Dromedary milk exosomes as mammary transcriptome nano-vehicle: Their isolation, vesicular and phospholipidomic characterizations

Exosomes are extracellular nanovesicles that play a role in cellular trafficking and communication. Camel milk exosomes might carry the potential of recovery of several illnesses that coins the dromedary milk. This study shows for the first time their isolation and fine characterization. The differential ultracentrifugation was used for their isolation. Their recovery from dromedary milk during different lactation periods was evaluated. The vesicular characterization and stability testing of the recovered exosome were examined by transmission electron microscopy (TEM). The proteome footprinting was resolved by gel electrophoresis prior to their specific protein biomarker analysis. The immunoblotting of their specific protein biomarker TSG101 unexpectedly revealed a truncated 35 KDa protein specific for dromedary milk exosome rather than the previously reported 43 KDa mammalian one. The reversed-phase HPLC screening of their phospholipid makeup was compared with that of cattle milk exosomes at different lactation periods. Since dromedary milk exosomes reflect their mammary transcriptome outcome, further assessment of their content of as1casein, as2casein b-casein j-casein mRNAs parallel with a constitutive glyceraldehyde dehydrogenase (GAPD) gene was performed using real-time PCR. The TEM scanning indicated that dromedary milk exosomes are freeze-stress unstable homogeneous with average size of 30 nm. There was no significant difference in expression level of different casein genes in mid lactation period in dromedary milk exosomes over late lactation period. The phospholipidomic survey proved that phosphatidylcholine is the major candidate of the examined phospholipids in dromedary milk exosomes. The obtained data give novel interpretation about the content of camel milk exosomes with possible insight for use as potentially-safe nano carrier.

Journal of Advanced Research (2016) 7, 749–756 Cairo University Journal of Advanced Research ORIGINAL ARTICLE Dromedary milk exosomes as mammary transcriptome nano-vehicle: Their isolation, vesicular and phospholipidomic characterizations Aya M Yassin a, Marwa I Abdel Hamid a, Omar A Farid b, Hassan Amer a, Mohamad Warda a,* a Biochemistry and Chemistry of Nutrition Department, Biotechnology Center for Services and Researches, Faculty of Veterinary Medicine, Cairo University, 12211 Giza, Egypt b National Organizations for Drug Control and Research (NODCAR), Giza, Egypt A R T I C L E I N F O Article history: Received July 2015 Received in revised form 27 October 2015 Accepted 27 October 2015 Available online November 2015 Keywords: Dromedary Milk Exosomes Transcriptome Proteome Phospholipids A B S T R A C T Exosomes are extracellular nanovesicles that play a role in cellular trafficking and communication Camel milk exosomes might carry the potential of recovery of several illnesses that coins the dromedary milk This study shows for the first time their isolation and fine characterization The differential ultracentrifugation was used for their isolation Their recovery from dromedary milk during different lactation periods was evaluated The vesicular characterization and stability testing of the recovered exosome were examined by transmission electron microscopy (TEM) The proteome footprinting was resolved by gel electrophoresis prior to their specific protein biomarker analysis The immunoblotting of their specific protein biomarker TSG101 unexpectedly revealed a truncated 35 KDa protein specific for dromedary milk exosome rather than the previously reported 43 KDa mammalian one The reversed-phase HPLC screening of their phospholipid makeup was compared with that of cattle milk exosomes at different lactation periods Since dromedary milk exosomes reflect their mammary transcriptome outcome, further assessment of their content of as1casein, as2casein b-casein j-casein mRNAs parallel with a constitutive glyceraldehyde dehydrogenase (GAPD) gene was performed using real-time PCR The TEM scanning indicated that dromedary milk exosomes are freeze-stress unstable homogeneous with average size of 30 nm There was no significant difference in expression level of different casein genes in mid lactation period in dromedary milk exosomes over late lactation period The phospholipidomic survey proved that phosphatidylcholine is the major candidate of the examined phospholipids in dromedary milk exosomes The obtained data give novel interpretation about the content of camel milk exosomes with possible insight for use as potentially-safe nano carrier Ó 2015 Production and hosting by Elsevier B.V on behalf of Cairo University This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/ 4.0/) * Corresponding author Tel.: +20 1062368347, +20 35720399; fax: +20 35725240, +20 35710305 E-mail addresses: maawarda@eun.eg, maawarda@hotmail.com (Mohamad Warda) Peer review under responsibility of Cairo University Production and hosting by Elsevier http://dx.doi.org/10.1016/j.jare.2015.10.003 