DSpace at VNU: Cloning of some heat shock proteins genes for further transcriptional study of Planktothrix agardhii exposed to abiotic stress

Folia Microbiol DOI 10.1007/s12223-014-0372-9 Cloning of some heat shock proteins genes for further transcriptional study of Planktothrix agardhii exposed to abiotic stress Chi Thi Du Tran & Cécile Bernard & Katia Comte Received: 24 August 2014 / Accepted: 15 December 2014 # Institute of Microbiology, Academy of Sciences of the Czech Republic, v.v.i 2014 Abstract Planktothrix agardhii is one of the freshwater cyanobacteria that can produce the hepatotoxin microcystins (MC)—a real threat to human and animal health Knowledge of the biological role of MC in producing organisms is highly desired to understand the driving force of MC production Recently, emerging evidences have suggested that MC may have protective role in cells facing environmental stress If this is true, one should expect differences in the cellular protective mechanisms between MC-containing and MC-deficient mutant strains To test this hypothesis, it would be essential to investigate the consequences of the loss of MC in Planktothrix in the transcriptional responses of its heat shock proteins (Hsps) to abiotic stresses—an important component of cellular stress response However, a crucial first step is prerequisite for the isolation of hsp genes here, as the genome of Planktothrix has not been fully published Therefore, we have successfully isolated four hsp genes including clpC (hsp100), htpG (hsp90), groEL (hsp60), and groES (hsp10) from Planktothrix agardhii PCC 7805 using ramped annealing PCR (RAN-PCR) with consensus-degenerate hybrid oligonucleotide primers (CODEHOP) and annealing control primer (ACP) system In addition, some putative regulatory sequences found in the upstream region of groESL operon of Planktothrix agardhii were also discussed C T D Tran Faculty of Biology, Hanoi University of Science, VNU-Hanoi, Hanoi, Vietnam C T D Tran : C Bernard : K Comte (*) UMR 7245 CNRS-MNHN “Molécules de Communication et Adaptation des Micro-organismes”, Muséum National d’Histoire Naturelle, 12 rue Buffon CP 39, 57 rue Cuvier, 75231 Paris Cedex 05, France e-mail: kcomte@mnhn.fr Introduction Organisms, during their lifetime, have to face various environmental fluctuations In order to maintain cellular homeostasis, they have to be able to constantly sense and trigger the protective mechanisms including the modulation of the expression of stress proteins to adapt to environmental changes Amongst these stress proteins, heat shock proteins (Hsps) play an important role in protein folding, assembly, translocation, and degradation in many normal cellular processes, stabilize proteins and membrane, and can assist in protein refolding under stress conditions (Wang et al 2004) Although Hsps are constitutively expressed, they are also induced in cells exposed to stressful conditions (Stephanou et al 2011) The cyanobacteria (photosynthetic prokaryotes) have an impressive ability to adapt to the environment that allow them to colonize almost all ecological niches including extreme conditions like hot spring or snow (Whitton and Potts 2000) Some species frequently found in temperate zone such as Planktothrix agardhii (Gomont) (Anagnostidis and Komarek 1988) can produce different variants of microcystins (MC) Actually, the MC have been isolated from multiple cyanobacterial genera including Microcystis, Anabaena, Planktothrix, Oscillatoria, Chroococcus, and Nostoc (Pearson et al 2010; Sivonen and Jones 1999) Amongst them, Planktothrix is one of the most prevalent nuisance species with highest concentration of MC per biomass unit (Fastner et al 1999; Scheffer et al 1997) Although the effects of MC on growth and physiological functions of various other organisms have been well studied, their function for the