c Hình 1.2: Phế cầ u khuẩ n gây tan máu alpha tha ̣ch máu Hình 1.3: Vỏ polysaccharide của phế cầu 10 Hình 1.4: lớp bề mă ̣t của phế cầ u khuẩ n 12 Hình 1.5: Sư ̣ tổ ng hơ ̣p CPS của týp 9A bằ ng đường phu ̣ thuô ̣c Wzx/Wzy .17 Hình 1.6: Các týp huyết gây IPD phổ biến nhất theo khu vực 25 Hình 2.1: Vị trí Thành phố Nha Trang Bệnh viện Đa khoa tỉnh Khánh Hịa ….34 Hình 2.2: Sơ đờ nghiên cứu 37 Hình 2.3: Vị trí lấy dịch tỵ hầu bằng tăm 38 Hình 2.4: Các kiểu hình tan máu của vi khuẩn môi trường thạch máu 39 Hình 2.5: Vòng ức chế của Optochin lên sinh trưởng của phế cầu khuẩn 39 Hình 2.6: Cách pha loãng bậc cho 16 nồng độ kháng sinh từ dung dịch mẹ 42 Hình 2.7: Vi khuẩn mọc các đĩa thạch Mueller-Hinton có kháng sinh 44 Hình 3.1: Hình ảnh nuôi cấy định danh phế cầu ………………………………………47 Hình 3.2: Hình ảnh điện di sản phẩm PCR sàng lọc phế cầu 47 Hình 3.3: Hình ảnh điện di sản phẩm của set PCR đinh ̣ týp huyế t phế cầ u .49 Hình 3.4: Mẫu phế cầu mang týp huyết 52 Hình 3.5: Chủng mọc đĩa thạch có nồng độ kháng sinh khác ………….50 DANH MỤC BẢNG, SƠ ĐỜ, ĐỜ THỊ BẢNG Bảng 1.1: Mơ ̣t sớ yế u tố đô ̣c lưc̣ và vai trò của chúng sư ̣ cư trú của phế cầ u .23 Bảng 1.2: Những yế u tố làm tăng nguy mắ c IPD ở trẻ em 24 Bảng 1.3: Tính nhạy cảm các loại kháng sinh của các chủng S pneumoniae phân lập từ 1997-2000 28 Bảng 1.4: Các vắc xin phế cầu 32 Bảng 2.1: Trình tự că ̣p mồ i lytA và cpsA………………………………………… 40 Bảng 2.2: Các kháng sinh thử nghiệm và diễn giải MIC phế cầu 41 Bảng 3.1: Kết sàng lọc phế cầu PCR với lytA cpsA…………………… 47 Bảng 3.2: Kết quả sàng lọc và xác định phân bố týp huyết phế cầu 50 Bảng 3.3: MIC của các týp huyế t có vắ c xin 53 Bảng 3.4: MIC của các týp huyế t không có vắ c xin 54 SƠ ĐỒ Sơ đồ 2.1: Sơ đồ chấm chủng cấy 32 giếng .44 Sơ đồ 3.1: Số ca hầ u……………48 bê ̣nh nhi mắ c ARI đƣơ ̣c tuyể n cho ̣n và mẫu dich ̣ ty ̣ ĐỜ THỊ Biể u đờ 3.1: Sư ̣ phân bố týp huyế t phế cầ u ở trẻ em mắ c ARI 51 Biể u đồ 3.2: Tính kháng của phế cầu đố i với các loại kháng sinh 52 Biể u đồ 3.3: Phân bố týp huyết của các chủng phế cầu kháng thuốc 55 DANH MỤC VIẾT TẮT Tên đầy đủ Từ viết tắt ARI Acute Respiratory Infection(Viêm đƣờng hô hấ p cấ p ) CAP Community Acquired Pneumonia (Viêm phổ i mắ c phải cô ̣ng đồ ng) IPD Invasive Pneumococcal Disease (Bê ̣nh phế cầ u xâm lấ n ) CPS Capsular Polysaccharide (Polysaccharide vỏ ) CWPS OS Cell Wall Polysaccharide (Polysaccharide thành tế bào ) Oligosaccharide ChoP Phosphorylcholine PspA Pneumococcal surface protein A (Protein bề mă ̣t phế cầ u A) PspC Pneumococcal surface protein C(Protein bề mă ̣t phế cầ u C) ABC ATP-binding Cassette (Phƣ́c hơ ̣p gắ n ATP) PsaA Pneumococcal surface antigen A (Kháng nguyên bề mặt phế cầu A ) PiaA Pneumococcal iron acquisition A (Chấ t thu nhâ ̣n sắ t của phế cầ u A) PiuA Pneumococcal iron uptake A (Chấ t hấ p thu ̣ sắ t của phế cầ u A) 7-valent Pneumococcal Conjugate Vaccine (Vắ c xin cô ̣ng hơ ̣p phế cầ u giá) 10-valent Pneumococcal Conjugate Vaccine (Vắ c xin cô ̣ng hơ ̣p phế cầ u 10 giá) PCV7 PCV10 PCV13 13-valent Pneumococcal Conjugate Vaccine (Vắ c xin cô ̣ng hơ ̣p phế cầ u 13 giá) PPSV23 23-valent Pneumococcal Polysaccharide Vaccine (Vắ c xin polysaccharide phế cầ u 23 giá) PNSP ENSP Penicillin Non-Susceptible Pneumococci (Phế cầ u không nha ̣y Penicillin) Erythromycin Non-Susceptible Pneumococci (Phế cầ u không nha ̣y Erythromycin) NIPs National Immunization Programs (Chƣơng trin ̀ h tiêm chủng quố c gia) MDR Multi-drug Resistance (Đa kháng thuố c) WHO PCR World Health Organization (Tổ chƣ́c Y tế thế giới) Plymerase Chain Reaction (Phản ửng trùng hợp chuỗi) MIC Minimun Inhibition Concentration (Nồ ng đô ̣ tố i thiể u ƣ́c chế ) AE Elution Buffer (Đê ̣m rƣ̉a chiế t ) ATCC American Type Culture Collection (Bô ̣ sƣu tâ ̣p giố ng chuẩ n Hoa Kỳ ) STGG Skim milk-Tryptone-Glucose-Glycerol KIẾN NGHI ̣ Tƣ̀ các kế t quả thu đƣơ ̣c nghiên cƣ́u, đƣa số kiến nghị sau: Tiế p tu ̣c đánh giá sƣ̣ lƣu hành của các týp huyế t phế cầ u ta ̣i Nha Trangvà thƣ̣c hiê ̣n đánh giá ta ̣i khác khu vƣ̣c khác của Viê ̣t Nam Nhằ m tìm sƣ̣ phân bố chung của các týp h uyế t của phế cầ u , cung cấ p dƣ̃ liê ̣u khảo sát cho chiế n lƣơ ̣c phát triể n vắ c xin cô ̣ng hơ ̣p phế cầ u tƣơng lai Nên đƣa vào sƣ̉ du ̣ng rô ̣ng raĩ vắ c xin cô ̣ng hơ ̣p phế cầ u PCV , nhấ t là ở các nhóm tuổi