2090-1232 Ó 2015 Production and hosting by Elsevier B.V on behalf of Cairo University This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/) 750 Introduction Exosomes are naturally occurring, membranous nanovesicles of 30–100 nm in diameter [1] They are widely produced by cells of different origins with divergent functions [2] and being identified in various biological fluids [3] including milk [4] Exosomes harbor different biomolecules including nucleic acids such as miRNA, small non-coding RNA and mRNA which reflect their cellular origin [5] The molecular characterization of exosome exerts potential biomarker of the disease such as cancer; therefore, their potential roles in different physiological activities and cellular communication are currently under investigation [6,7] Their nucleic acids can be translated into functional protein or regulate the activity of gene The cell-to-cell communication by exosome-mediated transfer of genetic information was first addressed by Valadi et al [8] and was later confirmed by other authors detailing their role in neonate genome modulation [9] In the same way, commercial milk has recently proved to contain stable exosome that remains intact in the gastrointestinal tract and exert an immunoregulatory effect [10] In contrast to their microRNA compromised effects in development of age-related disorders such as obesity, type diabetes mellitus, cancer, and neurodegenerative diseases [11], cow milk exosomes ameliorate experimental arthritis on oral delivery [12] Despite the presence of RNAase activity, these physically stable vesicles might exert trans-species transcriptome modulation by acting as cargo for various RNA types in bovine milk [13] In addition to physical stability, the comparative proteomics evaluation of human plasma exosome revealed their long lasting ability of preserving their biological activity [14] These facts could be attributed to the unique phospholipid makeup in these lipid-enriched nanovesicles [15] Camel milk, on the other hand, is gaining increased recognition due to its beneficial effects in control and prevention of multiple health problems [16] It is believed to mitigate several pathological illnesses including diabetes [17], different types of hepatitis [18] and even neurodevelopmental disorders [19] Fresh camel milk consumption is extensive in Arabic countries where diabetes prevalence is very high [20] Despite these facts, the characterization of dromedary milk exosomes as potential contributor in the observed effects has not been fully recovered Therefore, this is the first initiative investigation to isolate and characterize the dromedary milk exosomes during different lactation periods The methods of isolation were evaluated The proteomics, lipidomic and transcriptomic profiling of isolated exosomes were then resolved The physical stability of isolated exosomes as a function of time was observed Material and methods Animals The experimental use of the animals and all the procedures were approved by the Animal Ethics Committee of the Veterinary Medicine Faculty, Cairo University The study was performed between autumn of 2013 and winter of 2014 Clinically healthy lactating she-camels bred in national local farm were used Milk samples (40–50 mL) were collected at mid and late lactation periods (6 samples from different animals for each period) The mid lactation A.M Yassin et al period was considered from 100 to 200 days in milk; however the late lactation period was after 200 days in milk Isolation of dromedary milk exosomes Milk exosomes were isolated by differential ultracentrifugation modified after Thery et al [21] Briefly, freshly milk samples (25 mL each) were centrifuged at 2000g for 20 at °C to get rid of particulate debris and fat globules Ten mL of the defatted milk supernatant was centrifuged for 30 at 10.000g at °C to obtain supernatant milk serum Five mL from the later was re-centrifuged for 70 at 100.000g (SW 55Ti rotor; Beckman Coulter Instruments, Fullerton, CA, USA) at °C to pellet the crude exosomes The pellet was then suspended in mL PBS and re-centrifuged as the previous step and the recovered exosomal pellet was re-suspended in minimum volume of PBS buffer to keep the suspension and either freshly used or stored at À20 °C until further analyses The validation of this method was assisted by parallel separation of milk exosome from milk serum using commercial standard method for serum exosome isolation (InvitrogenTM, Carlsbad, CA, USA, Cat # 4478360) Both methods gave similar yield with no significant difference in their protein contents or TEM size detection (Data not shown) Exosome characterization and stability testing by TEM negative staining The morphology and particle size of the camel milk exosomes were examined using TEM according to Mokarizadeh et al [22] A 10 lL of exosomes suspension was loaded on an amorphous carbon coated- copper grid Negative staining was performed by addition of 10 lL of neutral 1% aqueous phosphotungestic acid The grid was then examined for the exosomes by TEM (Tecnai