producing organisms still remains obscure despite its importance in understanding the driving forces of the production of toxin (Babica et al 2006) Recently, there are increasing numbers of facts that indicate an intracellular function of MC related to environmental stresses especially when an oxidative stress occurred (Briand et al 2008; Dziallas and Grossart 2011; Neilan et al 2013; Zilliges et al 2011) In the complex Folia Microbiol response of cyanobacteria to abiotic stress, the activities of Hsps play important roles Cyanobacteria produce different types of Hsps upon exposure to stress (Bergmann et al 2010; Tran et al 2013; Webb et al 1990; Webb and Sherman 1994) The five main classes of Hsps are discovered to be present in cyanobacteria (Wase et al 2013) The protective effects of Hsps can be attributed to the network of the chaperone machinery (Wang et al 2004) If MC have protective role in cells facing stressful stimuli, we speculate that the expression of genes coding for Hsps might be different in an MCproducing strain and its MC-deficient mutant To test this hypothesis, the expressions of hsp genes of an MCproducing strain and its MC-deficient mutant over different periods of exposure to abiotic stress, such as high light stress (Tran et al 2013), can be compared using reverse transcription quantitative PCR (RT-qPCR) However, prior to investigating such a stress response analysis, a first step in the isolation of hsp genes (i.e., gene of interest (GOI)) is prerequisite, as the genome of Planktothrix agardhii has not been fully sequenced yet We have obtained some sequences of hsp genes from the genome project Genopole of Pasteur institute of Paris (Tran TDC, PhD thesis, 2012) In order to have representative genes of every main group of hsps, we have isolated in this present study four hsp genes including clp (hsp100), htpG (hsp 90), groEL (hsp60), and groES (hsp10) The isolation of an unknown gene is always based on the known sequences of its homologs from the other (closely or distantly related) organisms The procedure usually comprises two steps: (1) amplification of a fragment of target sequence using appropriate primers and (2) determination of uncharacterized DNA sequences flanking the fragment obtained in the first steps (genome walking) Consequently, our strategy consisted in the use of a modified version of touchdown PCR: the ramped annealing PCR (RAN-PCR) with a highly effective procedure in identification of unknown genes, the consensusdegenerate hybrid oligonucleotide primers (CODEHOP) performed with the annealing control primer (ACP) system Materials and methods DNA template Genomic DNA was extracted from the axenic strain of Planktothrix agardhii PCC 7805 using Qiagen Dneasy Blood & and Tissue kit The protocol was modified to adapt to Planktothrix agardhii (Tran TDC PhD thesis, 2012) CODEHOP primers The maximum known cyanobacterial protein sequences of each Hsp were retrieved from NCBI Protein Database These sequences were aligned using ClustalW multiple alignment program These Clustal alignments were uploaded as input to iCODEHOP (http://dbmi-icode-01.dbmi.pitt.edu/i-codehopcontext/Welcome) Amongst the potential primers proposed by iCODEHOP, for each gene, one pair of primers with lowest degeneracy and a relatively long amplicon was selected for PCR Primers were synthesized by Eurogentec (Liège Science Park, Belgium) RAN-PCR and PCR product sequencing Ramped annealing PCR (RAN-PCR) was used to amplify gene fragments using CODEHOP primers The thermal cycling program includes a preliminary denaturation step at 94 °C for min, followed by 35 cycles of (94 °C for 20 s, 65 °C for 20 s, 60 °C for s, 55 °C for s, 50 °C for s, 45 °C for 15 s, 68 °C for min), and a final extension at 68 °C for 10 RAN-PCR was performed in 50-μL total volume of reaction containing 60 mmol Tris-SO4, pH 8.9, 