có tỷ lệ mang nguy mắ c các bê ̣nh phế lớn nhƣ trẻ em dƣới tuổ i sẽ có hiê ̣u quả cao Đồng thời tiến hành giám sát chặt chẽ thay đổi phân bố týp huyế t và tính kháng kháng sinh của phế cầ u Kỹ thuật Multiplex PCR thể độ tin cậy cao , đơn giản và giá thành thƣ̣c hiê ̣n thấ p, thể kỹ thuật n ên đƣơ ̣c ứng dụng rộng rãi giám sát lƣu hành các týp huyế t cũng nhƣ chẩ n đoán phế cầ u Cân nhắ c sƣ̉ du ̣ng hơ ̣p lý các kháng sinh có tỷ lê ̣ kháng cao phế cầu nhƣ Penicillin, Macrolide, Chlindamycin, Tetracycline, Ciprofloxacin điề u tri ̣ bệnh phế cầ u 60 TÀI LIỆU THAM KHẢO Tiếng Việt Bô ̣ Y Tế (2007b), Niên giám thố ng kê Y tế Nhà xuất Y học, Hà Nội Bô ̣ Y Tế (2010), Niên giám thố ng kê Y tế Nhà xuất Y học, Hà Nội Tiế ng Anh Abeyta, M., Hardy, G G.,Yother, J (2003), Genetic alteration of capsule type but not PspA type affects accessibility of surface-bound complement and surface antigens of Streptococcus pneumoniae, Infect Immun, 71(1), pp 218-225 Anh, D D., et al (2009), Surveillance of pneumococcal-associated diseases among hospitalized children in Khanh Hoa province, Vietnam, Clinical Infectious Disease Appelbaum, P C (1992), Antimicrobial resistance in Streptococcus pneumoniae: an overview, Clin Infect Dis, 15(1), pp 77-83 Austrain, R (1981), Some observations on the pneumococcus and on the current status of pneumococcal disease and its prevention, Rev Infect Dis, Avery, O T., Macleod, C M.,McCarty, M (1944), Studies on the Chemical Nature of the Substance Inducing Transformation of Pneumococcal Types : Induction of Transformation by a Desoxyribonucleic Acid Fraction Isolated from Pneumococcus Type Iii, J Exp Med, 79(2), pp 137-158 Baba, H., Kawamura, I., Kohda, C., Nomura, T., Ito, Y., Kimoto, T., Watanabe, I., Ichiyama, S.,Mitsuyama, M (2002), Induction of gamma interferon and nitric oxide by truncated pneumolysin that lacks pore-forming activity, Infect Immun, 70(1), pp 107-113 Balakrishnan, I., Crook, P., Morris, R.,Gillespie, S H (2000), Early predictors of mortality in pneumococcal bacteraemia, J Infect, 40(3), pp 256-261 10 Berkley JA., et al (2005), Bacteremia among children admitted to a rural hospital in Kenya, N Engl J Med, 352, pp 39-47 11 Berry, A M., Lock, R A., Hansman, D.,Paton, J C (1989), Contribution of autolysin to virulence of Streptococcus pneumoniae, Infect Immun, 57(8), pp 2324-2330 12 Blaser, John E Bennett & Raphael Dolin & Martin J (2014), Mandell, Douglas, and Bennett's Principles and Practice of Infectious Diseases, New York: Churchill Livingstone, Volume and volume (Vol 2) 13 Bogaert, D., De Groot, R.,Hermans, P W (2004), Streptococcus pneumoniae colonisation: the key to pneumococcal disease, Lancet Infect Dis, 4(3), pp 144-154 14 Bogaert, D., Hermans, P W., Adrian, P V., Rumke, H C.,de Groot, R (2004), Pneumococcal vaccines: an update on current strategies, Vaccine, 22(17-18), pp 2209-2220 61 15 Bonten, M J., Huijts, S M., Bolkenbaas, M., Webber, C., Patterson, S., Gault, S., van Werkhoven, C H., van Deursen, A M., Sanders, E A., Verheij, T J., Patton, M., McDonough, A., Moradoghli-Haftvani, A., Smith, H., Mellelieu, T., Pride, M W., Crowther, G., Schmoele-Thoma, B., Scott, D A., Jansen, K U., Lobatto, R., Oosterman, B., Visser, N., Caspers, E., Smorenburg, A., Emini, E A., Gruber, W C.,Grobbee, D E (2015), Polysaccharide conjugate vaccine against pneumococcal pneumonia in adults, N Engl J Med, 372(12), pp 1114-1125 16 Boulnois, G J (1992), Pneumococcal proteins and the pathogenesis of disease caused by Streptococcus pneumoniae, J Gen Microbiol, 138(2), pp 249-259 17 Breiman, R F., Spika, J S., Navarro, V J., Darden, P M.,Darby, C P (1990), Pneumococcal bacteremia in Charleston County, South Carolina A decade later, Arch Intern Med, 150(7), pp 1401-1405 18 Briles, D E., Ades, E., Paton, J C., Sampson, J S., Carlone, G M., Huebner, R C., Virolainen, A., Swiatlo, E.,Hollingshead, S K (2000), Intranasal immunization of mice with a mixture of the pneumococcal proteins PsaA and PspA is highly protective against nasopharyngeal carriage of Streptococcus pneumoniae, Infect Immun, 68(2), pp 796-800 19 Broor, S., Parveen, S., Bharaj, P., Prasad, V S., Srinivasulu, K N., Sumanth, K M., Kapoor, S K., Fowler, K.,Sullender, W M (2007), A prospective three-year cohort study of the