Electrochemical synthesis of polypyrrole nanowires and application of biosensor

MINISTRY OF EDUCATION AND TRAINING HANOI UNIVERSITY OF SCIENCE AND TECHNOLOGY INTERNATIONAL TRAINING INSTITUTE FOR MATERIALS SCIENCE BUI DAI NHAN ELECTROCHEMICAL SYNTHESIS OF POLYPYRROLE NANOWIRES AND APPLICATION OF BIOSENSOR MASTER OF SCIENCE THESIS MATERIALS SCIENCE SUPERVISOR : Dr MAI ANH TUAN HANOI - 2011 Bui Dai Nhan 2011 Master Thesis ACKNOWLEDGMENTS I would like to express my appreciation to my supervisor, Dr Mai Anh Tuan for his guidance patience, advice and support during the course at International Training Institute for Materials Science (ITIMS) I would like to express my sincere gratitude to Prof Tran Trung, Hung Yen University of Education and Technology for giving me a chance to attend master course in ITIMS and providing me the necessary facilities for my master thesis My very special thanks goes to my co-supervisor M.Sc Luu Manh Quynh, Institute of Materials Science, Hanoi University of Science, for his endless guidance Without his advice and technical support, this thesis would never been written I wish to thank to my friend Tran Thi Trang for her friendship and cooperation, thank to Eng Phuong Trung Dung who has helped me in doing measurements I am indebted to the teaching ITIMS for their motivation and support, particularly the friendly and helpful manner of ITIMS staffs will remain in my mind, especially the members of Biosensor group in ITIMS for sharing friendly research environment Many thanks to my friends who have encouraged me during the time of study Above all, I am grateful to my beloved family, especially my father who always be with me with endless encouragement, inspiration and love ITIMS, Hanoi, November 2011 Bui Dai Nhan 2011 Master Thesis I hereby declare that all the result in this document has been obtained and presented in accordance with academic rules and ethical conduct I also declare that, as required by these rules and conduct, I have fully cited and referenced all material and results that are not original to this work The author of this thesis Bui Dai Nhan Bui Dai Nhan 2011 Master Thesis CONTENTS Acknowledgement Reassure words Contents List of Abbreviation List of Table List of Figure Preface Chapter1 INTRODUCTION 1.1 Overview of conducting polymers 11 1.1.1 Introduction 11 1.1.2 Historical back ground of the development of conducting polymers 13 1.1.3 Mechanism of electrical conduction in CPs 15 1.1.4 Current synthesis of conducting polymers 17 1.2 Polypyrrole (PPy) and Electrochemical polymerization of PPy 18 1.2.1 Properties of Polypyrrole 18 1.2.2 Electrochemical synthesis of Polypyrrole 20 1.2.3 Effect of Synthesis conditions on Electrochemical Polymerization 26 1.3 Application of Biosensors 27 1.3.1 General Introduction to DNA sensor 28 1.3.2 Immobilization of probe DNA on polymer based electrode 34 1.4 Aim of the Study 36 Chapter 2: EXPERIMENTS 37 2.1 Electrochemical polymerization of polypyrrole 37 2.1.1 Materials 37 2.1.2 Instrumentation 37 2.1.3 Experiment procedure 40 2.2 DNA immobilization and measurement Setup 42 2.2.1 Chemicals 42 2.2.2 DNA strand immobilization 42 Bui Dai Nhan 2011 Master Thesis 2.2.3 Measurement setup 44 Chapter 3: RESULTS AND DISCUSSIONS 48 3.1 Electrochemical synthesis of PPy nanowires 48 3.1.1 Electroactivities of Polypyrrole 48 3.1.2 Effects of parameters on electrochemical polymerization of polypyrrole 51 3.1.3 Chemical composition and functional groups of obtained PPy nanowires 60 3.2 DNA sensors characteristics 70 3.2.1 Characteristics of DNA sensor is a function of time 70 3.2.2 Hybridization detection using DNA sensor 71 3.2.3 The reproducibility of DNA sensor 73 CONCLUSION 76 RECOMMENDATIONS Error! Bookmark not defined REFERENCES 78 Bui Dai Nhan 2011 Master Thesis LIST OF ABBREVATION CPs Conducting Polymers PPy Polypyrrole PAc Polyacetylene PAni Polyaniline PTh Polythiophene WE Working Electrode CE Counter Electrode RE Reference Electrode DNA Deoxyribonucleic Acid PCR Polymerase Chains Reaction EDC 1-Ethy-3-(3-dimethyl-aminopropyl)-carbodiimide