18 mmol ammonium sulfate, mmol MgSO4, 0.2 mmol each dNTP, 0.4 μmol each primer, 20 ng genomic DNA, U Platinum Taq DNA polymerase High Fidelity (Invitrogen) The products were checked on 1.5 % (w/v) agarose gels (Dutscher Scientific) PCR products were excised and purified from agarose gel by QIAquick Gel Extraction Kit (QIAGEN Inc USA) Purified PCR products were then TA-cloned into pGEM-T Easy vector (Promega, WI, USA) and transformed into Escherichia coli JM109 competent cells (Promega, WI, USA) After overnight incubation, the white colonies were picked, and colony PCR was conducted using M13 universal primers The positive clones were sequenced by Genoscreen (Lille, France) Sequences were compared with the database in GenBank using Blastx programs Genome walking DNA Walking SpeedUp Kit (Seegene Inc Seoul, South Korea) was used to determine the full-length genes The kit was developed from ACP technology (Hwang et al 2003) The procedure consists of three consecutive PCR using ACP primers supplied with the kit and target-specific primers (TSP) designed based on the sequences acquired in the previous stage For each upstream or downstream region to be determined, three TSPs must be designed In fact, nested PCR is incorporated in the procedure to enhance the specificity PCR products were processed, cloned, and sequenced as previously described Folia Microbiol The nucleotide sequences data reported in this study are available in the DDBJ-EMBL-GenBank database under the following accession numbers: KF275115 for the clpC gene, KF275116 for the htpG gene, KF275119 for the groES, and KF275121 for the groEL gene Results and discussion Cloning of partial sequences by RAN-PCR using CODEHOP primers There are two strategies that have been used in designing primers for unknown target: degenerate and consensus primers (Boyce et al 2009) Consensus primer has advantages in the isolation of highly conserved gene homologs, but it is very likely to fail in application to distantly related sequences (Rose et al 1998) As compared with consensus primer, the use of degenerate primer enhances the possibility of including a primer with exact complementary to an unknown target DNA sequence However, the degeneracy increases to accommodate more divergent genes, and the actual concentration of an exact match primer drops This results in a weak or undetectable band on a gel Meanwhile, the degeneracy of primers often complicates the selection of suitable annealing temperatures CODEHOP strategy overcomes shortcomings of both degenerate and consensus methods As CODEHOP primers comprise a relatively short degenerate 3′ core and a 5′ nondegenerate clamp, therein, the 3′ core degenerate is designed from only highly conserved 3–4 amino acid, and the total number of individual primers in the degenerate pool is minimized (Rose et al 1998) Indeed, most of CODEHOP primers acquired in this study had a degeneracy less than or equal to 32 GroES-F was the only primer whose degeneracy was higher than 32 (64) (Table 1) Amplification of Planktothrix agardhii PCC 7805 genomic DNA with CODEHOP primers for each target gene using RAN-PCR yielded one or several bands (data not shown) For each gene, the band(s) closest to the predicted size (Table 1) were TA-cloned and subsequently sequenced The matched gene fragments were confirmed by BLAST analysis For clp, htpG, groEL, and groES, we have obtained gene fragments of 603, 749, 913, and 150 bp, respectively (Table 2) Determination of flanking regions of target genes by DNA walking For the success of RT-qPCR, the primers should be carefully designed to satisfy stringent criteria Therefore, a full-length sequence would provide the best chance for primer selection Moreover, full-length sequence also allows a better identification of the gene For each blanking region to be determined, after three consecutive