Nghiên cứu ảnh hưởng của chất kích kháng lên sự biểu hiện của một số gen tham gia quá trình sinh tổng hợp curcuminoid ở tế bào nghệ đen (curcuma zedoaria roscoe) tt tiếng anh

MINISTRY OF EDUCATION AND TRAINING HUE UNIVERSITY UNIVERSITY OF SCIENCE TRUONG THI PHUONG LAN STUDY ON EFFECT OF ELICITORS ON GENES INVOLVED IN CURCUMIN BIOSYNTHESIS EXPRESSION IN ZEDOARY CELLS (Curcuma zedoaria Roscoe) DISSERTATION SUMMARY Major: Plant Physiology Code: 9420112 Scientific supervisor: Prof Dr NGUYEN HOANG LOC HUE – 2019 The study was performed at: Department of Biology University of Sciences, Hue University Scientific supervisor: Prof Dr Nguyen Hoang Loc Review 1:Prof Dr Duong Tan Nhat Central Highlands Scientific Research Institute Reviewer 2: Prof Dr Dr Le Thi Thuy Tien Ho Chi Minh City University of Technology Reviewer 3: Prof Dr TS Vo Thi Mai Huong University of Science, Hue University The dissertation will be defended at scientific Hue University’s council in Hue University on … hour … day … month … year 2019 For more information about dissertation, please visit: - Library of University of Sciences, Hue University - Vietnam national library INTRODUCTION The necessity of the study Curcuma zedoaria, belonging to the ginger family (Zingiberaceae), has been using in traditional medicine in various countries to treat inflammation, aches, skin diseases such as wounds and spots sores, as well as abnormalities of the menstrual cycle Curcuminoids, a mixture of curcumin and its delivery including demethoxycurcumin, and bisdemethoxycurcumin, is major compound having bioactivity of Curcuma Previous studies suggested that curcuminoids, especially curcumin, have valuable biological activities such as antioxidant, antitumor, anti- inflammatory, anti-acidogenic, radioprotective and neuroprotective (anti β-amyloid) properties Genes that involve the pathway of curcuminoid metabolism in C longa have been identified and qualified the expression level, including two type III polyketide synthase genes, DCS gene and CURS1, CURS2 and CURS3 genes However to our knowledge, genes which metabolize curcuminoids in zedoary (C zedoaria) were not reported yet Elicitors are the chemical compounds which have been used to modify the pathway of secondary metabolism in order to enhance of the biosynthesis of pharmaceutically significant metabolites or phytopharmaceuticals in plant cell cultures Thus, we carried out the research entitles “Study the effect of elicitors on expression of genes involved curcuminoid biosynthesis pathway in Curcuma zedoaria cells” to find out the elicitor and optimal concentration to enhance the expression level of type III polyketide synthase gene in the phenylpropanoid pathway of Curcuma zedoaria cells Our results firstly provide scientific evidence on the role of SA, YE and MeJA as the positive regulation compounds for gene expression in this medicinal plant Objectives of study Theoretical objectives Improvement the expression level of CzDCS, CzCURS1, CzCURS2 and CzCURS3 genes involved in phenylpropanoid metabolism pathway for curcuminoid biosynthesis in Curcuma zedoaria cells cultured in vitro by elicitors Practical objectives Enhancement the curcumin biosynthesis, major compound of curcuminoid and being widely applied in pharmaceutical from Curcuma zedoaria cells cultured in vitro Research scope and content Research content - Establishing in vitro Curcuma zedoaria cells culture in supplement with AgNO3 into medium culture - Isolation of CzDCS, CzCURS1, CzCURS2, and CzCURS genes involved in curcuminoid biosytheis from Curcuma zedoaria - Investigation the effect of elicitors including YE, SA and MeJA on expression level of gene