epidemiology and virology of acute respiratory infections of children in rural India, PLoS One, 2(6), pp e491 20 Brown, J S., Gilliland, S M.,Holden, D W (2001), A Streptococcus pneumoniae pathogenicity island encoding an ABC transporter involved in iron uptake and virulence, Mol Microbiol, 40(3), pp 572-585 21 Brugger, S D., Hathaway, L J.,Muhlemann, K (2009), Detection of Streptococcus pneumoniae strain cocolonization in the nasopharynx, J Clin Microbiol, 47(6), pp 1750-1756 22 Brundage, J F.,Shanks, G D (2008), Deaths from bacterial pneumonia during 191819 influenza pandemic, Emerg Infect Dis, 14(8), pp 1193-1199 23 Bryce, J., Boschi-Pinto, C., Shibuya, K., Black, R E.,Group, W H O Child Health Epidemiology Reference (2005), WHO estimates of the causes of death in children, Lancet, 365(9465), pp 1147-1152 24 Cardozo, D M., Nascimento-Carvalho, C M., Andrade, A L., Silvany-Neto, A M., Daltro, C H., Brandao, M A., Brandao, A P.,Brandileone, M C (2008), Prevalence and risk factors for nasopharyngeal carriage of Streptococcus pneumoniae among adolescents, J Med Microbiol, 57(Pt 2), pp 185-189 25 Center for Disease Control and Prevention (CDC) (2009), Bacterial coinfections in lung tissue specimens from fatal case of 2009 pandemic influenza A (H1N1) - United States, May-August 2009 MMWR Morb Mortal Wkly Rep Vol 58 1071 26 Cevey-Macherel, M., Galetto-Lacour, A., Gervaix, A., Siegrist, C A., Bille, J., Bescher-Ninet, B., Kaiser, L., Krahenbuhl, J D.,Gehri, M (2009), Etiology of 62 community-acquired pneumonia in hospitalized children based on WHO clinical guidelines, Eur J Pediatr, 168(12), pp 1429-1436 27 Clavo-Sanchez, A J., Giron-Gonzalez, J A., Lopez-Prieto, D., Canueto-Quintero, J., Sanchez-Porto, A., Vergara-Campos, A., Marin-Casanova, P.,Cordoba-Dona, J A (1997), Multivariate analysis of risk factors for infection due to penicillin-resistant and multidrug-resistant Streptococcus pneumoniae: a multicenter study, Clin Infect Dis, 24(6), pp 1052-1059 28 Cohen, R., Levy, C., Bonnet, E., Grondin, S., Desvignes, V., Lecuyer, A., Fritzell, B.,Varon, E (2010), Dynamic of pneumococcal nasopharyngeal carriage in children with acute otitis media following PCV7 introduction in France, Vaccine, 28(37), pp 6114-6121 29 Chien, Y W., Klugman, K P.,Morens, D M (2009), Bacterial pathogens and death during the 1918 influenza pandemic, N Engl J Med, 361(26), pp 2582-2583 30 Dhoubhadel, B G., Yasunami, M., Nguyen, H A., Suzuki, M., Vu, T H., Thi Thuy Nguyen, A., Dang, D A., Yoshida, L M.,Ariyoshi, K (2014), Bacterial load of pneumococcal serotypes correlates with their prevalence and multiple serotypes is associated with acute respiratory infections among children less than years of age, PLoS One, 9(10), pp e110777 31 Duane, P.G., Rubins, J.B., Weisel, H.R., Janoff EN (1993), Identification of hydrogen peroxide as a Streptococcus pneumoniae toxin for rat alveolar epithelial cells, Infect Immun, 61, pp 4396-4397 32 Ercibengoa, M., Arostegi, N., Marimon, J M., Alonso, M.,Perez-Trallero, E (2012), Dynamics of pneumococcal nasopharyngeal carriage in healthy children attending a day care center in northern Spain Influence of detection techniques on the results, BMC Infect Dis, 12, pp 69 33 Fenoll, A., Asensio, G., Jado, I., Berron, S., Camacho, M T., Ortega, M.,Casal, J (2002), Antimicrobial susceptibility and pneumococcal serotypes, J Antimicrob Chemother, 50 Suppl S2, pp 13-19 34 Fenoll, A., Granizo, J J., Aguilar, L., Gimenez, M J., Aragoneses-Fenoll, L., Hanquet, G., Casal, J.,Tarrago, D (2009), Temporal trends of invasive Streptococcus pneumoniae serotypes and antimicrobial resistance patterns in Spain from 1979 to 2007, J Clin Microbiol, 47(4), pp 1012-1020 35 Fenoll, A., Gimenez, M J., Robledo, O., Aguilar, L., Tarrago, D., Granizo, J J.,Martin-Herrero, J E (2008), Influence of penicillin/amoxicillin non-susceptibility on the activity of third-generation cephalosporins against Streptococcus pneumoniae, Eur J Clin Microbiol Infect Dis, 27(1), pp 75-80 36 Fernebro, J., Andersson, I., Sublett, J., Morfeldt, E., Novak, R., Tuomanen, E., Normark, S.,Normark, B H (2004), Capsular expression in Streptococcus pneumoniae negatively affects spontaneous and antibiotic-induced lysis and contributes to antibiotic tolerance, J