PCRs, the longest sharp products of the third PCR were purified, TA-cloned, and subsequently sequenced The whole nucleotide sequence of each target gene was obtained by analyzing the overlapping regions of the sequences isolated by CODEHOP primers and their flanking sequences determined by genome walking The full-length sizes of the target genes are presented in Table BLAST analyses showed that the obtained gene sequences had high identity with the known genes from other cyanobacteria The highest identities between the deduced amino acid sequences of the putative genes isolated from Planktothrix agardhii and their homologs from other cyanobacteria were higher or equal to 82 % (Table 3) Sequence analysis Table List of CODEHOP primers used in this study Primer name Primer sequence (5′→3′) Clp-F CCCGGCGGACCAARAA YAAYCC Clp-R GCCTCGTCCATCAGGT CDATNGCYTT GroEL- GACGTGGCCGGCGAYG F GNACNAC GroEL- GGTCTCGGTGGCGGCN R CCNACYTT GroES- CCCGACACCG F CCMRNGARAARCC GroES- CAGCTTGATGTCGGTG R CCNGCRTAYTT HtpG-F CAGATCCACACCGAGA AYATHTTYCC HtpG-R TGCAGGTTGTAGGGGT ARTCNGTRTT Degeneracy Predicted size of amplicon (bp) 629 Putative Clp The full-length gene is of 2478 bp The translated product consists of 825 amino acids The best match obtained from a local alignment search within nonredundant protein database (blastp) was with an ATP-dependent Clp protease regulatory subunit of Lyngbya sp PCC 8106 (93 % identity) 24 32 922 32 64 Table Gene fragment sizes determined by PCR using CODEHOP primers and the flanking regions determined by DNA walking Gene name Gene fragment isolated Flanking region size Full-length by CODEHOP primers (bp) gene size (bp) (bp) Upstream Downstream Clp HtpG GroEL GroES 603 749 913 150 151 16 12 16 753 586 27 242 105 1289 1204 483 57 2478 1980 1638 312 Folia Microbiol Table Summary of the best hit against non-redundant protein database for the genes isolated in the study No Gene (NCBI accession) Length of translated product (amino acid) Best hit against non-redundant protein database (NCBI Description/ accession) function Identity (%) 825 659 543 103 Lyngbya sp PCC 8106 (ZP_01620901.1) Arthrospira sp PCC 8005 (ZP_09780364.1) Lyngbya sp PCC 8106 (ZP_01624122.1) Arthrospira sp PCC 8005 (ZP_09784331.1) 93 82 91 89 clpC (KF275115) htpG (KF275116) groEL (KF275121) groES (KF275119) The sequence contains two well-conserved ATP-binding site motifs that are separated by spacer sequence that is characteristic of relatively large ATPase subunit of Hsp100 system (ClpA to ClpD) (Gottesman et al 1990; Schirmer et al 1996) In Synechococcus sp PCC 7942, two clpB genes (clpBI and clpBII) (Eriksson and Clarke 1996; Eriksson et al 2001) and one clpC gene (Clarke and Eriksson 1996) have been cloned and characterized Aligning the deduced amino acid sequence of the putative clp gene of Planktothrix agardhii isolated in this study with the amino acid sequences of ClpBI, ClpBII, and ClpC of Synechococcus elongatus PCC 7942 revealed that this Planktothrix Clp was most similar to ClpC (90 % identity) Meanwhile, it showed only 48 and 45 % sequence identity with the ClpBI and ClpBII, respectively Accordingly, the hsp100 gene of Planktothrix agardhii isolated in this study is most likely to be a clpC Putative HtpG The entire sequence of putative HtpG comprises 1980 bp The translated product is a 659-amino acid protein This protein showed the highest identity with HtpG (661 amino acids) of Arthrospira sp PCC 8005 (82 % identity) In cyanobacteria, the gene htpG was first cloned and characterized in Synechococcus sp PCC 7942 (Tanaka and Nakamoto 1999) The translated product of the putative htpG gene of Planktothrix agardhii isolated in this study showed 62 % sequence identity with HtpG of Synechococcus sp PCC 7942 Putative GroES and GroEL The full-length sequences of putative GroES and putative GroEL contain 312 and 1638 bp, respectively