MIA 1-methyl-imidazole VB Valence Band CB Conduction Band PBS Phosphate Buffer Solution SEM Scanning Electron Microscopy FT-IR Fourier Transform Infrared Spectroscopy SERS Surface Enhanced Raman Spectroscopy Bui Dai Nhan 2011 Master Thesis LIST OF TABLE Table 1.1 The chronology of the development of some important conducting polymers Table 1.2 Advantages and disadvantages of chemical and electrochemical synthesis of conducting polymers Table 1.3 Advantages and Disadvantages of Chemical and Electrochemical synthesis of PPy Table 1.4 History of biosensor development Table 2.1 DNA sequence used in this work Table 3.1 Current density (mA/cm2) vs added volume of pyrrole monomer (mL) Table 3.2 Current density (mA/cm2) vs different concentration of gelatin (%wt) Table 3.3 Current density (mA/cm2) vs Reaction time (second) Table 3.4 Absoption peaks in FT-IR spectrum Table 3.5 Comparison between SERS peaks in this work and and those in literature Bui Dai Nhan 2011 Master Thesis LIST OF FIGURE Figure 1.1 Conductivity of conducting polymer compared with other materials Figure 1.2 Three typical types of conducting polymer Figure 1.3 Band theory and doping-induced structural transitions of polypyrrole Figure 1.4 Three steps of polymerization process of Polypyrrole Figure 1.5 Aromatic and Quinoid structrure of PPy Figure 1.6 Three electrode setup for electrochemical synthesis composed of working electrode (WE), counter electrode (CE) and Reference electrode (RE) Figure 1.7 Cyclic voltammogram of PPy nanowires and cauliflower-like in KCl solution at scan rate of 25 mV/s Figure 1.8 Potentiostat curve of the synthesis of PPy on Nikel electrode and ITO electrode Figure 1.9 A typical structure unit of gelatin polypeptide Figure 1.10 The schematic of a biosensor Figure 1.11 General DNA sensor design based on CPs Figure 1.12 The principle of DNA sensor Figure 1.13 The total biosensors market showing the world revenue forecast for 2009–2016 Figure 1.14 Four base types of DNA Figure 1.15 Hydrogen bonds between the A-T and G-C bases of the two trands of DNA Figure 2.1 Schematic of electrochemical synthesis system of polypyrrole Figure 2.2 Covalent immobilization between PPy films and phosphate DNA on Pt micro-electrode using EDC, MIA catalysts Figure 2.3 Differential measurement using Lock-in Amplifier Figure 2.4 The wave form of the Lock-in Amplifier SR830 Figure 2.5 Equivalent electrical circuit of differential system Bui Dai Nhan 2011 Master Thesis Figure 3.1 Cyclic voltammogram of Ppy between -1.0 V and +1.0 V at 250 mV/s scan rate Figure 3.2 Potentiostatic polymerization curve for the electrodeposition of Polypyrrole Figure 3.3 Potentiostatic curves for the electrodeposition of Polypyrrole from 0.1M LiClO4 electrolyte at different conditions Figure 3.4 The saturated current density of the electrochemical curve vs.pyrrole monomer concentration Figure 3.5 SEM images of Ppy structrures synthesized at different added volume of pyrrole Figure 3.6 The current density recorded vs different concentration of gelatin Figure 3.7 SEM images of Ppy structures potentiostatically synthesized at different of gelatin concentration Figure 3.8 The current density recorded vs different sweeping (reaction time) Figure 3.9 SEM images of Ppy structures potentiostatically synthesized at different reaction time Fig 3.10 Morphologies of PPy nanowires prepared at optimized condition Figure 3.11 FI-IR spectra of obtained Ppy nanowires Fig 3.12 Path of the stylus over the sample in the measurement of Pt thickness Figure 3.13 The thickness of Platinum film Fig 3.14 Distribution of PPy nanowires over Pt surface electrode Figure 3.15 Surface Enhanced Raman Spectroscope of polypyrrole film deposited on Platinum surface Figure 3.16 Response time and Reaction time of the DNA sensor Figure 3.17 The curve of DNA sequence hybridization, CDNA probe =0.05M, T=3000K Figure 3.18 The reproducibility of DNA sensor Bui Dai Nhan 2011 Master Thesis PREFACES Recently, Polypyrrole (PPy) is one of the most extensively used conducting polymers in biosensor designs