Nghiên cứu genotype của human papillomavirus trên một số ung thư sinh dục nữ tt tieng anh

MINISTRY OF EDUCATION AND TRAINING NGUYEN THI PHUONG MAI STUDYING HUMAN PAPILLOMAVIRUS GENOTYPE ON SOME FEMALE GENITAL CANCERS Major: Biochemistry Code: 62720112 ABSTRACT OF MEDICAL DOCTERAL THESIS HA NOI – 2020 Thesis has been completed at: HA NOI MEDICAL UNIVERSITY Supervisors: Prof PhD Ta Thanh Van Reviewer 1: Assoc Prof PhD Pham Van Tran Reviewer 2: Assoc Prof PhD Phan Quoc Hoan Reviewer 3: Assoc Prof Tran Nhu Duong The thesis will be present in front of the Board of university examiner and reviewer Held at: Hanoi Medical University at ., th August, 2020 This thesis can be found at: National Library Library of Hanoi Medical University GENERAL Cervical cancer (CC) is the most common cancer, ranking the 3rd in the incidence and death among female cancers Vaginal cancer (VC) and vaginal cancer (VAC) are two less common types of cancer, with 10 times lower incidence and death than CC The previous studies shown that about 90% of cervical, 66% of VAC and 60% of VC tissue are infected by HPV Vaccines for the prevention of HPV6, 11, 16 and 18 infection through preventing the L1 protein of HPV from identifying by host cells have been used in Vietnam The E6E7 HPV16 vaccine treats CIN (Cervical Intraepithelial Neoplasia) lesions caused by HPV infection by increasing the responsiveness of immune cells being studied and used around the world Previous research published HPV52 is the most common at Vietnamese prostitutes Is the HPV vaccine in the Vietnamese market capable of preventing HPV types in CC, VC and VAC? Moreover, the study expected to provide database on HPV16E6 and E7 variants in different types of cancer cells as well as for the vaccine strategy for prevention cancer caused by HPV infection For the above reasons, the “studying Human Papillomavirus genotype on some female genital cancers" was conducted with two objectives: Identify HPV genotype in CC, VAC, VC tissues Assess the relationship between genotype of HPV and the type of cell at cancer tissue The urgency of the study: Commercial vaccines currently circulating in Vietnam are only capable of preventing HPV6, 11, 16 and 18 HPV infection Announcement from the identification of HPV16, 18 by two pairs of specific primers E6, E7 for HPV 6, 11, 16, 18 on paraffin block of cervical tissue did not indicate the exact distribution of HPV genotype Published from a group of Vietnamese and Japanese scientists indicated that HPV52 is the most common at the cervix of prostitutes So far, the issue of authentic genotype distribution of HPV in cervical tissue, VC, VAC has not been clarified Therefore, we conduct research on this topic New contributions of the thesis The study indicated the exact distribution of HPV genotype in genital cancer tissues HPV16 infection accounted for the highest proportion (43.5%) followed by HPV18 (23%), coinfection with HPV16, 18 (16.2%); HPV52 infection accounts for only 4.2% Lineage European accounted for 94% (94/100) of HPV16 infection cases; Asian sublineage accounted for the highest percentage, 80% (80/100); European prototype - 14%, Asian-American a - 5% and African 2-1% Epithelial cancer accounted for 99.5% (213/214) of female genital cancer cases, in which, squamous cell cancer accounted for the highest proportion (79.8% -170 / 213) Asian Sublineage of HPV16 appeared in all types of epithelial cancer cells and in squamous cell cancer accounted for 90% Squamous cell carcinoma were infected with all subtypes of HPV16, Asian sublineage accounted for 78.3% Layout of the thesis - The thesis is presented with 111 pages including: pages of general, 36 pages of literature review, 15 pages of research object and method, 33 pages of results, 23 pages of discussion, pages of conclusion, and a page of recommendation - The thesis had 21 tables, 32 pictures, 166 references arranged in the order of appearance in the thesis Chapter I LITERATURE REVIEW 1.1 Human Papillomavirus Human Papillomavirus is a virus that transmitted by direct contact, especially through sex The DNA double strand of HPV is about 8000 bp long, including 02 late genes (late) L1, L2; 06 genes early (early) E1, E2, E4, E5, E6, E7 HPV is classified according to its structure and risk The DNA sequence of L1 is 10% different from the nearest known type called new HPV type; lineage if the difference is 1-10%, sublineage if the difference is 0.5-1% According