... way can the thoughts be gathered and focussed, and resolution and http://www.your-guidance.com/ 19
Ngày tải lên: 21/01/2014, 18:20
... readers than I should in writing of him as an Artist. Besides, as an artist he has been done a great deal already; and a commercial state like ours has really more concern in him as a business man. ... page. He knows that there is always a danger that the reigning favorite may fail to please; that at any rate, in the order of things, he is passing away, and that if the magazine is not to pass ... to know motive and character with such thoroughness and accuracy as he can acquire only through his own heart. A man remains in a measure strange to himself as long as he lives, and the very sources...
Ngày tải lên: 17/02/2014, 19:20
Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc
... discriminant analysis (LDA).Thisstatistical multivariate method is supervised. It searches for the variables containing the greatest interclass variance and the smallest intraclass variance, and constructs ... [14]. Many parameters can be adjusted for increasing the efficiency of the algorithm. The data were analysed with a window of five wavenumbers, assuming that adjacent wavenumbers are highly corr elated. ... phosphate associated with nucleic acids, i.e. DNA and RNA. The a bsorption bands a t 1245 a nd 1087 cm )1 are c haracteristic o f asymmetric and symmetric pho spho- diester vibration of nucleic acids...
Ngày tải lên: 21/02/2014, 03:20
Therapeutic ultrasound as a potential male contraceptive: power, frequency and temperature required to deplete rat testes of meiotic cells and epididymides of sperm determined using a commercially available system doc
... global and regional levels and trends. Reprod Health Matters 2010, 18:90-101. 34. Ahman E, Shah I: Unsafe abortion. Global and regional estimates of the incidence of unsafe abortion and associated ... counts and motilities. Untreated, retired breeders served as untreated controls. Sham-treated animals underwent all preparations for ultrasound treatment as treated animals: anesthesia was administered ... couples [1,2]. Ultrasound’s potential as a male contraceptive was first reported by Fahim et al. [3]. In a series of publications, it was shown that a single application of ultrasound could result in a dramatic...
Ngày tải lên: 05/03/2014, 17:20
The Project Gutenberg EBook of The Man of Letters as a Man of Business, by William Dean Howells potx
Ngày tải lên: 28/06/2014, 17:21
The Project Gutenberg EBook of The Man of Letters as a Man of Business by William Dean Howells pptx
Ngày tải lên: 28/06/2014, 17:21
Báo cáo y học: " Airway smooth muscle as a target of asthma therapy: history and new directions" docx
Ngày tải lên: 12/08/2014, 16:20
santiago as a hemmingway code hero in the old man and the sea
Ngày tải lên: 21/03/2014, 22:50
Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly
... than the sample with regular aroma concentration. The hypothesis was based on studies by De Graaf et al. (1994, 1996) and Griep, Mets, and Massart (1997) and Schiffman and Warwick (1993), all of ... flavor, and stronger in after-taste than the sample with a regular aroma concentration. The heightened aroma concentration caused a slight off-flavor described as ‘artificial’. The manufacturer packaged ... information was provided on the front page of the home-use booklet. Preliminary data analysis revealed no significant main effects and only one significant interaction of day and aroma on the pleasantness...
Ngày tải lên: 03/04/2013, 21:06
Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier
... euent was detected with a UV detector at 232 nm. e main pharmacokinetic parameters were calculated by DAS 1.0 (Anhui, China) program. Bioavailability (BA) is a measurement of the rate and extent ... (Sonaje et al., 2009): BA (AUC )Dose (AUC )Dose 100 R AB BA = ì ì ì% () () where AUC is the area under the curve. Statistical analysis All data are presented as a mean value with its stand- ard ... method had several advantages such as a rapid and simple preparation procedure, great potential for large industrial scale production, and easy control of the particle size (Zhang et al., 2009)....