G20, FEI, Netherland) operating at an accelerating voltage of 80 kV For stability testing, the recovered fresh exosomes were subjected to times of short thawing cycles (4 °C for 20 each) while being deepfreezed (À40 °C) for weeks prior to TEM scanning SDS–PAGE and western blot analysis The exosomal pellets recovered from the previous isolation step were subjected to SDS–PAGE electrophoresis followed by specific exosomes biomarker immune-probing Generally, the recovered pellets were resuspended in lowest amount of lysis buffer (10% RIPA buffer in PBS) to give the desired protein concentration on gel loading and not to interfere with the next protein determination step using Bradford’s assay [23] Samples for electrophoresis were then diluted in 2Â Laemmli sample buffer with DTT (final concentration 100 mM) and urea (125 mg/mL) and incubated for 10 at 37 °C The dilution was performed in the way that $20 lg of proteins from extracted exosomes was loaded per lane on 10% polyacrylamide gels and transferred onto PVDF membrane (GE Healthcare, Chalfont St Giles, UK) To localize the exosome specific marker, Western blotting was performed with TSG101 polyclonal antibody (Novus Biologicals, Littleton Co, USA, Cat # NBP1-80244) using HRP-conjugate goat anti-rabbit IgG secondary antibody (Novus Biologicals, Littleton Co, Dromedary milk exosomes: Isolation and characterization 751 USA; Cat # NB730-H) and diaminobenzidine as chromogen substrate (Genemed Biotechnologies kit, Inc., San Francisco, CA, USA, Cat # 10-0006) under a stream of the nitrogen, and stored at À20 °C The extracted phospholipid was dissolved in a mobile phase solvent containing 20% chloroform before HPLC analysis Transcriptome analysis of exosomal content HPLC chromatographic separation To screen the transcriptome content of the isolated exosomes, total RNA was isolated using total RNA purification kit (Jena Bioscience, Loăbstedter Str Jena, Germany, Cat #PP-210S) according to the manufacturer’s instruction The RNA concentration and purity were spectrophotometrically assisted at 260 nm and 280 nm, respectively The total RNA (3 lg) was then reversely transcribed using a cDNA synthesis kit (Revert Aid First Strand cDNA Synthesis Kit; Thermo Scientific, Waltham, MA, USA, Cat #K1622) with a constant volume of RT reaction mix The purity of each amplification product was confirmed by clear single band corresponds to their specific size on agarose gel electrophoresis The PCR products were visualized on 2% agarose gel, stained with ethidium bromide and photographed under UV after an electrophoresis run for one hour The level of expression of GAPDH-as reference gene and a s1, a s2, b, j, casein genes within the recovered exosomes were assisted using quantitative real-time PCR using Luminaris Color HiGreen Low ROX qPCR Master kit (Thermo Scientific, Waltham, MA, USA, Cat #K0371) Primers sets for each gene were listed with their accession numbers and predicted amplicon sizes in Table For each SYBR Green assay, a dissociation curve was generated to detect non-specific amplification or primer dimerization (Supplementary Data) The isocratic high-performance liquid chromatographic separation of different phospholipids was performed by HPLC system (Agilent 1200 Series equipped with computerized solvent delivery system and UV detector, Santa Clara, CA, USA) using lPorasil silica gel column (10-lm particle size) Samples (20 lL) were injected for HPLC analysis and eluted by degassed mobile phase [acetonitrile–methanol–85% phosphoric acid (96:3:1, v/v/v)] that was delivered with the flow rate of 0.80 ml/min The effluent was monitored by at 203 nm wavelength and the concentration of each sample was detected using corresponding phospholipid standards The phospholipid standards were phosphatidylinositol (PI), PS, phosphatidylethnolamine (PE), and phosphatidylcholine (PC), and they were purchased from Sigma Chemical Company (St Louis, MO, USA) Each standard was previously prepared in concentration of mg/mL with chloroform–methanol (2:1, v/v) and stored at À20 °C All chemicals were of analytical-reagent grade Statistical analysis The data were analyzed using nonparametric Wilcoxon signedrank test by comparing medians of each value to hypothetical values using GraphPad Prism (version 5.01) Software Exosome lipidome: determination of major phospholipids Results Phospholipids extraction Exosomes morphology and stability Major phospholipids were extracted after minor modifications of method previously reported by Folch et al [24] Briefly, 100 ll from previously prepared exosomal suspension obtained from either dromedary milk or cattle milk (as parallel control with the same processing steps) was gently transferred to a graduated glass tube The chloroform:methanol mix (2:1, v/v) was added to the glass tube at twice volume as that of exosome pellet size The suspension was strongly mixed and centrifuged at 2500g for 10 After centrifugation the supernatant was discarded The methanol:water solution (1:1, v/v) was then added to the subnatant with its quarter volume The mixture was subsequently mixed and