Infect Dis, 189(2), pp 328-338 37 Garcia-Leoni, M E., Cercenado, E., Rodeno, P., Bernaldo de Quiros, J C., MartinezHernandez, D.,Bouza, E (1992), Susceptibility of Streptococcus pneumoniae to 63 penicillin: a prospective microbiological and clinical study, Clin Infect Dis, 14(2), pp 427-435 38 Garcia, E., Llull, D., Munoz, R., Mollerach, M.,Lopez, R (2000), Current trends in capsular polysaccharide biosynthesis of Streptococcus pneumoniae, Res Microbiol, 151(6), pp 429-435 39 Graham, S M., English, M., Hazir, T., Enarson, P.,Duke, T (2008), Challenges to improving case management of childhood pneumonia at health facilities in resourcelimited settings, Bull World Health Organ, 86(5), pp 349-355 40 Gray, B M., Converse, G M., 3rd,Dillon, H C., Jr (1979), Serotypes of Streptococcus pneumoniae causing disease, J Infect Dis, 140(6), pp 979-983 41 Gray, B M., Converse, G M., 3rd,Dillon, H C., Jr (1980), Epidemiologic studies of Streptococcus pneumoniae in infants: acquisition, carriage, and infection during the first 24 months of life, J Infect Dis, 142(6), pp 923-933 42 Grijalva, C G., Griffin, M R., Edwards, K M., Johnson, M., Gil, A I., Verástegui, H., Lanata, C F., Williams, J V (2014), Concordance between RT-PCR-based detection of respiratory viruses from nasal swabs collected for viral testing and nasopharyngeal swabs collected for bacterial testing, J Clin Virol, 60, pp 309-312 43 Gillespie, S H (1989), Aspects of pneumococcal infection including bacterial virulence, host response and vaccination, J Med Microbiol, 28(4), pp 237-248 44 Hammerschmidt, S., Wolff, S., Hocke, A., Rosseau, S., Muller, E.,Rohde, M (2005), Illustration of pneumococcal polysaccharide capsule during adherence and invasion of epithelial cells, Infect Immun, 73(8), pp 4653-4667 45 Hanquet, G., Kissling, E., Fenoll, A., George, R., Lepoutre, A., Lernout, T., Tarrago, D., Varon, E.,Verhaegen, J (2010), Pneumococcal serotypes in children in European countries, Emerg Infect Dis, 16(9), pp 1428-1439 46 Hare, K M., Morris, P., Smith-Vaughan, H.,Leach, A J (2008), Random colony selection versus colony morphology for detection of multiple pneumococcal serotypes in nasopharyngeal swabs, Pediatr Infect Dis J, 27(2), pp 178-180 47 Hirst, R A., Mohammed, B J., Mitchell, T J., Andrew, P W.,O'Callaghan, C (2004), Streptococcus pneumoniae-induced inhibition of rat ependymal cilia is attenuated by antipneumolysin antibody, Infect Immun, 72(11), pp 6694-6698 48 Ho, P L., Chiu, S S., Ang, I.,Lau, Y L (2011), Serotypes and antimicrobial susceptibilities of invasive Streptococcus pneumoniae before and after introduction of 7-valent pneumococcal conjugate vaccine, Hong Kong, 1995-2009, Vaccine, 29(17), pp 3270-3275 49 Horne, D.,Tomasz, A (1985), Pneumococcal Forssman antigen: enrichment in mesosomal membranes and specific binding to the autolytic enzyme of Streptococcus pneumoniae, J Bacteriol, 161(1), pp 18-24 64 50 Hostetter, M K (1986), Serotypic variations among virulent pneumococci in deposition and degradation of covalently bound C3b: implications for phagocytosis and antibody production, J Infect Dis, 153, pp 682-693 51 Hsu, K K., Shea, K M., Stevenson, A E., Pelton, S I.,Massachusetts Department of Public, Health (2010), Changing serotypes causing childhood invasive pneumococcal disease: Massachusetts, 2001-2007, Pediatr Infect Dis J, 29(4), pp 289-293 52 Huang, S S., Hinrichsen, V L., Stevenson, A E., Rifas-Shiman, S L., Kleinman, K., Pelton, S I., Lipsitch, M., Hanage, W P., Lee, G M.,Finkelstein, J A (2009), Continued impact of pneumococcal conjugate vaccine on carriage in young children, Pediatrics, 124(1), pp e1-11 53 Huss, A., Scott, P., Stuck, A E., Trotter, C.,Egger, M (2009), Efficacy of pneumococcal vaccination in adults: a meta-analysis, CMAJ, 180(1), pp 48-58 54 Institute, Clinical and Laboratory Standards (2008), Performance standards for antimicrobial susceptibility testing; eighteenth informational supplement In CLSI document M100-S18 Wayne, PA: Clinical and Laboratory Standards Institute 55 Johnson, H L., Deloria-Knoll, M., Levine, O S., Stoszek, S K., Freimanis Hance, L., Reithinger, R., Muenz, L R.,O'Brien, K L (2010), Systematic evaluation of serotypes causing invasive pneumococcal disease among children under