for curcuminoid synthesis and curcumin accumulation in Curcuma zedoaria cells cultured in vitro Research limit Studies were conducted with the laboratory scale Novelty of dissertation - Perivious studies on in vitro propagation and callus cells culture did not use AgNO3 to improve the effect of culture In this study, AgNO3 supplementation at 1.5 mg/L into in vitro propagation and callus cells culture enhanced the results in compare to previous studies - Succesfully isolated four genes involved in curcuminoid biosynthesis, showing 99% similarity to corresponding genes in C longa and had deposited on GenBank with accession number MF663785, MF402846, MF402847, and MF987835 These genes expressed in Zedoary turmeric and callus - DCS gene played most importance role in the genes involved in curcumin biosynthesis in Zedoary, expression of this gene directly regulated curcumin accumulation - Studied the effect of elicitors (yeast extract and salicilic acid) on curcumin accumulation and related genes expression The optimal values reached under treatment by g/L YE after the day of culture, gene expression level was 2.78 fold higher than that of control Dissertation structure Dissertation is presented in 127 A4 pages without suplementary In which, the introduction section consists of pages, litterateur review section contains 22 pages, materials and methods section involves 11 pages, result section accounts for 40 pages, discussion section is 16 pages, conclusion and suggestion section is page, list of publication section is pages, reference section is 21 pages and supplementary section is 13 pages Dissertation referred 169 references including 161 English references The results section consists of tables and 26 figures CHAPER LITTERATEUR REVIEW Zedoary Zedoary (Curcuma zedoaria Roscoe) is a valuable medicinal plant; the essential oil obtained from its rhizomes is reported to have antimicrobial activity It is also used clinically in the treatment of cervical cancer, as the aqueous extract of zedoary has antimutagenic activity In traditional Asian medicine, zedoary (Zedoariae rhizoma) is also used for treatment of stomach diseases, hepato-protection, the treatment of blood stagnation Furthermore, zedoary has antiinflammatory potency related to its antioxidant effect Zedoary is medicinal plant which its root mainly contains emission compounds (sesquiterpene and monosesquiterpene) and curcuminoid (curcumin, demethoxy-curcumin and bisdemethoxycurcumin) In addition, Zedoary roots is consisted of starch, stick compounds and phenolic compunds such as tannin, flavonoid Plant cells culture for secondary metabolite production Plant cells culture has potential appling for secondary metabolite production, especially medicinal compounds This approach could lead the stable in quality of products, resulting in less dependence to the nature production Moreover, it provides materials for biophysical, biochemistry experiements and application on extraction metabolite compounds Elicitor and application Elicitor is defined as a molecule that initials or enhances secondary metabolite biosynthesis in the plant cells Elicitation is an induction process that increases the synthesis bioactive compounds under trigger of elicitor, leading plant in against the stress environment such as pathogen infection or adverse ecological conditions Up to day, numerous studies have been reported on application elicitor to induce secondary metabolite compounds production from in vitro plant Most studies demonstrate the increasing accumulation of secondary metabolite compounds in compared to control after being treated by elicitor under optimal condition Numerous plants