centrifuged at 2500g for 10 The supernatant and the boundary layer were then discarded The subnatant was lastly transferred to another glass tube, dried Table The TEM scanning for morphology of recovered camel milk exosomes showed homogenous population of exosomes with average size about 30 nm (Fig 1a) These homogenous exosomes population change in their size to be ranged between 50 and 90 nm with clumping and agglomeration after intermittent freezing and (Fig 1b) Proteome footprinting of recovered exosome Next, the exosome proteome was revealed by SDS PAGE (Fig 2a) and the level of expression of exosome TSG101 protein specific marker in dromedary milk was evaluated during PCR primers for different amplified genes Target genes Accession no Sequence Product size (bp) GAPDH EU331417.1 153 b casein AJ012630.1 j casein Y10082.1 a s1 casein JF429138.1 a s2 casein AJ012629.1 50 50 50 50 50 50 50 50 50 50 CGACCACTTTGTCAAGCTCA 30 CTGAGGGCCTCTCTCTTCCT 30 CTCTGCCTCTGCTCCAGTCT 30 ACAGGGACAAGTGGTTGAGG 30 CCAAATTATGCCAAGCCAGT 30 GATGGCAGGGTTGACTGTTT 30 AGCAGTGGTTTCACCCATTC 30 GCTCTTCCAGATAGCGTTGG 30 TCTTGCAAAGCATGAGATGG 30 CCTTGATGAAGAGCCTGGAG 30 235 168 206 249 752 A.M Yassin et al different lactation periods (Fig 2b) As shown in Fig 2a, there was no clear difference in mid lactation exosome when compared with that at late lactation concerning the proteome pattern For Western blot analysis (Fig 2b), there was a specific band with molecular weight 35 KDa instead of 43 KDa Transcriptome analysis of exosomal content Fig shows the agarose gel-resolved products of RT-PCR (reverse transcribed PCR) on exosome of dromedary milk during different lactation periods for GAPDH gene (Fig 3a), j-casein gene (Fig 3b), as1-casein gene (Fig 3c), and as2-casein gene (Fig 3d), respectively It is clear from Fig that the differential ultracentrifugation has the same transcriptomic yield as that recovered by exosome isolation kit used for commercial preparation More importantly is that the level of expression of different examined genes shows no obvious difference between the two lactation periods This was consistently true for the results obtained by quantitative real-time PCR (qRT-PCR) Results of qRT-PCR (Table 2) revealed that there was no any significant change in the level of expression of examined genes (b-casein, j-casein and as2casein genes) between both lactation periods Supplementary Data provide the dissociation curve generated to detect nonspecific amplification or primer dimerization during real-time amplification Here we used the data of b-casein gene as representative model Fig (a) Protein foot printing of dromedary milk exosomes: The exosomes pellets for both mid and late lactation milk samples were loaded in 10% Tris–glycine gel and stained with commassie brilliant blue Lanes (25 lg) and (10 lg) represent protein foot printing of extracted exosomes from mid lactation milk samples Lanes and 4, however, represent extracted exosomes from late lactation milk with different loading amounts (20 lg and 10 lg, respectively) It is clear that from lane and lane with equal loading amounts (10 lg each) that the mid lactation exosome has nearly the same protein banding as that at late lactation Lane M is the Blue Eye Pre stained protein marker (Jena Bioscience) Each lane represents exosomal proteome extracted from single separate milk sample with no pooling (b) Western blot of exosomal marker TSG101 (Tumor Susceptibility Gene 101 Protein) After SDS– PAGE, TSG101 was detected from other exosomal protein isolated Lanes 1, 3, and represent exosomes of mid lactation milk samples with loading amount of 10, 30, and 20 lg of protein, respectively Lanes 2, 4, and represent late lactation milk exosomes with loading amount of 10, 30, and 20 lg of protein, respectively Lane M: represent protein marker Unexpected specific bands were obtained at molecular weight 35 KDa instead of 43 KDa The Western blot represents one run from three runs with similar results Phospholipidomic study Fig (a) TEM scanning of recovered camel milk exosomes extracted from one sample as representative of mid lactation stage shows homogenous population of exosomes (indicated by arrows) with average size about 30 nm (scale bar: 100 nm) (b) TEM scanning of camel milk exosomes after stability testing by intermittent short thawing steps of freezed exosomes shows heterogeneous population of exosomes in the size range of 50– 90 nm with clumping and agglomeration as indicated by arrows (scale bar: 500 nm) The HPLC tracing of exosomes’ derived major phospholipid in during different lactation periods showed a slight elevation however not significant (p < 0.05) in PS fraction in camel milk exosomes at late lactation period above that detected in camel at early lactation or those reported in cattle at both periods (Fig 4b) Discussion Milk is not only a sole nutritional source for infants but also acts as immune modulator [25] Recently its nano-scaled Dromedary milk exosomes: Isolation and characterization 753 Fig Agarose gel-resolved products of RT-PCR (reverse transcribed PCR) on exosome of