to their ability to cause disease, HPV is divided into groups: high-risk groups (including HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 73 and 82), probably cause cancer (including HPV26, 53 and 66), low-risk group (HPV6, 11, 40, 42, 43, 44, 54, 61, 70, 72, 81 and CP6108) HPV16 is again sub-grouped into European lineage including the European prototype sublineage (with variants of E-T350 and E-G350), Asian sublineage (mutations T178 with AS-a, As-b, As-c) NonEuropean lineage includes Asian American sublineage (AA) (with mutations G145T and T350G) and African sublineage (Af1) (including mutations C143G and G145T); African (Af2) has mutations C143G, G145T and C335T After entering the basal epithelial cell layer, DNA virus transformed into the host chromosome, E6 and E7 proteins were expressed, inhibited tumor suppressor proteins pRb and p53 At this stage, HPV was synthesized with low quantity At the epidermis, L1 and L2 proteins are expressed to produce complete viral particles released Those released from host by desquamation of the epithelial cell The "zinc finger" (amino acids 33-63, 109-139) on the E6 HPV16 gene, the conserved region (amino acids 37-49 and 116-137) on the E7 gene of HPV16 are related to p53, pRb The positions D25, L83 on E6 belong to the identification area of the immune system International publications showed that most HPV is removed after years of infection; HPV16, HPV18, HPV31, HPV33 persist in CIN dysplastic tissue and cancer 1.2 Female genital cancer In 2018, the WHO classified the anatomy of female genital cancer (GFC) into: epithelial carcinoma (including squamous cell carcinoma, adenocarcinoma and other carcinoma (carcinoma) basal, squamous cell carcinoma, vitreous cell cancer, endocrine neurological cancer )), melanoma and others Epithelial carcinoma relates to HPV, melanoma is not related to HPV High levels of NO and nitro from inflammatory reactions insert some nucleotides in the DNA sequence causing the DNA sequence to break or form cross-linking between the two single strain The increase in copies of E6 and E7 genes of HPV16 significantly reduces p53 and pRb proteins, reduces cell death, increases mutation frequency, destabilizes host cell genome The transformation of E6 and E7 genes into the host chromosome leads to more severe lesions, even in-stu and invasive cancers Operation combines chemotherapy or radiation therapy is the most common method of treating CC, VC, VAC The L1HPV vaccination prevent HPV 6, 11, 16 and 18 infection, reducing the incidence of cervical dysplasia at CIN2 and CIN3 levels E7HPV16 vaccine therapy effectively reduced CIN3 cervical dysplasia, to CIN2 after weeks of treatment, reduced VAIN2 vaginal dysplasia diameter by 40% 1.3 Domestic, foreign research and HPV related pathologies Results from previous studies showed that the prevalence of HPV in the community is not high ( 80% with HPV16 is common) Sublineage European – prototype of HPV16 is common in CC patients in Italy and Morocco, Northeast Chinese; Philippian prostitutes Sublineage Asian of HPV16 is common among CC patients in Thailand and Japanese prostitutes Similarly, in Vietnam, the incidence of HPV infection in cervix increased from the community (6.110, 2%) to northern prostitutes (49.5% with common HPV52), CC (84.4% for HPV6, 11, 16, 18 and HPV16 are common) Asian Sublineage of HPV16 is common among Vietnamese prostitutes (95.8%) HPV infection in precancerous lesions (80-95%) is higher than that in VC (30-60%) and VAC (50-75%) However, HPV16 is still the most common; HPV18 is not the second most common type in both VC and VAC tissue Squamous cell cancer accounts for the highest percentage at FGC tissue Adenocarcinoma is the second in CC, VAC; and basal cell carcinoma is second in VC The prevalence of HPV and HPV16 at squamous cell carcinoma always predominates over adenocarcinoma and adeno-squamous carcinoma cell 1.4 Techniques for detection, identification of genotypes of HPV and histopathological testing PCR technique of amplifying 140 bp gene segment of L1 using GP5+/6+ primers, has detected many types of HPV such as 6, 11, 16, 18, 31, 33, 35, 39, 40, 42, 45, 51, 54, 56, 58, 59, 66, 68, 70, and 74 MGP5+/6+ modified primer is replaced a nucleotide and increased in size to 10 bp compared to the original primer, which increases detection High-risk HPV (from 0.7 to 17.2%) The primer pairs GP5 +/6+and MGP5+/6+; HPV16-E6 and HPV16-E7 published