The translated product of GroES consists of 103 amino acids The deduced amino acid sequence of GroES had the closest sequence identity to the GroES (103 amino acids) of Arthrospira maxima CS 328, Arthrospira platensis NIES39, and Arthrospira sp PCC 8005 (89 % identity) The deduced amino acid residues of the putative GroEL consist of 545 amino Hsp 100 Hsp 90 Hsp 60 Hsp10 acids This protein showed the highest identity to GroEL (543 amino acids) of Lyngbya sp PCC 8106 (91 % identity) It was found that the ORF of GroEL is located in the downstream region of GroES, separated by a 115-bp spacer region forming a putative GroESL operon of Planktothrix agardhii (Fig 1) It has been known that all cyanobacteria usually contain two distinct hsp60/GroEL genes: GroEL1 and GroEL2 or rarely three hsp60 genes (Lund 2009) GroEL1 is accompanied with an adjacent GroES forming GroESL operon, whereas GroEL2 possesses no GroES in its neighboring region These two types of GroEL have been isolated and characterized in Synechocystis sp PCC 6803 (Chitnis and Nelson 1991; Lehel et al 1993), Synechococcus vulcanus (Furuki et al 1996; Tanaka and Nakamoto 1999), and Anabaena sp strain L31 (Rajaram et al 2001) Here, the deduced amino acid sequences of Planktothrix GroEL and GroES are remarkably conserved when compared with the GroEL1 (85–88 % identity) and GroES (75–79 % identity) from the three cyanobacteria mentioned above Meanwhile, the nucleotide sequence analysis of the upstream region of the GroES gene revealed a perfect match with a putative controlling inverted repeat of chaperone expression (CIRCE) element (TTAGCACTCAGGAGTCGAGAGTGC TAA), which is located 68 bp prior to the start codon of GroES In addition, a potential ribosome-binding (Shine Dalgarno) sequence (GGAGG) was found at bp upstream of the start codon A −35 element (TTGCAA) and a −10 element (TAAATT) which resemble a typical bacterial vegetative (σ70)dependent promoter were also found The −10 element overlaps the left arm of CIRCE element Furthermore, it was observed that a 6-bp sequence (ACTGTT) was repeated three times (60– 61 bp apart from each other) in the upstream region of the putative GroESL identified in Planktothrix agardhii Apart from this 6-bp repeat, a 7-bp inverted repeat (AACAGTT N5 AACTGTT) and K-box (GTTCGGNNAN-CCNNAC) were also found (Fig 2) Fig Schematic map of the putative GroESL operon of Planktothrix agardhii PCC7805 The ORF of GroEL is located in the downstream region of GroES, separated by a 115-bp spacer Folia Microbiol Fig Nucleotide sequence of the upstream region of the putative operon GroESL of Planktothrix agardhii The upstream region of the putative GroESL operon of Planktothrix agardhii PCC7805 contains a CIRCE element (boxed bold letters), −35 and −10 regions of the putative σ70- dependent promoter (solid line), 6-bp (ACTGTT) repeats (bold italic letters), putative Shine Dalgarno sequence (dashed line), 7-bp inverted repeat (two arrows facing each other), and a K-box element (boxed letters) The cis-acting CIRCE element has been found in more than 40 different eubacterial species including both Gramnegative and Gram-positive species (Hecker et al 1996; Narberhaus 1999; Neilan et al 2013) It has been shown to act as a negative cis-element of grpE/dnaK/dnaJ and/or groESL operons (Vanasseldonk et al 1993; Yuan and Wong 1995a; Zuber and Schumann 1994) The transcription of these operons is inhibited when the negative regulator HrcA (heat shock regulation at CIRCE elements) binds directly to CIRCE (Roberts et al 1996; Schulz and S c h u m a n n 9 ; Yu a n a n d Wo n g 9 b ) I n Synechocystis sp PCC 6803, the groE expression in the hrcA mutant is greatly induced by heat and/or light (Kojima and Nakamoto 2007) In addition, a K-box (GTTCGG-NNAN-CCNNAC) and an N-box (GATCTA) which sits in the upstream region of groESL1 may play an