dromedary milk during different lactation periods: (a) Electrophoretic mobility of RT-PCR products of GAPDH gene separated on 2% agarose gel The product size was 153 bp Lanes from (1 to 6) represent RT-PCR products of GAPDH gene from exosomes isolated by total exosome isolation Kit, while lanes from (10 to 60 ) for RNA of exosomes isolated by differential ultracentrifugation Lanes 1, 2, 3, 10 , 20 , 30 represent PCR products for RNA of exosomes from mid lactation milk samples, while lanes 4, 5, 6, 40 , 50 , 60 represent PCR products for RNA of exosomes from late lactation milk samples (Each lane represents single animal sample) Lane M: 100 bp ladder (b) Electrophoretic mobility of PCR products of jcasein gene separated on 2% agarose gel RT-PCR products of j-casein gene with a specific band at 168 bp performed on RNA extracted from exosomes by total exosome isolation kit (lanes to 6) and differential ultracentrifugation (lanes 10 to 60 ) Lanes 1, 2, 3, 10 , 20 , 30 represent PCR products for RNA of exosomes from mid lactation milk samples, while lanes 4, 5, 6, 40 , 50 , 60 represent PCR products for RNA of exosomes from late lactation milk samples (Each lane represents single animal sample) Lane M: 100 bp ladder (c) Electrophoretic mobility of PCR products of as1-casein gene separated on 2% agarose gel RT-PCR products of as1-casein gene with a specific band at 206 bp performed on RNA extracted from exosomes by total exosome isolation kit (lanes to 5) and differential ultracentrifugation (lanes 10 to 60 ) Lanes 1, 2, 3, 10 , 20 , 30 represent PCR products for RNA of exosomes from mid lactation milk samples, while lanes 4, 5, 40 , 50 , 60 represent PCR products for RNA of exosomes from late lactation milk samples (Each lane represents single animal sample) Lane M: 100 bp ladder (d) Electrophoretic mobility of PCR products of as2 -casein gene separated on 2% agarose gel RT-PCR products of as2-casein gene with a specific band at 249 bp performed on RNA extracted from exosomes by total exosome isolation (lanes to 4) and differential ultracentrifugation (lanes 10 to 60 ) Lanes 1, 2, 10 , 20 , 30 represent PCR products for RNA of exosomes from mid lactation milk samples, while lanes 3, 4, 40 , 50 , 60 represent PCR products for RNA of exosomes from late lactation milk samples (Each lane represents single animal sample) Lane M: 100 bp ladder content ‘‘exosomes” are believed to play a central role in maternal-infant trans-communication in different species [4–7] For the first time, we used differential centrifugation followed by ultra-high speed centrifugation to isolate exosome from the dromedary camel milk The reliability of isolation was confirmed by parallel use of commercial kit The size Table and shape of isolated exosome were screened with TEM This first step of identification revealed spherical particles with average size of $30 to 100 nm This is consistent with finding by Admyre et al [4], who reported the human breast milk exosomes were in the range of 50 nm Likewise, Reinhardt et al [6] showed TEM-examined bovine milk exosomes examined The level of expression of milk protein genes with its Ct values Gene Mid lactation Late lactation P value (two tailed) b casein j casein as1 casein as2 casein 20.24a ± 0.53 25.76a ± 0.39 24.65a ± 0.34 26.69a ± 0.45 16.48a ± 2.39 23.003a ± 1.91 20.19a ± 0.37 21.54a ± 3.64 0.5000 0.5000 0.5000 0.5000 The Ct values are inversely related to the amount of the starting template Results are shown as means ± SEM (n = 3); a Superscript on the data = nonsignificant difference It is clear from the table and statistical analysis that there was no clear significant difference in the level of expression of each gene between different periods (P < 0.05) 754 were between 50 and 100 nm in diameter These data, however, partially disagree with Tauro et al [26], who proved that ultracentrifugation method of isolation yields slightly larger vesicles clumped together Secondly, the stability of the recovered fresh exosome was checked by successive short thawing cycles while being in deep-freeze store Surprisingly, the TEM scanning of stability tested exosomes showed heterogeneous population with different size clumps This change in size of deep freezed exosome disagrees with previous results obtained by Sokolova et al [27], who characterized the exosomes derived from different human cells under different conditions and revealed that multiple À20 °C freezing and thawing didn’t affect the exosomes size The observed difference in our results, however, could be attributed either to the difference in methodology or to certain peculiarity in the nature of the unresolved phospholipid makeup of dromedary milk exosome The later explanation affords better sense since high gravitational force (350.000g) was successfully used for isolation of human B cell-derived exosomes [28] Logically proteome is constructive determent in exosomal correlated function Here the electrophoresis-resolved protein foot-printing of the recovered exosomes shows no recognized discrepancy between mid and late lactation periods in major protein