due to its good biocompatibility and polymerization at neutral pH [30] The electronic structure of PPy is highly sensitive to change in polymeric chain environment and other perturbations in the chain conformation caused by, for example, a biological recognition event such as DNA hybridization [30] The changes in the delocalized electronic structure can provide a signal for the presence of a target analyte molecule These advantages of conducting PPy make them suitable for biosensors and chemical sensors which play important role in public health and environment [18] The drawback of DNA sensor based PPy membrane includes limited sensitivity and reproducibility due to the low conductivity of PPy in film and cauliflower-like form, presented in previous work (1) In this thesis, we aim at the synthesis of PPy nanowires using electrochemical technique with the desire of obtaining better characteristics of DNA sensor for Ecoli bacteria DNA detection The synthesis of PPy nanowires was obtained by using potentiostat method at 0.75V, in LiClO4 0.1M (PBS, pH =7) electrolyte containing 0.5 mL pyrrole monomer and 0.08%wt gelatin It should be noted that gelatin is used as a ‘soft template’ to orientate the growth of PPy nanowires The PPy nanowires 50 nm of diameter provide large and fine surface Especially, N-H group of PPy nanowires was orientated upward from the surface which takes advantage for DNA probe immobilization As the result, the DNA based PPy nanowires has good characteristics for Ecoli DNA detection, including a short response time (~10 seconds), small detection limit (0.1 nM) as well as good reproducibility (1) P.D Tam et al / Materials Science and Engineering C 30 (2010) 1145–1150 Bui Dai Nhan 2011 Master Thesis Additionally, the peaks at 1560 cm-1 and 1610 cm-1 are theoretically assigned to the C=C backbone stretching of reduced and oxidized PPy nanowire, respectively [45] However, as presented in Fig 3.15 we just observe only a peak at 1592.6 cm-1, indicating an overlapped the two peaks It can be seen that this prominent peak is closer to the oxidized PPy peak (approximately 1610 cm -1) Qualitatively, it can be supposed that oxidized state of PPy dominated the whole peak of C=C backbone stretching It demonstrates that oxidation potential was well-controlled during the whole process in potentiostat mode, leading to the formation of oxidized units of PPy over the electrode’s surface Furthermore, as above mentioned, the higher oxidized level of PPy was, the higher conductivity measured The conductivity of PPy is strongly increased with the Raman peak intensity of oxidized PPy, reveals in both C-H in-plane deformation of oxidized PPy and C=C stretching of oxidized PPy Firstly, as presented in Fig 3.15, the double peaks at 1044 cm-1 and 1086 cm-1 in SERS are assigned to be the C-H in- plane deformation of oxidized PPy [46] It is interesting to observe the enhancement of the peak at 1044 cm-1 ascribed to the C-H bending vibration was directly related to the increased doping level of ions in the PPy shell [36] The presence of this peak can be explained that anions participated as dopants during PPy polymerization, including phosphate and perchlorate group discussed in FT-TR spectra in Fig 3.11 However, phosphate group doesn’t appears in SERS spectra, it might be a result of that was not located near Platinum surface 67 Bui Dai Nhan 2011 Master Thesis Peaks (cm-1) in this Peaks (cm-1) shown work in the literature 931 932 972 972, 984, 998 Ring deformation 1044, 1086 1044 C-H in plane deformation 1244 1300 N-H in plane deformation 1377 1326,1392 Ring stretching ~ aromatic 1592 1560~1630 C=C backbone stretching~ Quinoid Peak assignments Table 3.5 Comparison between SERS peaks in this work and those in literature Based on SERS spectra of Pt/PPy nanoparticle, we tried to understand the influence of the doping level in conducting polymer shell on the properties of sample After analyzing carefully, we find that the peak of C-H bending vibration was found to be enhanced with the increase in content of anion ( , ) The role of doping of PPy in charge transfer process can be explained according to the polaron-bipolaron theory It is believed that doping should alter the local Fermi level, results in the formation of polarons and bipolarons and their energy gaps which are smaller than the gap of undoped state [36] Moreover, the higher doping level of PPy indicating higher density and mobility of polarons and bipolarons, contributing to an enhancement of conductivity of PPy The peak at 1377 cm-1 is assigned to the ring stretching of pyrrole, represent the presence of aromatic form of PPy prepared in electrochemical polymerization Also, it can be said that PPy rings are close to Platinum surface, thus the peak is strongly 68 Bui Dai Nhan 2011 Master Thesis enhanced Moreover, although the C=C stretching vibration is not typical in PPy structure, the enhanced peak is still very sharp and high Hence, the entire C=C linkages in pyrrole chain might be arranged near Pt surface Above all, the most exciting peak is 1244 cm-1 is assigned to the vibration of β(CH)/δ(NH) [41] In our study, the peak of N-H appears but the position shifts to a lower wavenumber compared with the peak at 1300 cm -1 of N-H in literature [45] In addition, the amplitude of the peak at 1244 cm -1 is much smaller than that of peak at 1592 cm-1 indicating a weak enhanced peak, thus N-H groups are entirely orientated upward and far from the surface of the membrane which is believed to facilitate the DNA immobilization This is the most interesting result achieved from our study which has not been presented in other studies [11] In other respect, this may be ascribed to the change in chemical structure of PPy, indicating that gelatin is not only used as a ‘soft template’ for PPy growth, but also plays an important role in the orientation of N-H group on the surface of PPy membrane In summary, SERS spectrum proves the information about chemical structure and comparatively evaluates the conductivity (will be further discussed in the next part) of obtained PPy nanowires Besides, the result from SERS spectrum contains helpful information about a potential DNA sensor application trend, which is the right target of this study 69 Bui Dai Nhan 2011 Master Thesis 3.2 DNA sensors characteristics 3.2.1 Characteristics of DNA sensor is a function of time It is known that the charges (electron, ion) are released on the conductive membrane at the moment when DNA target come into hybridization with DNA probe This leads to an increase of the membrane’s conductance, and hence an increase of output signals Figure 3.16 Response time and Reaction time of the DNA sensor In Fig 3.16, a drop of target DNA nM was added into 200L cell Interestingly, it can be seen that the response time is very short (a few seconds) After the first jump step of output signal, the conductivity observed is constant after 2÷3 minutes However, to avoid fluctuation of output signal, the reaction time chosen for the next measurements is minutes After hybridization, the DNA double helix cannot split by itself, so the recovery time was not observed 70 Bui Dai Nhan 2011 Master Thesis 3.2.2 Hybridization detection using DNA sensor The DNA-modified sensor surface was used to determine the concentration of the target DNA sequence inside the sample To read out the hybridization signal, the probe DNA-attached sensor is soaked into a measuring cell filled with 200 L of double distilled water Sample concentration was controlled by adding a same volume of 5nM target DNA, respectively The conductivity output signal presented the DNA matching between the probe and the target DNA sequences, was recorded by measuring voltage drop on two k resistances using A and B channels of the Lock-in amplifier interfaced with a computer Figure 3.17 The curve of DNA sequence hybridization, CDNA probe = 0.05M, T=3000K A DNA double helix forms on the surface of the sensor when target/immobilized DNA matching occurs Such a strong hybridization is detected by a 71 Bui Dai Nhan 2011 Master Thesis change in the conductance of the conductive