five: the pneumococcal global serotype project, PLoS Med, 7(10) 56 Johnston, R B., Jr (1991), Pathogenesis of pneumococcal pneumonia, Rev Infect Dis, 13 Suppl 6, pp S509-517 57 Jounblat, R., Kadioglu, A., Mitchell, T J.,Andrew, P W (2003), Pneumococcal behavior and host responses during bronchopneumonia are affected differently by the cytolytic and complement-activating activities of pneumolysin, Infect Immun, 71(4), pp 1813-1819 58 Kahn, J S (2006), The widening scope of coronaviruses, Curr Opin Pediatr, 18(1), pp 42-47 59 Kelly, T., Dillard, J P.,Yother, J (1994), Effect of genetic switching of capsular type on virulence of Streptococcus pneumoniae, Infect Immun, 62(5), pp 1813-1819 60 Kensuke Takahashi, Motoi Suzuki, Le Nhat Minh, Nguyen Hien Anh, Luu Thi Minh Huong, Tran Vo Vinh Son, Phan The Long, Nguyen Thi Thuy Ai, Le Huu Tho, Konosuke Morimoto, Paul E Kilgore, Dang Duc Anh, Koya Ariyoshi and Lay-Myint Yoshida (2013), The incidence and aetiology of hospitalised community-acquired pneumonia among Vietnamese adults: A prospective surveillance in central Vietnam, BMC Infectious Diseases, 13, pp 296 61 Klugman, K P.,Koornhof, H J (1988), Drug resistance patterns and serogroups or serotypes of pneumococcal isolates from cerebrospinal fluid or blood, 1979-1986, J Infect Dis, 158(5), pp 956-964 62 Koedel, U., Scheld, W M.,Pfister, H W (2002), Pathogenesis and pathophysiology of pneumococcal meningitis, Lancet Infect Dis, 2(12), pp 721-736 65 63 Kharat, A S.,Tomasz, A (2003), Inactivation of the srtA gene affects localization of surface proteins and decreases adhesion of Streptococcus pneumoniae to human pharyngeal cells in vitro, Infect Immun, 71(5), pp 2758-2765 64 Lanoue, A., Clatworthy, M R., Smith, P., Green, S., Townsend, M J., Jolin, H E., Smith, K G., Fallon, P G.,McKenzie, A N (2004), SIGN-R1 contributes to protection against lethal pneumococcal infection in mice, J Exp Med, 200(11), pp 1383-1393 65 Laura E Caulfield, Mercedes de Onis, Monika Blössner, and Robert E Black (2004), Undernutrition as an underlying cause of child deaths associated with diarrhea, pneumonia, malaria, and measles, The American Journal Clinical Nutrition 66 Lehmann, D., Willis, J., Moore, H C., Giele, C., Murphy, D., Keil, A D., Harrison, C., Bayley, K., Watson, M.,Richmond, P (2010), The changing epidemiology of invasive pneumococcal disease in aboriginal and non-aboriginal western Australians from 1997 through 2007 and emergence of nonvaccine serotypes, Clin Infect Dis, 50(11), pp 1477-1486 67 Lexau, C A., Lynfield, R., Danila, R., Pilishvili, T., Facklam, R., Farley, M M., Harrison, L H., Schaffner, W., Reingold, A., Bennett, N M., Hadler, J., Cieslak, P R., Whitney, C G.,Active Bacterial Core Surveillance, Team (2005), Changing epidemiology of invasive pneumococcal disease among older adults in the era of pediatric pneumococcal conjugate vaccine, JAMA, 294(16), pp 2043-2051 68 Llull, D., Munoz, R., Lopez, R.,Garcia, E (1999), A single gene (tts) located outside the cap locus directs the formation of Streptococcus pneumoniae type 37 capsular polysaccharide Type 37 pneumococci are natural, genetically binary strains, J Exp Med, 190(2), pp 241-251 69 Mac, Leod Cm,Kraus, M R (1950), Relation of virulence of pneumococcal strains for mice to the quantity of capsular polysaccharide formed in vitro, J Exp Med, 92(1), pp 1-9 70 Monto, A S (2002), Epidemiology of viral respiratory infections, Am J Med, 112 Suppl 6A, pp 4S-12S 71 Moore, M R.; Link-Gelles, R.; Schaffner W.; et al (2015), Effect of use of 13-valent pneumococcal conjugate vaccine in children on invasive pneumococcal disease in children and adults in the USA, Lancet Infect Dis, 15(3), pp 301-309 72 Morona, J K., Paton, J C., Miller, D C.,Morona, R (2000), Tyrosine phosphorylation of CpsD negatively regulates capsular polysaccharide biosynthesis in streptococcus pneumoniae, Mol Microbiol, 35(6), pp 1431-1442 73 Mufson, M A., Chan, G., Stanek, R J (2007), Penicillin resistance not a factor in outcome from invasive Streptococcus pneumoniae community-acquired pneumonia in adults when appropriate empiric therapy is started, Am J Med Sci, 333(3), pp 161-167 74 Murray, Patrick R; Rosenthal, Ken S; Pfaller, Michael A (2005), Medical Microbioloy (Fifth Edition), St