have been cultured under elicitor treament including Dioscorea zingiberensis, Digitalis lanata, Hypericum triquetrifolium, Portulaca oleracea, Psoralea corylifolia, Silene vulgaris, Alstonia scholaris, Hypericum perforatum, Scrophularia kakudensis, Taxus baccata, Artemisia annua… Cultivation the curcuma genus under elidictor supplementation have been reported on C aeruginosa, C longa, and C mangga Curcuminoid biosynthesis genes The curcuminoid biosynthesis in C longa has been involved different enzymes require for several reactions in which most of genes/enzymes already has been characterized on properties and fuctions as well as recombinant expression Among them, polyketide synthase type III plays most importance role Diketide-CoA synthase gene (DCS) encodes for diketide-CoA synthase, a enzyme belonging to polyketide synthase type III catalyzes for reaction to form feruloyldiketide-CoA by feruloyl-CoA and malonyl-CoA Curcumin synthase gene (CURS) encodes for enzyme catalyzes the formation of curcuminoid by cinnamoyldiketide-N-acetylcysteamine and feruloyl-CoA The co-reaction of DCS and CURS in the presence of feruloyl-CoA and malonyl-CoA is resulted in plenty curcumin accumulation, whereas CURS alone exhibits low curcumin synthesis in the presence of feruloyl-CoA and malonyl-CoA CHAPTER MATERIALS AND METHODS 2.1 Materials Study qualified the expression level of genes involved in curcuminoid biosynthesis pathway in Zedoary culture cells (Curcuma zedoaria Roscoe) 2.2 Methods 2.2.1 In vitro zedoary plants culture Leaf-base and root in vitro cultureo Sterilized leaf-base explants (approx × 1.5 cm) was cultured on MS medium containing 2% (w/v) sucrose, 0.8% (w/v) agar, supplemented with mg/L BAP, 0.5 mg/L IBA and 20% (v/v) coconut water In vitro leaf-base was transferred on the same medium with addition of 0.5-2.5 mg/L AgNO3 to investigate the generation of multi-shoot Các chồi in vitro (3-4 cm) was cultivated on MS medium supplemented with mg/L NAA and AgNO range from 0.5 to 2.5 mg/L AgNO3 to examine the root generation Callus culture Leaf-base explants (approx 0.2 × cm) of weeks old in vitro zedoary plants were tranferred on MS medium supplemented with mg/L BAP and mg/L 2,4-D to induce callus formation The primary calli were sliced into pcieces (approx mm diameter) and subcultured on fresh medium containing mg/L 2,4-D and KIN, or NAA (0.5-2 mg/L), or AgNO (0.5-2.5 mg/L) for biomass production Supension cell culture g callus after precultivation for weeks was transferred into 250ml shaking flask containing 50 mL MS medium with 20 sucrose g/L, mg/L 2,4-D and mg/L BAP, shaking of 150 rpm for 18 day 2.2.2 Curcuminoid biosynthesis genes isolation DNA isolation Total DNA of zedoary was extracted from young leaves of in vitro plants by the CTAB method according to Babu et al (2014) with slight modification PCR amplification Total DNA of zedoary was used as template to amplify the coding gene based on specific primers designed for corresponding genes in Curcuma longa (Table 2.1) Table 2.1 Primers used for PCR amplification of the coding DNA sequences of curcuminoid genes in C zedoaria Genes Primers Nucleotide sequences (5’- 3’) DCS-F GTCGTTTCTGTGACCTTCTC DCS-R CTTTTGGATGCAGACTGGAACA CURS1-F CTGCGACTGCGAGAAGAAGC CURS1-R CAGATAGACAGCCATACAAACC CURS2-F GCACGCGTTTTCTTGCTAATC CURS2-R GATCGTGTTCATAATTCACTGG CURS3-F CTAGCTAGCTGCAATTCGTT CURS3-R GTGCTAGCTTAGCTTGACGTA Putative length (nu) CzDCS CzCURS1 CzCURS2 CzCURS3 ~ 1400 ~ 1250 ~ 1300 ~ 1250 Gene cloning and Phylogenetic analysis PCR products were purified, ligated to pGEM®T-Easy vector using T4 DNA ligase (Promega, USA) and transferred into E coli TOP10 by heat-sock method