important role in the activation of the transcription of this operon by heat and/or light Accordingly, it was proposed that the cyanobacterial groESL expression is regulated by a putative positive mechanism mediated by K-box and Nbox in addition to the HrcA/CIRCE system (Sato et al 2008) Analysis of the upstream sequences of groESL genes from various cyanobacterial species has revealed that the CIRCE element sequence is highly conserved in most of the groESL operons except those from a couple of species of Prochlorococcus Similarly, K-box was also found to be a highly conserved sequence located upstream of the groESL promoter sequences (Sato et al 2008) In the present study, K-box but not N-box was found 39 bp prior to the CIRCE element of P agardhii The presence of K-box and the absence of N-box in the upstream region of the groESL operon were also found in Anabaena sp strain PCC 7120 and Anabaena sp strain L-31 (Kojima and Nakamoto 2007) Concerning repeat sequences, similar sequences such as an 11-bp inverted and direct repeat (CAGTTATCAGT) and a 5-bp direct repeat (ACTGT) were also found in the upstream region of Anabaena groESL operon (Rajaram et al 2001) The ATCAGTT sequence has been reported to be a common repeat found in the genome of Microcystis aeruginosa, Fischerella, Anabaena PCC 7120, Nostoc punctiforme, and Anabaena sp strain l–31 However, its location, direction, and number of repeating units vary significantly The possible role of these repeats has not been elucidated, but they may be involved in regulating the expression of the groESL operon under different environmental stress conditions (Rajaram et al 2001) Conclusions Four full-length genes of hsps including clp (hsp100), htpG (hsp 90), groEL (hsp60), and groES (hsp10) have been successfully isolated from Planktothrix agardhii PCC 7805 All the upstream and downstream sequences flanking the gene fragments were obtained using DNA Walking ACP primers In addition, the putative groES and groEL isolated in this study were found to belong to the putative groESL operon Some potential regulatory elements sitting in the upstream region of groESL were also found in this study Finally, the RAN-PCR appears to be very advantageous in amplifying unknown target sequences using degenerate primers This method opens up large perspectives about the specific acquisition of genes of interest for many purposes as transcriptional studies to compare the expression level of genes (i.e., hsps) between wild-type vs mutant strains in response to various environmental stresses This may allow a better biological and ecological understanding of the still underinvestigated cyanobacterial species (i.e., Leptolyngbya sp., Planktolyngbya sp.), for which very few sequences are deposited in databases (and any genome is available until now), despite their bloom-forming abilities with potential harmful effects in aquatic systems Acknowledgments This work was funded by ATM (“Biodiversité et rôle des micro-organismes dans les écosystèmes actuels et passés”) Folia Microbiol fellowship from the National Natural History Museum of Paris and an annual grant from Yves Rocher foundation (grant number 660/09) References Anagnostidis K, Komarek J (1988) Modern approach to the classification system of cyanophytes Oscillatoriales Arch Hydrobiol 80:327– 472 Babica P, Blaha L, Marsalek B (2006) Exploring the natural role of microcyst ins—a review of effects on photoautotrophic organisms J Phycol 42:9–20 Bergmann N, Winters G, Rauch G, Eizaguirre C, Gu J, Nelle P, Fricke B, Reusch TBH (2010) Population-specificity of heat stress gene induction in northern and southern eelgrass Zostera marina populations under simulated global warming Mol Ecol 19:2870–2883 Boyce R, Chilana P, Rose TM (2009) iCODEHOP: a new interactive program for designing COnsensus-DEgenerate Hybrid Oligonucleotide