Louis: Elsvier Mosby 66 75 Musher, D M (1992), Infections caused by Streptococcus pneumoniae: clinical spectrum, pathogenesis, immunity, and treatment, Clin Infect Dis, 14(4), pp 801-807 76 Nascimento-Carvalho CM, Ribeiro CT, Cardoso MR , et al (2008), The role of respiratory viral infections among children hospitalized for community-acquired pneumonia in a developing country, Pediatr Infect Dis J 77 O'Brien K.L., Wolfson L.J., Watt J.P., et al (2009), Burden of disease caused by Streptococcus pneumoniae in children younger than years: global estimates, Lancet 78 Obaro, S K (2000), Confronting the pneumococcus: a target shift or bullet change?, Vaccine, 19(9-10), pp 1211-1217 79 Orihuela, C J., Gao, G., Francis, K P., Yu, J.,Tuomanen, E I (2004), Tissue-specific contributions of pneumococcal virulence factors to pathogenesis, J Infect Dis, 190(9), pp 1661-1669 80 Pasinato, A., Indolfi, G., Marchisio, P., Valleriani, C., Cortimiglia, M., Spanevello, V., Chiamenti, G., Buzzetti, R., Resti, M., Azzari, C.,Italian Group for the Study of Bacterial Nasopharyngeal Carriage in, Children (2014), Pneumococcal serotype distribution in 1315 nasopharyngeal swabs from a highly vaccinated cohort of Italian children as detected by RT-PCR, Vaccine, 32(12), pp 1375-1381 81 Pernica, J M., Moldovan, I., Chan, F.,Slinger, R (2014), Real-time polymerase chain reaction for microbiological diagnosis of parapneumonic effusions in Canadian children, Can J Infect Dis Med Microbiol, 25(3), pp 151-154 82 Pettigrew, M M., Fennie, K P., York, M P., Daniels, J.,Ghaffar, F (2006), Variation in the presence of neuraminidase genes among Streptococcus pneumoniae isolates with identical sequence types, Infect Immun, 74(6), pp 3360-3365 83 Pitkaranta, A., Roivainen, M., Blomgren, K., Peltola, J., Kaijalainen, T., Raty, R., Ziegler, T., Ronkko, E., Hatakka, K., Korpela, R., Poussa, T., Leinonen, M.,Hovi, T (2006), Presence of viral and bacterial pathogens in the nasopharynx of otitis-prone children A prospective study, Int J Pediatr Otorhinolaryngol, 70(4), pp 647-654 84 Plotkowski, M C., Puchelle, E., Beck, G., Jacquot, J.,Hannoun, C (1986), Adherence of type I Streptococcus pneumoniae to tracheal epithelium of mice infected with influenza A/PR8 virus, Am Rev Respir Dis, 134(5), pp 1040-1044 85 Quin, L R., Carmicle, S., Dave, S., Pangburn, M K., Evenhuis, J P.,McDaniel, L S (2005), In vivo binding of complement regulator factor H by Streptococcus pneumoniae, J Infect Dis, 192(11), pp 1996-2003 86 Regamey, N., Kaiser, L., Roiha, H L., Deffernez, C., Kuehni, C E., Latzin, P., Aebi, C., Frey, U.,Swiss Paediatric Respiratory Research, Group (2008), Viral etiology of acute respiratory infections with cough in infancy: a community-based birth cohort study, Pediatr Infect Dis J, 27(2), pp 100-105 87 Reinert, R R., Paradiso, P.,Fritzell, B (2010), Advances in pneumococcal vaccines: the 13-valent pneumococcal conjugate vaccine received market authorization in Europe, Expert Rev Vaccines, 9(3), pp 229-236 67 88 Richter, S S., Heilmann, K P., Dohrn, C L., Riahi, F., Beekmann, S E.,Doern, G V (2009), Changing epidemiology of antimicrobial-resistant Streptococcus pneumoniae in the United States, 2004-2005, Clin Infect Dis, 48(3), pp e23-33 89 Romero-Steiner, S., Pilishvili, T., Sampson, J S., Johnson, S E., Stinson, A., Carlone, G M.,Ades, E W (2003), Inhibition of pneumococcal adherence to human nasopharyngeal epithelial cells by anti-PsaA antibodies, Clin Diagn Lab Immunol, 10(2), pp 246-251 90 Rosenow, C., Ryan, P., Weiser, J N., Johnson, S., Fontan, P., Ortqvist, A.,Masure, H R (1997), Contribution of novel choline-binding proteins to adherence, colonization and immunogenicity of Streptococcus pneumoniae, Mol Microbiol, 25(5), pp 819829 91 Rudan, I., Boschi-Pinto, C., Biloglav, Z., Mulholland, K.,Campbell, H (2008), Epidemiology and etiology of childhood pneumonia, Bull World Health Organ, 86(5), pp 408-416 92 Sandgren, A., Albiger, B., Orihuela, C J., Tuomanen, E., Normark, S.,HenriquesNormark, B (2005), Virulence in mice of pneumococcal clonal types with known invasive disease potential in humans, J Infect Dis, 192(5), pp 791-800 93 Schultsz, C., Vien le, M., Campbell, J I., Chau, N V., Diep, T S., Hoang, N V., Nga, T