membrane on the sensor surface, leading to a change in the output signal of the system The sensor can detect as low as 0.1 nM of E.Coli target DNA (20 bases) In Fig 3.17, the hybridization illustrated by a linear curve, describing the relationship between the DNA target concentration and the DNA sensor output signal Basically, selectivity of a DNA sensor is strongly influenced by the hybridization of DNA strands, which follows strictly the law discovered by Chargaff E in 1951 In case of the matching between the DNA probe and DNA target strand, the conductivity depends linearly on the concentration of DNA target strand Y = A + BX Where: Y (∆σout ) : Conductivity (mS); X : The concentration of DNA target sequence in sample-cell (M) B : The background signal, usually at zero (mV) The sensitivity of DNA sensor can be calculated by determining the slope value in the equation of the linear curve As a result, we found out: Equation Y = AX+B Adj.R – Square 0.9849 Value Standard Error Intercept A 0.172 0.02861 Slope B 0.130 0.00448 72 Bui Dai Nhan 2011 Master Thesis This value of slope is 0.13 with a negligible standard error (0.48%), which means that the sensitivity of the DNA sensor is 0.13 mS/nM ~ 13 mV/nM (Formula 2.8), indicating an excellent sensitivity 3.2.3 The reproducibility of DNA sensor The first measurement (3.2.2) demonstrates that the DNA sensor works properly with sensitivity of 0.13 mS/nM However, the biomaterials are degraded over the time Therefore, we need to verify the reproducibility of the DNA sensor by measuring rematching process of that sensor after thermal denaturation process In this work, the DNA sensor used was immersed in a breaker at T>Tm (melting point of DNA double helix) and then quickly freezed in an ice bath for minutes to obtain the single DNA strand Firstly, we need to determine the melting point of DNA double helix on the DNA sensor used i) The melting point of DNA double helix The melting temperature of DNA probe depends on its length and can be calculated by the formula (4.1) discovered by Marmur and Doty, 1962 Tm = 69.3 + 0.41(G + C) (4.1) Whereas: G,C: the number of G-type and C-type nucleotide in DNA strand, respectively In this case, the DNA has 20 nucleotides (AACGCCGATACCATTACTTA), so G = 2, C = Substituted from (4.1), we have: Tm (DNA probe) = 69.3 + 0.41×(2+6) = 72.58oC 73 Bui Dai Nhan 2011 Master Thesis The theoretical melting temperature of DNA proble is 72.58oC, the point where the DNA double helix can splits into two DNA strands ii) Reproducibility of the DNA sensor As calculated above, we determine Tm = 78.280C, theoretically In our experiment, DNA sensor was immersed into double distilled water at 850C for minutes (to get complete denaturation) and then quickly freezed in an ice bath for minutes to obtain the single DNA strand Afterwards, the DNA sensor was immersed into the cell containing the sample to detect the DNA target as the second time The different output signal between the matching and rematching is illustrated in Fig 3.18 Figure 3.18 The reproducibility of DNA sensor C(probe)= 0.05M As presented in Fig 3.18, the output signal of the DNA sensor changes slightly compared with that before denaturation (Δδ= 5.3%) 74 Bui Dai Nhan 2011 Master Thesis To test the stability of fabrication technique, some measurements were carried out by using different sensors (prepared at the same condition) with the same DNA target concentration variation and DNA probe (0.05M) immobilized on the surface electrode The calculated result indicated that the relative standard deviation of the output signal of these sensors was approximately 9% This result recommends that the DNA sensor is reproducible and reusable 75 Bui Dai Nhan 2011 Master Thesis CONCLUSION Although there are numerous studies on PPy based DNA sensor, our study achieved some interesting results summerised in this section The synthesis of PPy nanowires was obtained by using potentiostat method in the presence of gelatin In which:  The polymerization potential is 0.75V; the supporting electrolyte used