Nucleotide sequences were sequenced by dideoxy terminator method Phylogenetic analysis Coding region of DCS, CURS1, CURS2, CURS3 genes of C zedoaria and C longa were used to generate the phylogenetic tree by MEGA7 software 2.2.3 Expression qualification of curcuminoid biosynthesis genes Elicitor treatment Elicitors were added into medicum culture at difference conccentration (25-150 µM MeJA, 50-150 µM SA and 0.1-1.5 g/L YE) and difference inoculation time (initiation or at the day of 5) RT-PCR Expression level of curcuminoid genes in various samples was analysed by RT-PCR with the primers that designed based on their specific regions (Table 2.2) Table 2.2 Primers used for RT-PCR amplification of the specific regions of curcuminoid genes in C zedoaria Genes CzDCS Primer Nucleotide sequences (5’- 3’) Length of Annealing s indicators temperature (nu) (oC) 272 55 286 55 211 55 202 50 ID-F TGCTCCGAGGTCACCGTGC ID-R GGTCAGCCCAATTTCGCGG IC1-F CCGCTGGAAGGAATTGAAA CzCURS AA IC1-R GAGCTTGTCCGGGCTCAGCT G IC2-F CCACCTCCGCGAGGTGGGG CzCURS CT IC2-R GCGGTGGCCAGCTTGCTCTG T IC3-F CACCTGAGGGAAATCGGCTG CzCURS G IC3-R GCGAGCTTCCCCTGTTCCAG C 2.2.3.3 HPLC Curcumin was isoalted as described by Paramapojn Gritsanapan (2009) Curcumin concentration was determined growth in compared with control Among that, medium containing AgNO3 (1.5 mg/L) callus reached highest dry weight of 62,43 mg (Table 3.6) Table 3.6 Effect of AgNO3 (0.5-2 mg/L) and 2,4-D (1 mg/L) on the growth of callus cells AgNO3 (mg/L) Diameter (cm) Control 0.5 1.0 1.5 2.0 b 1.28 1.38ab 1.41a 1.45a 1.35ab Weight Fresh (g) c 0.53 0.59bc 0.65ab 0.71a 0.67ab Dry (mg) 48.21c 49.78c 56.87b 62.43a 58.18b 3.1.3 Callus cells culture The results showing in Fig 3.3 indicated the lag phase is short The cells changed to growth phase and continuously exponential from day to day 14 of culture, then dramatically decreased Fresh cells biomass reached approximately 170g/L, equally to 15 g/L of dry biomass weight Figure 3.3 The growth curve of zedoary callus cells 3.2 Identification of curcuminoid biosynthesis genes 3.2.1 Gene isolation The full length of DCS, CURS1, CURS2 CURS3 genes of zedoary are 1382 bp, 1240 bp, 1288 bp and 1265 bp, respectively (Fig 3.6) Hene, the genes were named as CzDCS, CzCURS1, CzCURS2 and CzCURS3, and deposited on GenBank with accession number of MF663785, MF402846, MF402847 and MF987835, respectively To identify intron/exon in our genomic DNA sequences of CzDCS, CzCURS1, CzCURS2 and CzCURS3, we used several strategies to ensure high accuracy of identity assignment The results showed that CzCURS1, CzCURS2 and CzCURS3 have one intron whereas CzDCS has two introns The putative intron/exon regions are shown in figure 3.7 Figure 3.6 PCR products of genes involved in curcuminoid biosynthesis amplified from total genomic DNA Lane M1 and M2: DNA size marker (100 bp (BioRad) and kb DNA Ladder (Geneaid)), 1: CzDCS, 2: CzCURS1, 3: CzCURS2, 4: CzCURS3 We employed phylogenetic analysis as a tool to correctly assign identity for C zedoaria curcuminoid biosynthesis genes The results are shown in figure 3.16 indicated that corresponding genes cluster with very high bootstrap values, demonstrating the orthologs and paralogs of these genes in C longa and C zedoaria In the phylogenetic tree, CURS genes classify as group with high identity, the difference are only range 0.1 to 0.2 The DCS genes also have high similarity and form as group Figure 3.7 Schematic diagram of intron/exon arrangement The diagram shows intron (line), exon (box) and their boundaries in four curcuminoid biosynthesis genes in C zedoaria Number indicates the first nucleotide of the start codon The general structure of the