T., Savelkoul, P., Stepnieuwska, K., Parry, C., Hien, T T.,Farrar, J J (2007), Changes in the nasal carriage of drug-resistant Streptococcus pneumoniae in urban and rural Vietnamese schoolchildren, Trans R Soc Trop Med Hyg, 101(5), pp 484-492 94 Shann, F., Gratten, M., Germer, S., Linnemann, V., Hazlett, D.,Payne, R (1984), Aetiology of pneumonia in children in Goroka Hospital, Papua New Guinea, Lancet, 2(8402), pp 537-541 95 Shaper, M., Hollingshead, S K., Benjamin, W H., Jr.,Briles, D E (2004), PspA protects Streptococcus pneumoniae from killing by apolactoferrin, and antibody to PspA enhances killing of pneumococci by apolactoferrin [corrected], Infect Immun, 72(9), pp 5031-5040 96 Simell B., Auranen K., Kayhty H., Goldblatt D., Dagan R., et al (2012), The fundamental link between pneumococcal carriage and disease, Expert Rev Vaccines, 11, pp 841-855 97 Simoes, E A F., Cherian, T., Chow, J., Shahid-Salles, S A., Laxminarayan, R.,John, T J (2006), Acute Respiratory Infections in Children, in Disease Control Priorities in Developing Countries, D T Jamison, J G Breman, A R Measham, G Alleyne, M Claeson, D B Evans, P Jha, A Mills, & P Musgrove, Editors.: Washington (DC) 98 Singleton, R J., Hennessy, T W., Bulkow, L R., Hammitt, L L., Zulz, T., Hurlburt, D A., Butler, J C., Rudolph, K.,Parkinson, A (2007), Invasive pneumococcal disease caused by nonvaccine serotypes among alaska native children with high levels of 7valent pneumococcal conjugate vaccine coverage, JAMA, 297(16), pp 1784-1792 99 Sorensen, U B., Agger, R., Bennedsen, J.,Henrichsen, J (1984), Phosphorylcholine determinants in six pneumococcal capsular polysaccharides detected by monoclonal antibody, Infect Immun, 43(3), pp 876-878 68 100 Sorensen, U.B.S., Henrichsen, J., Chen, H.C & Szu, S.C (1990), Covalent linkage between the capsular polysaccharide and the cell wall peptidoglycan of Streptococcus pneumoniae revealed by immunochemical methods, Microb Pathog, 8, pp 325-334 101 Spratt, B G.; Hanage, W P.; Brueggemann, A B (2004), Evolutionary and population biology of Streptococcus pneumoniae, Washington (D C): ASM Press, pp 119-135 102 Talbot, U M., Paton, A W.,Paton, J C (1996), Uptake of Streptococcus pneumoniae by respiratory epithelial cells, Infect Immun, 64(9), pp 3772-3777 103 Tomasz, A (1981), Surface components of Streptococcus pneumoniae, Rev Infect Dis, 3(2), pp 190-211 104 Tseng, H J., McEwan, A G., Paton, J C.,Jennings, M P (2002), Virulence of Streptococcus pneumoniae: PsaA mutants are hypersensitive to oxidative stress, Infect Immun, 70(3), pp 1635-1639 105 Thomas R Larson., Janet Yother (2017), Streptococcus pneumoniae capsular polysaccharide is linked to peptidoglycan via a direct glycosidic bond to β-D-Nacetylglucosamine, PNAS 106 Van Dam, J E., Fleer, A.,Snippe, H (1990), Immunogenicity and immunochemistry of Streptococcus pneumoniae capsular polysaccharides, Antonie Van Leeuwenhoek, 58(1), pp 1-47 107 Wartha, F., Beiter, K., Albiger, B., Fernebro, J., Zychlinsky, A., Normark, S.,Henriques-Normark, B (2007), Capsule and D-alanylated lipoteichoic acids protect Streptococcus pneumoniae against neutrophil extracellular traps, Cell Microbiol, 9(5), pp 1162-1171 108 Watson, D A., Musher, D M., Jacobson, J W.,Verhoef, J (1993), A brief history of the pneumococcus in biomedical research: a panoply of scientific discovery, Clin Infect Dis, 17(5), pp 913-924 109 Weinberger, D M., Malley, R.,Lipsitch, M (2011), Serotype replacement in disease after pneumococcal vaccination, Lancet, 378(9807), pp 1962-1973 110 Whatmore, A M., King, S J., Doherty, N C., Sturgeon, D., Chanter, N.,Dowson, C G (1999), Molecular characterization of equine isolates of Streptococcus pneumoniae: natural disruption of genes encoding the virulence factors pneumolysin and autolysin, Infect Immun, 67(6), pp 2776-2782 111 Winkelstein, J A (1981), The role of complement in the host's defense against Streptococcus pneumoniae, Rev Infect Dis, 3(2), pp 289-298 112 World Health Organization (1999), Bacterial etiology of serious infections in young infants in developing countries: results of a multicenter study The WHO Young Infants Study Group, Pediatr Infect Dis J 113 World Health Organization (November 2009), The global burden of disease: 2004 update 114 Yother, J (2004), The