pattern ESCRT proteins have been proposed as major players in the biogenesis of exosomes of different origins [2,29] The ESCRT-I component TSG101 is believed to be a specific exosome-segregated biomarker during its biogenesis [30] Fig Phospholipids distribution in exosomes of camel cattle during different lactation periods (a) Represents HPLC tracing pattern of exosomal phospholipids in camel and cattle at different lactation periods, while (b) shows the mean value of distributions for each species at different lactation periods Data represent the means and SEM (n = 3) of phospholipids from different samples A.M Yassin et al TSG101 was detected as exosomal biomarker in bovine milk exosomes [6], urinary exosomes [31], and derived exosomes human colon cancer cell line LIM1863 [26] with average molecular weight 43–50 KDa Western blotting in the current investigation was performed to qualitatively and quantitatively evaluate the level of expression of exosome TSG101 protein specific marker in dromedary milk Qualitative immunoblot analysis recognized the TSG101 protein as a common band with the size of 35 KDa in these exosomes No clear explanation affords a reason for such size shift from common 43 KDa to 35 KDa The post-translation modification e.g phosphorylation or protein truncation in this poorly investigated mammalian species might serve a possible answer Further amino acids sequence assessment of this dromedary protein should be performed to confirm these speculations Earlier report had previously detected full-length 46 kDa TSG101 with other homologous proteins of smaller molecular weights in breast cancer [32] Quantitatively, our blot analysis reported equal level of expression of TSG101 protein during mid and late lactation periods This observed constant level of expression of TSG101 may be attributed to its variety of biological functions with specific cell growth regulation [33] One of the aims of the study was the use of total exosome isolation kit to evaluate the differential ultracentrifugation method as pre´cised tool for dromedary milk exosome recovery Here the nearly equal recovery of cDNA of different gene transcripts as shown by RT-PCR results consolidated with the TEM scanning of the recovered exosomes clearly affirms the similarity of recovery by the two methods In agreement with our finding, previous observation by Alvarez et al [31] reported that the ultracentrifugation isolation method was one of the best for RNA processing The investigation confirms that the level of expression of different studied genes does not change that much in the isolated exosomes during different lactation periods as indicated by the RT-PCR and qRT-PCR data More importantly, we learned that the examined gene transcripts showed conservation in their domains among different mammalian species including dromedary as indicated by the qRT-PCR melting curves The stable expression of different examined casein family genes inside dromedary exosome during different lactation periods- as shown in this study- presumably disagrees with previous nation denoting fluctuation of the level of expression of these genes during different periods of lactations in other species The casein gene family is the most important milk protein gene that contributes in nutritive and immune modulation functions [34] This noticed variation could be a result of the species difference or the difference in distribution of these genes transcripts in dromedary milk On the other hands, the data clearly prove the resistance of the screened casein genes (b, j, as1, as2) – as major protein component in mammalian milk- to the possible presence of high RNase activity in milk These findings were confirmed by previous works proposing that intact exosomes have RNase protecting abilities [35] Our finding, however, supports the previous concept that exosomal RNA is stable and protected inside the exosomes by its lipid raft domains [36] This lipid raft domains could confer a certain protection of exosomal contents against hostile conditions and safeguard such nano-vehicle contents Dromedaryderived phospholipid had been previously characterized with more fluidity and stability characters [37] This assumption Dromedary milk exosomes: Isolation and characterization motivated us to screen the phospholipids construction of dromedary milk exosomes, since the lipid composition of exosomes might adjust their remote cellular function and destiny Here the major phospholipid components in exosome of dromedary milk show PC as the major constituent of exosomal phospholipids followed by PE and PS These major phospholipids are normally found in other mammalian origin exosomes [38] These phospholipid members are apparently highly conserved in eukaryotes since Albuquerque et al [39] found that Histoplasmacapsulatum secrete vesicles, which appeared to be similar to mammalian exosomes and by MS analysis of its phospholipid composition; PE and PC, followed by PS were the most abundant phospholipids and resemble the mammalian exosomes membrane phospholipid Exosomes showed an extraordinary