was LiClO4 0.1M (PBS, pH =7); the proper synthesis condition was established with 0.5 mL pyrrole monomer; 0.08% wt gelatin; 400 seconds of reaction time  The morphologies, chemical composition and functional groups were studied based on SEM, FI-IR and Surface Enhanced Raman Spectroscopy (SERS) technique It supposes that gelatin incorporated as “soft template” for PPy nanowire growth As the result, the N-H bond was orientated upward Platinum electrode surface which is believed an advantage for the DNA probe immobilization  The Ppy nanowires are 50 nm (diameter), very consistent, and suitable for DNA sensor application The immobilization of the DNA sequence on the surface of the sensor was carried out based on the linkage between NH–group of PPy conducting polymer and phosphate groups of probe DNA The output signal of the hybridization DNA probe–DNA target was recorded by Lock-in Amplifier SR 830 The response time of the DNA sensor is 10 seconds The detection limit is as low as 0.1 nM of E.Coli bacteria DNA (20 bases) concentration at ambient temperature The detection limit is better than that of our previous result (2nM) (1) The first experiments shows that the sensor has good reproducibility (1) P.D Tam et al / Materials Science and Engineering C 30 (2010) 1145–1150 RECOMMENDATIONS 76 Bui Dai Nhan 2011 Master Thesis The structures and hence the properties of the resulting polypyrrole are strongly influenced by a number of parameters that are not perfectly controlled Besides pyrrole monomer, gelatin and reaction time, other work should study on effect of other factors (nature of electrode, temperature, component of couterion, ect.) on properties of PPy nanowires Especially, PPy polymerization should be further investigated in the presence of dopants like Ag, Au, Ti which is expected to gain more interesting properties of PPy nanowires for various application For DNA sensor, the reproducibility should be further conducted for statistic evaluation 77 Bui Dai Nhan 2011 Master Thesis REFERENCES [1] A Angeli (1916) Gazz Chem Ital 42, 279 [2] A G MacDiarmid et al (1983), Polarons and Soliton Model in doped polyacetylene, J De Physique C3, 513 [3] A Moser, H Neuebauer, K Maurer, J Theiner, A Neckel(1992), Springer Series Solid State Sci, 107, 276 [4] A.Ye Pelekh, V.I.Krinichnyi et al (2003), An EPR study of the relaxation parameters in polyacetylene, Polymer Science U.S.S.R, Volume 33, Issue 8, 1991, 1615-1623 [5] Aunar Kassim, H.N.M Ekarmul Mahmud et al.(2006), Electrochemical preparation and characterization of polypyrrole–polyethylene glycol conducting Polymer Composite Films, The Pacific Journal of Science and Technology, volume 7, 104-105 [6] Baibarac, M.; Lapkowski, M.; Pron, A.; Lefrant, S.; Baltog (1998), I J Raman Spectrosc , 29, 825 [7] C.J Zhong, Z.Q Tang, Z.W Tian (1990), J Phys Chem 94, 2171 [8] C.K Chiang, C R Fischer, Y W Park, A J Heeger, H Shirakawa, E J Louis, S.C Gau, A G MacDiarmid (1977), Phys Rev Letters, 30, 1098 [9] Charles M Jenden, Richard G Davidson and Terrence G Turner, A Fourier transform – Raman spectroscopic study of electrochemical polypyrrole film, Australia, 3032 [10] Dall’olio, Y Dascola and G P Grandini (1969), C.R Acad Sci 267, 4336 [11] Dongtao Ge, Jing Mu, Sanquing Huang et al (2010), Electrochemical synthesis of polypyrrole nanowires in the presence of gelatin Synthetic Metal, 11, 016 [12] D.G Shchukin, K Kohler, H Mohwald(2006), J Am Chem Soc 128, 4560 [13] E Noelting (1989), Scientific and Industrial History of Anilin black, J Matheson, New York [14] G Natta, G Mazzanti (1958), P Corradini, Atti Accad Lincei Cl Sci Fis Mat Nat Rend, 25, 78 Bui Dai Nhan 2011 Master Thesis [15] G.P Gardini (1973), Adv Heterocycl Chem 15, 67 [16] H Shirakawa, F J Louis, A G MacDiarmid, C K Chiang, A J Heeger (1977), J Chem Soc., Chem Commun 578 [17] Hesse, E (1999); Creighton, J A Langmuir, 15, 3545 [18] Hui Peng, Lijuan, Christian Soeller, Jadranka Travas-Sejdic, Conducting polymers for electrochemical DNA sensing, Biomaterials 30 (2009), 2132-2148 [19] Joji J Anchanattu (1994), Preparation