Primers from multiply aligned protein sequences Nucleic Acids Res 37:222–228 Briand E, Yepremian C, Humbert JF, Quiblier C (2008) Competition between microcystin- and non-microcystinproducing Planktothrix agardhii (cyanobacteria) strains under different environmental conditions Environ Microbiol 10: 3337–3348 Chitnis PR, Nelson N (1991) Molecular cloning of the genes encoding chaperone proteins of the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem 266:58–65 Clarke AK, Eriksson MJ (1996) The cyanobacterium Synechococcus sp PCC 7942 possesses a close homologue to the chloroplast ClpC protein of higher plants Plant Mol Biol 31:721–730 Dziallas C, Grossart HP (2011) Increasing oxygen radicals and water temperature select for toxic Microcystis sp Plos One 6: e25569 Eriksson MJ, Clarke AK (1996) The heat shock protein ClpB mediates the development of thermotolerance in the cyanobacterium Synechococcus sp strain PCC 7942 J Bacteriol 178:4839–4846 Eriksson MJ, Schelin J, Miskiewicz E, Clarke AK (2001) Novel form of ClpB/HSP100 protein in the cyanobacterium Synechococcus J Bacteriol 183:7392–7396 Fastner J, Erhard M, Carmichael WW, Sun F, Rinehart KL, Ronicke H, Chorus I (1999) Characterization and diversity of microcystins in natural blooms and strains of the genera Microcystis and Planktothrix from German freshwaters Archiv Hydrobiol 145: 147–163 Furuki M, Tanaka N, Hiyama T, Nakamoto H (1996) Cloning, characterization and functional analysis of groEL-like gene from thermophilic cyanobacterium Synechococcus vulcanus, which does not form an operon with groES BBA- Protein Struct M 1294:106–110 Gottesman S, Squires C, Pichersky E, Carrington M, Hobbs M, Mattick JS, Dalrymple B, Kuramitsu H, Shiroza T, Foster T, Clark WP, Ross B, Squires CL, Maurizi MR (1990) Conservation of the regulatory subunit for the Clp ATPdependent protease in prokaryotes and eukaryotes Proc Natl Acad Sci U S A 87:3513–3517 Hecker M, Schumann W, Volker U (1996) Heat-shock and general stress response in Bacillus subtilis Mol Microbiol 19:417–428 Hwang IT, Kim YJ, Kim SH, Kwak CI, Gu YY, Chun JY (2003) Annealing control primer system for improving specificity of PCR amplification Biotechniques 35(6):1180–1184 Kojima K, Nakamoto H (2007) A novel light- and heat-responsive regulation of the groE transcription in the absence of HrcA or CIRCE in cyanobacteria Febs Lett 581:1871–1880 Lehel C, Los D, Wada H, Gyorgyei J, Horvath I, Kovacs E, Murata N, Vigh L (1993) A 2nd groel-like gene, organized in a GroESL operon is present in the genome of Synechocystis sp PCC-6803 J Biol Chem 268:1799–1804 Lund PA (2009) Multiple chaperonins in bacteria—why so many? Fems Microbiol Rev 33:785–800 Narberhaus F (1999) Negative regulation of bacterial heat shock genes Mol Microbiol 31:1–8 Neilan BA, Pearson LA, Muenchhoff J, Moffitt MC, Dittmann E (2013) Environmental conditions that influence toxin biosynthesis in cyanobacteria Environ Microbiol 15:1239–1253 Pearson L, Mihali T, Moffitt M, Kellmann R, Neilan B (2010) On the Chemistry, Toxicology and genetics of the cyanobacterial toxins, microcystin, nodularin, saxitoxin and cylindrospermopsin Mar Drugs 8:1650–1680 Rajaram H, Ballal AD, Apte SK, Wiegert T, Schumann W (2001) Cloning and characterization of the major groESL operon from a nitrogen-fixing cyanobacterium Anabaena sp strain L-31 BBAGene Struct Expr 1519:143–146 Roberts RC, Toovhinda C, Avedissian M, Baldini RL, Gomes SL, Shapiro L (1996) Identification of a Caulobacter crescentus operon encoding hrcA, involved in negatively regulating heat-inducible transcription, and the chaperone gene grpE J Bacteriol 178:1829– 1841 Rose TM, Schultz ER, Henikoff JG, Pietrokovski S, Mc callum CM, Henikoff S (1998) Consensus-degenerate hybrid oligonucleotide primers for amplification of distantly related sequences Nucleic Acids Res 26:1628–1635 Sato S, Ikeuchi