from previous studies Genoarrays- hybridization technology detects 15 high-risk HPVs (HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68) and low-risk HPVs (6, 11, 42, 43, 44, CP8304 (81)) Histopathological test is a diagnostic test that identifies the type of injury The tissue after paraffin embedding was coldcut, HE stained and observed under a microscope objective 100 Chapter SUBJECTS AND RESEACHMETHODOLOGY 2.1 Subject of research The subjects of the study were 214 patients with cervical cancer, VC, and VAC at the Department of Clinic, National Cancer Hospital; Department of Surgery 1, Ho Chi Minh City Oncology Hospital; Department of Anaphathology, National Obstetrics and Gynecology Hospital Patients were selected according to criteria: primary CC, VC, VAC; can have 01, 02 or all CC, VC, VAC; have not been treated with chemicals or radiation therapy; be diagnosed with cancer by histopathological results Patients with secondary or primary CC, VC, VAC but undergoing radiotherapy or chemotherapy will not be included in the study 2.2 Method of research: Cross-sectional descriptive studies were collected by convenient sampling Indicators in the study included: age information; results of type of cancer cell; results of HPV infection rate, HPV genotype, lineage, sublineage E6, E7 of HPV16 2.3 Location and study time * Location for sample analysis Faculty of Medicine, Kanazawa University, Japan; Gene and Protein Research Center, Hanoi Medical University * Research time: from June 2013 to October 2018 2.4 Equipment, chemicals: from Sigma-Alderich (Germany), Hydri-bio (Hong Kong), Applied Biosystems 2.5 Research process * DNA extraction from tissue samples: using proteinase K and phenol enzymes, chloroform, isoamyl alcohol * Amplifying the L1 gene of HPV to detect HPV infection Nucleotide sequence of primer pairs: Forward primer GP5+: tttgttactgtggtagatactac Reverse primer GP6+: cttatactaaatgtacaaataaaaag Forward primer GP5+M1: tttRactgttgtWgatactac Forward primer GP5+M2: tgtWactgttgtWgataccac Forward primer GP5+M3: gtWactgttgtRgacaccac Reverse primer GP6+M1: cttatactWaatgtcaaataWaaagttaa Reverse primer GP6+M2: cttaWactaaatgtYaaatacaaag Reverse primer GP6+M3: ctcaWactaaacgtYaaataaaaag Reaction components 30μL: Buffer 10X-3.0 μL; NTPs 2mM: 3.0μL; MgCl2 25mM: 4.2μL; primer: 0,375μL (for GP5+/6+) / 0.3μL (for MGP5+/6+); Amq Gold Amplifier 5U/µL0.3μL; distilled water: 16,125μL (for GP5+/6+)/ 16,2 μL (for MGP5+/6+); Template DNA: 3.0μL Thermal reaction cycle: 94oC - 10 minutes; 45 cycles [94oC - 45 seconds, 48oC - seconds, 38oC - 30 seconds, 42oC - seconds; 66oC - seconds for GP5+/6+; and 95oC - 30 seconds, 45oC - 30 seconds for MGP5+/6+); 71oC - 90 seconds; store samples at 4°C *Electrophoresis to identify L1 gene products after amplification: using a 100bp ladder marker on 2% agarose gel, ethidium bromide-stained DNA bands and photographed by EC3 Imaging system *L1 gene sequencing to identify products after amplification Primer: GP5+/6+ Reaction component 20μL: Big Dye term.V3.1 (2.5X): 1.0μL; Big Dye buffer 5X: 3.5μL; priming (5 pmol/µL): 1.5μL; Distilled water: 12.0 μL; Purified PCR products: 2.0μL Thermal reaction cycle: 96oC - minutes; 25 cycles [95 oC 10 seconds, 50oC - seconds]; 60oC - minutes; store the sample at ° C protected from light * Hybrid technology on genoarrays Amplification of L1 HPV gene with nucleotide biotinization Reaction component 25µL: Master mix PCR -23,25µL; DNA Taq polymerase: 0.75µL; Mold DNA: 1µL 10 Thermal reaction cycle: 96oC - minutes; 40 cycles [96oC 20 seconds, 55oC - 30 seconds]; 72oC - 30 seconds; Store samples at 4°C Hybrid on membrance * Identify lineage of HPV16 Amplification of genes E6, E7 of HPV16: The sequence of primer: Forward primer HPV16-E6: gaaatcggttgaaccgaaac Reversed primer HPV16-E6: acctctatgtggatgtaacg Forward primer HPV16-E7: gaccggtcgatgtatgtcttg Reversed primer HPV16-E7: cttctcccatgccctacattac Reaction component 40μL: buffer 10X: 4.0 μL; dNTPs 2mM: 4.0μL; MgCl2 25mM: 5.6μL; bait: 1.0μL; DNA Taq polymerase: 0.4; distilled water: 20μL; Mold DNA: 4.0μL Thermal reaction cycle: 95oC - 10 minutes; 40 cycles [95oC - 30 seconds, 50oC for E6 / 53oC for E7 - 30 seconds]; 72oC 45 seconds; Store samples at 4°C Electrophoresis identifies the product with using a 100bp ladder marker on 2% agarose gel Genome sequencing E6, E7 by primers E6, E7 of HPV16; The sequence of genes E6 and E7 was compared with the sequence on Genebank 2.6 Data