Pneumococcus, Washington (D C): ASM Press, pp 30-48 69 115 You, D., Wardlaw, T., Salama, P.,Jones, G (2010), Levels and trends in under-5 mortality, 1990-2008, Lancet, 375(9709), pp 100-103 PHỤ LỤC Phụ lục 1: Công thức pha môi trường STGG (cho 100ml) Khố i lƣơ ̣ng Thành phần 2g Skim Milk 3g Tryptic soy broth (TSB) 0,5g Glucose 10ml Glycerol Đủ 100ml Nƣớc cấ t Bƣớc 1: Trô ̣n tất thành phần Bƣớc 2: Chia vào ố ng ly tâm 2ml có nắ p xoáy, vă ̣n hờ nắ p Bƣớc 3: Sấ y các ố ng chƣ́a môi trƣờng ở 121oC 15 phút Bƣớc 4: Sau lấ y các ố ng môi trƣờng khỏi lò , để nguội, vă ̣n chă ̣t nắ p Bƣớc 5: Cấ t giƣ̃ ở 4oC 70 Phụ lục 2: Đinh ̣ nghiã ca bênh ̣ ARI theo WHO Phụ lục 3: Các cặp mồi sử dụng phương pháp PCR xác định týp huyết của phế cầ u Mồ i Trình tự (5’-3’) CPSA-F Set GCAGTACAGCAGTTTGTTGGACTGACC CPSA-R GAATATTTTCATTATCAGTCCCAGTC 14-F GAAATGTTACTTGGCGCAGGTGTCAGAATT 14-R GCCAATACTTCTTAGTCTCTCAGATGAAT 6-F AATTTGTATTTTATTCATGCCTATATCTGG 6-R TTAGCGGAGATAATTTAAAATGATGACTA 19F-F GTTAAGATTGCTGATCGATTAATTGATATCC 19F-R GTAATATGTCTTTAGGGCGTTTATGGCGATAG 23F-F GTAACAGTTGCTGTAGAGGGAATTGGCTTTTC 23F-R CACAACACCTAACACACGATGGCTATATGATTC 11-F GGACATGTTCAGGTGATTTCCCAATATAGTG 11-R GATTATGAGTGTAATTTATTCCAACTTCTCCC Set CPSA-F CPSA-R Nồ ng đô ̣ ć i cùng (µM) Kích thƣớc (bp) 0.1 160 0.3 189 0.3 250 0.3 304 0.5 384 0.5 463 0.1 71 160 10F/C/33C-F GGAGTTTATCGGTAGTGCTCATTTTAGCA 10F/C/33C-R CTAACAAATTCGCAACACGAGGCAACA 34-F GCTTTTGTAAGAGGAGATTATTTTCACCCAAC 34-R CAATCCGACTAAGTCTTCAGTAAAAAACTTTAC 15B/C-F TTGGAATTTTTTAATTAGTGGCTTACCTA 15B/C-R CATCCGCTTATTAATTGAAGTAATCTGAACC 19A-F GTTAGTCCTGTTTTAGATTTATTTGGTGATGT 19A-R GAGCAGTCAATAAGATGAGACGATAGTTAG Set CPSA-F CPSA-R 1-F CTCTATAGAATGGAGTATATAAACTATGGTTA 1-R CCAAAGAAAATACTAACATTATCACAATATTGGC 5-F ATACCTACACAACTTCTGATTATGCCTTTGTG 5-R GCTCGATAAACATAATCAATATTTGAAAAA GTATG 4-F CTGTTACTTGTTCTGGACTCTCGATAATTGG 4-R GCCCACTCCTGTTAAAATCCTACCCGCATTG 18-F CTTAATAGCTCTCATTATTCTTTTTTTAAGCC 18-R TTATCTGTAAACCATATCAGCATCTGAAAC 17F-F TTCGTGATGATAATTCCAATGATCAAACAAGAG 17F-R GATGTAACAAATTTGTAGCGACTAAGGTCTGC Set 0.2 0.3 0.5 0.1 CPSA-F CPSA-R 7B/C-F CTATCTCAGTCATCTATTGTTAAAGTTTACGACGGGA 7B/C-R GAACATAGATGTTGAGACATCTTTTGTAATTTC 3-F ATGGTGTGATTTCTCCTAGATTGGAAAGTAG 3-R CTTCTCCAATTGCTTACCAAGTGCAATAACG 9N/L-F GAACTGAATAAGTCAGATTTAATCAGC 9N/L-R ACCAAGATCTGACGGGCTAATCAAT 10A-F GGTGTAGATTTACCATTAGTGTCGGCAGAC 10A-R GAATTTCTTCTTTAAGATTCGGATATTTCTC 9V/A-F GGGTTCAAAGTCAGACAGTGAATCTTAA 9V/A-R CCATGAATGAAATCAACATTGTCAGTAGC Set 0.7 0.7 0.3 0.5 0.1 CPSA-F CPSA-R 35A/C-F ATTACGACTCCTTATGTGACGCGCATA 35A/C-R CCAATCCCAAGATATATGCAACTAGGTT 12-F GCAACAAACGGCGTGAAAGTAGTTG 12-R CAAGATGAATATCACTACCAATAACAAAAC 22A/F-F GAGTATAGCCAGATTATGGCAGTTTTATTGTC 22A/F-R CTCCAGCACTTGCGCTGGAAACAACAGACAAC 0.2 0.2 0.2 0.3 0.1 72 0.2 0.3 0.3 248 408 496 566 160 280 362 430 573 693 160 260 371 516 628 816 160 280 376 643 23A-F TATTCTAGCAAGTGACGAAGATGCG 23A-R CCAACATGCTTAAAAACGCTGCTTTAC Set 722 CPSA-F CPSA-R 21-F CTATGGTTATTTCAACTCAATCGTCACC 21-R GGCAAACTCAGACATAGTATAGCATAG 33F-F GAAGGCAATCAATGTGATTGTGTCGCG 33F-R CTTCAAAATGAAGATTATAGTACCCTTCTAC 20-F GAGCAAGAGTTTTTCACCTGACAGCGAGAAG 20-R CTAAATTCCTGTAATTTAGCTAAAACTCTTATC 35B-F GATAAGTCTGTTGTGGAGACTTAAAAAGAATG 35B-R CTTTCCAGATAATTACAGGTATTCCTGAAGCAAG Set 160 0.1 CPSA-F CPSA-R 6-F AATTTGTATTTTATTCATGCCTATATCTGG 6-R TTAGCGGAGATAATTTAAAATGATGACTA 6C/D-F CATTTTAGTGAAGTTGGCGGTGGAGTT 6C/D-R AGCTTCGAAGCCCATACTCTTCAATTA 192 0.2 338 0.3 514 0.5 677 1,2 160 0.1 250 0.2 727 0.5 Phụ lục 4: Bảng mẫu ghi nhận kết quả MIC Ngày:……MIC - S.pneumoniae Loại Kháng sinh: TT Mẫu 16 15 0.004 0.008 14 13 12 11 10 0.016 0.032 0.064 0.128 0.256 10 11 12 13 14 73 0.512 1 16 32 64 128 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 74 ... KHOA HỌC TỰ NHIÊN Lê Thị Kim Anh NGHIÊN CỨU SỰ LƢU HÀNH CỦA CÁC TÝP HUYẾT THANH VÀ TÍNH NHẠY CẢM KHÁNG SINH CỦA CÁC CHỦNG PHẾ CẦU GÂY VIÊM ĐƢỜNG HÔ HẤP CẤP Ở TRẺ EM NHẬP VIỆN TẠI BỆNH VIỆN ĐA. .. pneumoniae trẻ em bị viêm đƣờng hô hấp cấp nhập viện Bệnh viện đa khoa tỉnh Khánh Hòa Xác định phân bố týp huyết chủng phế cầu gây bệnh viêm đƣờng hô hấp cấp trẻ em nhập viện Bệnh viện đa khoa tỉnh Khánh. .. thực đề tài: ? ?Nghiên cứu lƣu hành týp huyết tính nhạy cảm kháng sinh chủng phế cầu gây viêm đƣờng hô hấp cấp trẻ em nhập viện Bệnh viện đa khoa tỉnh Khánh Hòa? ?? MỤC TIÊU CỦA NGHIÊN CỨU Xác định