M, Nakamoto H (2008) Expression and function of a groEL paralog in the thermophilic cyanobacterium Thermosynechococcus elongatus under heat and cold stress Febs Lett 582:3389–3395 Scheffer M, Rinaldi S, Gragnani A, Mur LR, Vannes EH (1997) On the dominance of filamentous cyanobacteria in shallow, turbid lakes Ecology 78:272–282 Schirmer EC, Glover JR, Singer MA, Lindquist S (1996) HSP100/Clp proteins: a common mechanism explains diverse functions Trends Biochem Sci 21:289–296 Schulz A, Schumann W (1996) hrcA, the first gene of the Bacillus subtilis dnaK operon encodes a negative regulator of class I heat shock genes J Bacteriol 178:1088–1093 Sivonen K, Jones G (1999) Cyanobacterial toxins In: Chorus I, Bartram J (eds) Toxic Cyanobacteria in Water A guide to their public health consequences, monitoring and management E and F.N Spoon, London Stephanou A, Latchman DS (2011) Transcriptional modulation of heatshock protein gene expression Biochem Int: e238601 Tanaka N, Nakamoto H (1999) HtpG is essential for the thermal stress management in cyanobacteria Febs Lett 458:117–123 Tran TDC, Bernard C, Ammar M, Chaouch S, Comte K (2013) Heat shock transcriptional responses in an MC-producing cyanobacterium (Planktothrix agardhii) and its MC-deficient mutant under high light conditions PlosOne 8:e73198 Vanasseldonk M, Simons A, Visser H, Devos WM, Simons G (1993) Cloning, nucleotide-sequence, and regulatory analysis of the Lactococcus lactis DNAJ gene J Bacteriol 175:1637–1644 Wang WX, Vinocur B, Shoseyov O, Altman A (2004) Role of plant heatshock proteins and molecular chaperones in the abiotic stress response Trends Plant Sci 9:244–252 Wase NV, Yen SO, Wright PC (2013) A global understanding of light stress in cyanobacteria: environmental and bioproducts perspectives In: Srivastava AK, RaiAN, Neilan BA (eds.) Stress Biology of Cyanobacteria: Molecular Mechanisms to Cellular Responses CRC Press Folia Microbiol Webb R, Sherman LA (1994) The cyanobacterial heat-shock response and the molecular chaperones The molecular biology of cyanobacteria Adv Photosynth 1:677–692 Webb R, Reddy KJ, Sherman LA (1990) Regulation and sequence of the Synechococcus sp strain PCC 7942 GroESL operon, encoding a cyanobacterial chaperonin J Bacteriol 172:5079–5088 Whitton BA, Potts M (2000) In: Whitton BA, Potts M (eds) The ecology of cyanobacteria Kluwer, Dordrecht, The Netherlands Yuan G, Wong SL (1995a) Isolation and characterization of Bacillus subtilis GroE regulatory mutants—evidence for ORF39 in the DnaK operon as a repressor gene in regulating the expression of both groE and DnaK J Bacteriol 177:6462–6468 Yuan G, Wong SL (1995b) Regulation of GroE expression in Bacillus subtilis—the involvement of the sigma(a)-like promoter and the roles of the inverted repeat sequence (CIRCE) J Bacteriol 177: 5427–5433 Zilliges Y, Kehr JC, Meissner S, Ishida K, Mikkat S, Hagemann M, Kaplan A, Boerner T, Dittmann E (2011) The cyanobacterial hepatotoxin microcystin binds to proteins and increases the fitness of Microcystis under oxidative stress conditions Plos One DOI: 10-1371/ journal.pone 0017615 Zuber U, Schumann W (1994) CIRCE, a novel heat-shock element involved in regulation of heat-shock operon DnaK of Bacillus subtilis J Bacteriol 176:1359–1363 ... of the putative clp gene of Planktothrix agardhii isolated in this study with the amino acid sequences of ClpBI, ClpBII, and ClpC of Synechococcus elongatus PCC 7942 revealed that this Planktothrix. .. Fig Nucleotide sequence of the upstream region of the putative operon GroESL of Planktothrix agardhii The upstream region of the putative GroESL operon of Planktothrix agardhii PCC7805 contains... also found (Fig 2) Fig Schematic map of the putative GroESL operon of Planktothrix agardhii PCC7805 The ORF of GroEL is located in the downstream region of GroES, separated by a 115-bp spacer Folia