processing Using Bioedit and MEGA software to analyze gene sequences; Chi-square statistical algorithm of SPSS 20.0 software to compare the genotype of HPV with the type of cell damage in cancer tissue 2.7 Ethics in research: approved by the Medical Ethics Council of Hai Phong Medical University according to the Decision No 7/2011 HDĐ-YHP 2.8 Fund for project : supported by Government project’s funding: "Collaborating on researching the prevalence and distribution of Human Papillomavirus genotype on some cancers at the North of Vietnam" 14 sublineage (83.3% -5/6) and the African sublineage (16.7% -1/6) There were 14 nucleotides mutations at E6 gene and ones at E7 gene (Table 3.3) Table 23: The distribution of nucleotide mutation and amino acid changed at HPV16E6, E7 gene Lineage European Sublineage European prototype Asian NonEuropean n E350T E350G (5) E350T (9) Asian a (44) Asian b (36) Asian-American (5) African2 (1) HPV16E6 gene Ref 1 40 1 1 35 1 G T C G G T T G A - T G G G G G A A - *Nucleotide 1 2 8 7 A T A T C - - - - - - - - - - G - - - - - - - G - - G - - - - - - - - - - - - - G - - - - - - - HPV16E7 gene Acid amin G A - C G - 3 C T T T G G G G - A T - I27L/L83V L83V L83V N58S D25E D25E/I27R D25E/I27R/D64N D25E/S71C D25K D25E D25E/N58K/E89D Q14H/H78Y/L83V R10L/Q14D/H78Y *Nu 7 G A C G G G G G G Ref: sequence of genes E6, E7 refer to download from Genbank, code HQ644236, *: Nucleotide sequence corresponding to positions: 132, 143, 145, 176, 178, 182, 183, 276, 277 , 293, 315, 350, 370 at E6 and 571, 647 at E7 gene A a D4H N29S N29S N29S N29S N29S N29S 15 Comment: At E6 gene, 80% (80/100) mutations at the 178 th nucleotide belonged to Asian sublineage, lead to the replacement of Aspartate by Glutamate or Lysin (D25E, D25K) Sublineage European prototype with mutation at the 350th nucleotide lead to the replacement of Leucin by Valine (L83V) appeared 5% (5/100) Sublineage Asian American appeared two more nucleotide mutations 145, 315 There were mutations at one case with replacing nucleotides at position 132 143, 145, 335 lead to change the 10th amino acid Arginine to Isoleucine , the 14th Glutamine to Aspartic and the 78th Histidine to Tyrosine at sublineage African2 There was no nucleotide mutations at positions 350, 178, 350 and 355 at sublineage E-350T At E7 gene, there were mutations at the 571 st nucleotide (1% -1/100) and the 647th (45%-45/100) lead to change Aspartat to Histidin at the 4th and Asparagin to Serin at the 29th of E7 gene 3.3 Relationship between HPV genotype and cancer cell type 3.3.1 Cell type at cancerous tissue There were two types of cancer cells including epithelial carcinoma (99.5% -213 / 214) and melanoma (0.5%) Squamous cell carcinoma accounted for - 79.8% (170/213), adenocarcinoma accounted for 12.7% (27/213) Other cancer cells such as adeno-squamous carcinoma, glasses cell carcinoma, endocrine neurons carcinoma, basal cells carcinoma also appeared 7.5% (4/213) 16 Figure 3.4: Distribution of cancer cell type at FGC tissue Comment: squamous cell carcinoma accounted for 78.8% (148/188) and 95.6% (22/23) at CC and VC Adenocarcinoma was less common at CC (13.8% -26/188) and did not appear at VC but occurred in of VAC tissue 3.3.2 Relationship between HPV genotype and cancer cell type 3.3.2.1 Relationship between HPV infection prevalence and cancer cell type All of the HPV-infected patients had epithelial carcinoma (172/172) Patients with melanoma was not infected HPV Table 3.4: Relationship between HPV infection and epithelial carcinoma type HPV infection Squamous cell carcinoma HPV positive n=172 HPV negative (n=41) Total (n=213) 140 30 170 AdenoOther carcinoma carcinoma cell 19 13 27 16 p 0,34 Comment: HPV, 81.4% (140/172) of squamous cell cancer patients; 11% (19/172) of adenocarcinoma and 7.5% (13/172) of other cell cancers were infected HPV 3.3.2.2 Relationship between HPV genotype and cancer cell type 17 Table 3.5: Relationship between HPV genotype and epithelial carcinoma cell type HPV infection Squamous cell carcinoma HPV16 (n = 83) HPV16.18 (n =31) HPV18 (n = 44) Other type (n =14) Total (n =172) 76 23 28 13 140 AdenoOther p carcinoma carcinoma cell 0,007 10 19 13 Comments: HPV16, HPV18 and HPV16.18 were the highest infection prevalence at squamous cell carcinoma There was statistically significant difference between prevalence of HPV16 and HPV18 infection at squamous cell carcinoma and adenocarcinoma, other carcinoma cell at p = 0.007 (