sorting of lipid classes and species into the exosome membrane Major differences in lipid classes and species have been determined, thus demonstrating that specific lipid species are selectively enriched in exosomes Interestingly, the noticed nonsignificant increase in PS – as a marker of apoptosis – in dromedary milk exosome in late lactation could denote the mammary tissue regression at the late lactation in these animals It is likely that the interplay between lipids and proteins is essential for formation of exosomes [40] Therefore, further expanding research on these lipid species might help in resolving the biogenesis and stability of exosomes with better understanding their extracellular interaction Conclusions The exosomes from dromedary milk were firstly isolated and characterized The size range of recovered exosomes was within the normal range reported for such vesicles in other species Stability testing by freezing and thawing showed heterogeneous population of these nanovesicles with tendency for agglomeration and clumping Electrophoresis proteome resolution revealed no major qualitative or quantitative difference in their proteins during mid or late lactation periods The immunoblot analysis of their specific marker confirmed the expression of truncated less molecular weight TSG101 protein The transcriptomic study revealed that there was stable expression of casein family genes during different lactation periods Additionally, phospholipidomic survey proved that PC is the major phospholipid constituent in dromedary milk exosomes Conflict of interest The authors have declared no conflict of interest Acknowledgments This work is fully supported by the Cairo University Research Fund Part of the work had been performed at Biotechnology Center for Services and Researches Facilities – Faculty of Veterinary Medicine, Cairo University Appendix A Supplementary material Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jare.2015.10.003 755 References [1] Mincheva-Nilsson L, Baranov V The role of placental exosomes in reproduction Am J Reprod Immunol 2010;63:520–33 [2] van Niel G, Porto-Carreiro I, Simoes S, Raposo G Exosomes: a common pathway for a specialized function J Biochem 2006;140:13–21 [3] Aalberts M, van Dissel-Emiliani FM, van Adrichem NP, van Wijnen M, Wauben MH, Stout TA, et al Identification of distinct populations of prostasomes that differentially express prostate stem cell antigen, annexin A1, and GLIPR2 in humans Biol Reprod 2012;86:1–8 [4] Admyre C, Johansson SM, Qazi KR, File´n JJ, Lahesmaa R, Norman M, et al Exosomes with immune modulatory features are present in human breast milk J Immunol 2007;179:1969–78 [5] Vlassov AV, Magdaleno S, Setterquist R, Conrad R Exosomes: current knowledge of their composition, biological functions, and diagnostic and therapeutic potentials Biochim Biophys Acta 2012;1820(7):940–8 [6] Reinhardt TA, Lippolis JD, Nonnecke BJ, Sacco RE Bovine milk exosome proteome J Proteomics 2011;75:1486–92 [7] Gu Y, Li M, Wang T, Liang Y, Zhong Z, Wang X, et al Lactation-related MicroRNA expression profiles of porcine breast milk exosomes PLoS One 2012;7(8):e43691 [8] Valadi H, Ekstrom K, Bossios A, Sjostrand M, Lee JJ, Lotvall JO Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells Nat Cell Biol 2007;9:654–9 [9] Mittelbrunn M, Gutierrez-Vazquez C, Villarroya-Beltri C, Gonzalez S, Sanchez-Cabo F, Gonzalez MA, et al Unidirectional transfer of microRNA-loaded exosomes from T cells to antigen-presenting cells Nat Commun 2011;2:282 [10] Pieters BC, Arntz OJ, Bennink MB, Broeren MG, van Caam AP, Koenders MI, et al Commercial cow milk contains physically stable extracellular vesicles expressing immunoregulatory TGF-b PLoS One 2015;10(3):e0121123 [11] Melnik BC Milk-A nutrient system of mammalian evolution promoting mTORC1-dependent translation Int J Mol Sci 2015;16(8):17048–87 [12] Arntz OJ, Pieters BC, Oliveira MC, Broeren MG, Bennink MB, de Vries M, et al Oral administration of bovine milk derived extracellular vesicles attenuates arthritis in two mouse models Mol Nutr Food Res 2015;59(9):1701–12 [13] Izumi H, Tsuda M, Sato Y, Kosaka N, Ochiya T, Iwamoto H, et al Bovine milk exosomes contain microRNA and mRNA and are taken up by human macrophages J Dairy Sci 2015;98 (5):2920–33 [14] Kalra H, Adda CG, Liem M, Ang CS, Mechler A, Simpson RJ, et al Comparative proteomics evaluation of plasma exosome isolation techniques and assessment of the stability of exosomes in normal human blood plasma Proteomics 2013;13(22):3354–64 [15] Record M, Carayon K, Poirot M, Silvente-Poirot S Exosomes as new vesicular lipid transporters involved in cell–cell communication and various pathophysiologies Biochim Biophys Acta 2014;1841(1):108–20 [16] Korish AA, Arafah MM Camel milk ameliorates steatohepatitis, insulin resistance and lipid peroxidation in experimental non-alcoholic fatty liver disease BMC Complement Altern Med 2013;13:264 [17] Agrawal RP, Jain S, Shah S, Chopra A, Agarwal V Effect of camel milk on glycemic control and insulin requirement in patients with type diabetes: 2-years randomized