of Certain conducting polypyrroles and Study on their Physical Properties, Mahatma Gandhi University, 9-13 [20] J L Breadas, B Themans and J.M Andre (1984), The role of mobile organic radicals and ions in the transport properties of doped conjugated polymers, Synthetic Metals, 9, 265-274 [21] J.W Goodwin, G.M Markham, B Vinent(1997), J Phys Chem B 101 1961 [22] L Letheby (1862), J.Chem Soc 15, 161 [23] Lam T D, Binh N.H, Thinh N N, Hien L T, Chie N D (2004), Fabrication and characterization of microscale DNA sensor, the Second International Workshop on Nanophysics and Nanotechnology (IWONN’04), Ha Noi, 22-23, p177-180 [24] Liver, N.; Nitzan, A.; Gersten (1984), J Chem, Phys Lett, 111, 449 [25] M.D Ingram, H Staesche, K.S Ryder (2004), J Power Source 129, 107 [26] M.Fleischman, P.J.Hendra, A McQuillan(1974), J Chem Phys Lett 26, 123 [27] Metin ak, Synthesis of polythiophene and polypyrrole derivatives and their application in electrochromatic devices, doctoral thesis in physics, (2006) 10 [28] Nathalie K Guimard et al (2007), Conducting polymers in biomedical engineering, Sci [29] Nguyễn Đình Triệu (2000), Các phương pháp phân tích vật lý hoá lý, tập I, Khoa học kỹ thuật [30] Ramanavicius A, Ramanaviciene A, Malinauskas A (2006), Electrochemical sensors based on conducting polymer-pyrrole Electrochem Acta; 51(27): 28793 79 Bui Dai Nhan 2011 Master Thesis [31] Reza Ansari (2006), Polypyrrole Conducting electroactive Polymers: Synthesis and Stability Studies, E-Journal of Chemistry, vol.3, 186-201 [32] S Cosnier, R E Ionescu, S Herrmann, L Bouffier, M Demeunynck, R S Marks (2006), Anal Chem 78, 7054 [33] S.M.Sze(1986), Semiconductor sensor, John Wiley&sons [34] S SChantz, L.M Torell (1988), J.R Stevens Appl Phys 64, 2038 [35] Standford Research System (1999), Manual book of Lock-in Amplifier-model SR830 [36] Sunjie, Li Fang, Xutang Oing and Yun Lu (2010), Surface-enhanced Raman scattering study of Ag@PPy nanoparticles, Journal of Raman Spectroscopy, 41, 119-1123 [37] Syritski V, Idla K, Opik A (2004) Synthesis and redox behavior of PEDOT/PSS and PPy/DBS structures Synthetic Metals, 144: 235-239 [38] Thevenot, D.R; Toth; Durst, R.A.; Wilson (1999), G.S Electrochemical biosensors; Recommended definitions and classification, Pure Appl Chem, 71, 2333-2348 [39] Tian, G Zebri (1990), J Chem Phys 92, 3892 [40] Walt R J and Bargon J (1984), Tedrahedron, 40 (20), 3963-3970 [41] Wenqin Wang et al (2010), Controlled fabrication of surface-enhanced-Raman scattering-active silver nanostructures on polypyrrole films, Materials Chemistry and Physics 124, 385-388 [42] William Andrew (1989), Inherently conducting polymers: processing, fabrication, applications and limitations, doping of conjugated polymers, 40-42 [43] Xiuhua Wang, Mingwang Shao, Guang Shao, Yan Fu, Shaowu Wang (2009), Reversible and efficient photocurrent switching of ultra-long polypyrrole nanowires, Synthetic Metals 159, 273-276 Y.C Liu (2004), J Electroanal Chem 571, 255 [44] [45] Yu-Chuan Liu, Bing-Joe Hwang, Wen-Jie Jian, Raman Santhanam (2000), In stitu cyclic voltammetry-surface-enhanced Raman spectroscopy, Thin Solid Films 374, 85-91 80 Bui Dai Nhan 2011 Master Thesis [46] Yu-chuan Liu et al (2008), Studies of thermal decay of electropolymerized polypyrrole, Electrochemistry Communications 10, 161-164 [47] Yu-Chuan Liu (2004), Characteristic of vibration modes of polypyrrole on surface-enhanced Raman scattering spectra, Journal of Electroananlytical chemistry 571, 255-264 81 ... surface of electrode Table 1.3 Advantages and Disadvantages of Chemical and Electrochemical synthesis of polypyrrole Chemical synthesis is a simple and fast process to procedure fine powders of PPy... 1.14 Four base types of DNA Figure 1.15 Hydrogen bonds between the A-T and G-C bases of the two trands of DNA Figure 2.1 Schematic of electrochemical synthesis system of polypyrrole Figure 2.2... Current synthesis of conducting polymers 17 1.2 Polypyrrole (PPy) and Electrochemical polymerization of PPy 18 1.2.1 Properties of Polypyrrole 18 1.2.2 Electrochemical synthesis