encoding proteins is also shown below Domain assignment was obtained using Interproscan Figure 3.16 Molecular phylogenetic analysis of curcuminoid genes 3.2.2 Expression of curcuminoid genes To assess the expression of curcuminoid biosynthesis genes in C zedoaria (rhizome and callus), we opted RT-PCR method and analyzed the intensity of DNA bands from gel electrophoresis The data of RT-PCR of four curcuminoid genes (CzDCS, CzCURS1, 2, and 3) indicated all the genes expressed in both the rhizome and callus (Fig 3.17) The results suggest that the curcuminoid metabolism of C zedoaria also occurs in in vitro culture, and callus is a suitable material source for establishing plant cell suspension culture to produce curcumin Figure 3.17 Transcription expression of CzDCS, CzCURS1, CzCURS2 and CzCURS3 genes in various tissues of C zedoaria M: DNA size marker (1 kb), 1-3-5-7: rhizome, 2-4-6-8: callus, A: CzDCS, B: CzCURS1, C: CzCURS2, and D: CzCURS3 To ensure the above hypothesis, we analyzed the curcumin concentration, the major compound of curcuminoid in rhizome and callus HPLC analysis indicatea both the rhizome and callus extracts contain the peak of curcumin with the retention time is similarity to that of standard curcumin 3.3 Effect of elicitor on curcuminoid biosynthesis 3.3.1 Effect of type of elicitors on curcuminoid biosynthesis genes expression RT-PCR results showed treatment with methyl jasmonate (25150 mM) did not change the CURS1 expression in compared to control (Fig 3.22A) but increased CURS3 expression level (Fig 3.22B) Under treatment by salicylic acid (50-150 mM), the expression level of these genes were higher than control CURS1 expression level strongest enhanced when the cells are being treated with 100 mM SA while CURS3 showed highest expression at the 150 mM SA treatment Yeast extract treatment increased genes expression level at the concentration of 0.7-1.0 g/L, whereas other treatments reduced gene expression level Based on these results, we found MeJA shows less effect on CURS expression, while SA and YE had higher effect on expression level of these genes The slected elicitor treament concentration are salicylic acid 100 mM and yeast extract g/L to examine gene expression level at different period of treament 3.3.2 Expression of curcuminoid genes RT-PCR amplification in Figure 3.23 exhibited that expression of curcuminoid genes in treated cells of C zedoaria is higher than that of untreated cells Expression level of genes was evaluated through the intensity of DNA bands showed that they are 1.14-3.64fold higher than the control (Table 3.8) In general, YE showed a higher elicitation effect compare to SA, the total intensity of DNA bands reached a maximum value of 71528 versus 31625 (approx 2.3-fold) Table 3.8 Intensities of DNA bands from RT-PCR amplification of the specific regions of curcuminoid genes Gene Control SA (100 µM) YE (1 g/L) 5 CzDCS CzCURS1 CzCURS2 CzCURS3 4706 6881 4646 4414 5312 7810 6186 4146 6146 10766 8510 6203 5113 32576 12139 21700 13425 13524 17783 12664 Total 20647 23455 31625 71528 57397 ... C zedoaria Genes Primers Nucleotide sequences (5’- 3’) DCS-F GTCGTTTCTGTGACCTTCTC DCS-R CTTTTGGATGCAGACTGGAACA CURS1-F CTGCGACTGCGAGAAGAAGC CURS1-R CAGATAGACAGCCATACAAACC CURS2-F GCACGCGTTTTCTTGCTAATC... GATCGTGTTCATAATTCACTGG CURS3-F CTAGCTAGCTGCAATTCGTT CURS3-R GTGCTAGCTTAGCTTGACGTA Putative length (nu) CzDCS CzCURS1 CzCURS2 CzCURS3 ~ 1400 ~ 1250 ~ 1300 ~ 1250 Gene cloning and Phylogenetic... Figure 3.16 Molecular phylogenetic analysis of curcuminoid genes 3.2.2 Expression of curcuminoid genes To assess the expression of curcuminoid biosynthesis genes in C zedoaria (rhizome and callus),