controlled trial Eur J Clin Nutr 2011;65(9):1048–52 [18] El-Fakharany EM, Abedelbaky N, Haroun BM, Sa´nchez L, Redwan NA, Redwan EM Anti-infectivity of camel polyclonal antibodies against hepatitis C virus in Huh7.5 hepatoma Virol J 2012;9:201 756 [19] Bashir S, Al-Ayadhi LY Effect of camel milk on thymus and activation-regulated chemokine in autistic children: doubleblind study Pediatr Res 2014;75(4):559–63 [20] Melnik BC The pathogenic role of persistent milk signaling in mTORC1- and milk-microRNA-driven type diabetes mellitus Curr Diabetes Rev 2015;11:46–62 [21] Thery C, Amigorena S, Raposo G, Clayton A Isolation and characterization of exosomes from cell culture supernatants and biological fluids Curr Protoc Cell Biol 2006:22 (Chapter 3) [22] Mokarizadeh A, Rezvanfar MA, Dorostkar K, Abdollahi M Mesenchymal stem cell derived microvesicles: trophic shuttles for enhancement of sperm quality parameters Reprod Toxicol 2013;42:78–84 [23] Bradford MM A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding Anal Biochem 1976;72: 248–54 [24] Folch J, Lees M, Stanley GHS A simple method for the isolation and purification of total lipids from animals tissues J Biol Chem 1957;226:497–509 [25] Armogida SA, Yannaras NM, Melton AL, Srivastava MD Identification and quantification of innate immune system mediators in human breast milk Allergy Asthma Proc 2004;25:297–304 [26] Tauro BJ, Greening DW, Mathias RA, Ji H, Mathivanan S, Scott AM, et al Comparison of ultracentrifugation, density gradient separation, and immunoaffinity capture methods for isolating human colon cancer cell line LIM1863-derived exosomes Methods 2012;56:293–304 [27] Sokolova V, Ludwig AK, Hornung S, Rotan O, Pa Horn, Epple M, et al Characterisation of exosomes derived from human cells by nanoparticle tracking analysis and scanning electron microscopy Colloid Surf B 2011;87:146–50 [28] Wubbolts R, Leckie RS, Veenhuizen PT, Schwarzmann G, Mobius W, Hoernschemeyer J, et al Proteomic and biochemical analyses of human B cell-derived exosomes Potential implications for their function and multivesicular body formation J Biol Chem 2003;278:10963–72 [29] Carayon K, Chaoui K, Ronzier E, Lazar I, Bertrand-Michel J, Roques V, et al Proteolipidic composition of exosomes changes during reticulocyte maturation J Biol Chem 2011;286:34426–39 A.M Yassin et al [30] Simons M, Raposo G Exosomes–vesicular carriers for intercellular communication Curr Opin Cell Biol 2009;21:575–81 [31] Alvarez ML, Khosroheidari M, Kanchi Ravi R, DiStefano JK Comparison of protein, microRNA, and mRNA yields using different methods of urinary exosome isolation for the discovery of kidney disease biomarkers Kidney Int 2012;82:1024–32 [32] Lo YF, Chen TC, Chen SC, Chao CC Aberrant expression of TSG101 in Taiwan Chinese breast cancer Breast Cancer Res Treat 2000;60(3):259–66 [33] Wagner KU, Krempler A, Qi Y, Park K, Henry MD, Triplett AA, Riedlinger G, Rucker III EB, Hennighausen L Tsg101 is essential for cell growth, proliferation, and cell survival of embryonic and adult tissues Mol Cell Biol 2003;23(1): 150–62 [34] Ishii H, Nakamura T, Higuchi M, Mamada A, Fukushima M, Urashima T, et al The expression changes of casein mRNAs in mammary epithelial cells recovered from bovine milk during the lactation period Asian-Aust J Anim Sci 2007;20:983–8 [35] Keller S, Ridinger J, Rupp A, Janssen JWG, Altevogt P Body fluid derived exosomes as a novel template for clinical diagnostics J Trans Med 2011;9:86 [36] Subra C, Laulagnier K, Perret B, Record M Exosome lipidomics unravels lipid sorting at the level of multivesicular bodies Biochimie 2007;89:205–12 [37] Warda M, Zeisig R Phospholipid- and fatty acid-composition in the erythrocyte membrane of the one-humped camel [Camelus dromedarius] and its influence on vesicle properties prepared from these lipids Dtsch Tierarztl Wochenschr 2000;107 (9):368–73 [38] Grey M, Dunning CJ, Gaspar R, Grey C, Brundin P, Sparr E, et al Acceleration of a-synuclein aggregation by exosomes J Biol Chem 2015;290(5):2969–82 [39] Albuquerque PC, Nakayasu ES, Rodrigues ML, Casadevall A, Zancope-oliveira RM, Almeida IC Vesicular transport in Histoplasma capsulatum: an effective mechanism for trans-cell wall transfer of proteins and lipids in ascomycetes Cell Microbiol 2008;10:1695–710 [40] Llorente A, Skotland T, Sylvaănne T, Kauhanen D, Rog T, Orowski A, et al Molecular lipidomics of exosomes released by PC-3 prostate cancer cells Biochim Biophys Acta – Mol Cell Biol Lipids 2013;1831:1302–9  ... lactation A.M Yassin et al period was considered from 100 to 200 days in milk; however the late lactation period was after 200 days in milk Isolation of dromedary milk exosomes Milk exosomes were... means and SEM (n = 3) of phospholipids from different samples A.M Yassin et al TSG101 was detected as exosomal biomarker in bovine milk exosomes [6], urinary exosomes [31], and derived exosomes. .. transcribed PCR) on exosome of dromedary milk during different lactation periods for GAPDH gene (Fig 3a), j-casein gene (Fig 3b), as1 -casein gene (Fig 3c), and as2 -casein gene (Fig 3d), respectively