Ngày tải lên: 23/04/2013, 21:38
Evaluation of Dredged Sediment as a Silt and Clay Source for Artificial Tidal Flats
Ngày tải lên: 05/09/2013, 09:38
Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry
Ngày tải lên: 05/09/2013, 15:28
A contrastive analysis of encouraging as a speech act in english and vietnamese
Ngày tải lên: 26/11/2013, 13:31
Tài liệu Toilet design for rural areas and separated urine collection as a fertilizer source pptx
... composition of the human and animal in Vietnam (Table 3) as well as average rate of excretion (Table 4). Table 3: Chemical composition of excreta and urine of the human and animal Content in % ... their advantages and disadvantages. Similar, in Chapter 4 presents rural water toilet structures and also to compare their both sides of cost and benefit. Later, how to develop and manage toilets ... sanitation situation in rural area was a population cause in water body, since mid-2003 to early-2005, CTU had accepted to develop a know-how reference document as a manual concerning rural...
Ngày tải lên: 16/01/2014, 17:20
Tài liệu ANTHROPOLOGY: AS A SCIENCE AND AS A BRANCH OF UNIVERSITY EDUCATION IN THE UNITED STATES pptx
... utensils, weapons, and agricultural, etc., implements. Architecture and building. Clothing and fashions. Means of transportation by land and water. Agriculture. Domestication of plants and animals. ... Eurafrica, Austafrica, Asia, America, Oceanica. Causes and consequences of the migrations of races and nations. a. The Eurafrican Race.—Types of the white race. Its first home. Early migrations. ... of languages. Universal alphabets. Logical relations of the parts of speech. The vocabulary and the grammar of languages. Distinctions between languages and dialects. Mixed languages and jargons....
Ngày tải lên: 13/02/2014, 05:20
Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt
... that animal a- amylases are released in the intestinal tract where oxygen concentration is expected to be low, whereas bacterial linkers are devoid of Cys. However, Artemia and Acanthochitona ... Crassos- trea gigas (Mollusca, Bivalvia). Sequence data were depos- ited in GenBank (Table S1). Searches in databases Using the putative C-terminal domain of C. fluminea as a query, sequence databases ... Results and Discussion Identification of new modular a- amylases a- Amylases are ubiquitous enzymes hydrolyzing a- 1,4- glycosidic bonds of starch and related polysaccharides, such as glycogen, and belonging...
Ngày tải lên: 14/02/2014, 18:20
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt
... ACA G) and EWS reverse d(CGC TCG AGT CAC TAG TAG GGC CGA TCT CTG C), for pGEX–EWS; EAD forward d(CGG AAT TCA TGG CGT CCA CGG ATT ACA G) and EAD reverse d(CGC TCG AGT CAT CCG GAA AAT CCT CCA GAC ... samples to 95 °C on a thermal heating block and cooling to 4 °C at a rate of 2 Cặmin 1 . Name Sequence ssDNAS d(CATTCCCACCGGGACCACCAC) ssDNA L d(CATTCCCACCGGGACCACCACCATTCCCACCGGGACCACCAC) ETS-1 d(TCTCTCGGTGGCCGGGGCTCGTCGGGGTTTTGGGTCCGTCC) Htelo ... (lanes 1 and 2). (B) EMSA was per- formed with EWS (lanes 2, 4 and 6) and 32 P-labeled Htelo (lanes 3 and 4), dsHtelo (lanes 5 and 6) or ssDNA S (lanes 1 and 2). The structures of DNAs used as...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Deciphering enzymes Genetic selection as a probe of structure and mechanism docx
... the bifunctional enzymes chorismate mutase–prephenate dehydratase and chorismate mutase–prephenate dehydratase were deleted. Monofunctional versions of the dehydratase and the dehydrogenase are provided ... by plasmid pKIMP-UAUC. Random gene libraries are introduced into this strain and the ability of a cell harboring an individual library member to form a colony on minimal agar media lacking added ... interactions may be an easy way to increase enzyme stability. This hexameric variant, however, suffered a 200-fold decrease in catalytic efficiency. In contrast, the unstable monomeric variants had...
Ngày tải lên: 19/02/2014, 12:20