Molecular cloning and expression analysis of a heat shock protein (Hsp90) gene from black tiger shrimp (Penaeus monodon)

Abstract The techniques of homology cloning and anchored PCR were used to clone the Hsp90 gene from black tiger shrimp. The full length cDNA of black tiger shrimp Hsp90 (btsHsp90) contained a 5 0 untranslated region (UTR) of 72 bp, an ORF (open reading frame) of 2160 bp encoding a polypeptide of 720 amino acids with an estimated molecular mass of 83kDa and a 3 0 UTR of 288 bp. The sequence of the coding region showed 90 and 84% homology with that of theChiromantes haematocheir and Homo sapiens, respectively. Conserved signature sequences of Hsp90 gene family were found in the btsHsp90 deduced amino acid sequence. The temporal expressions of Hsp90 gene were constitutively in the black tiger shrimp tissues including liver, ovary, muscle, brain stomach, and heart, and their levels were markedly enhanced after 30min heat treatment at 37C. In ovarian maturation stages, the expression of btsHsp90 was strongest in the second stage, weaker in the fourth and first stage

Mol Biol Rep (2009) 36:127–134 DOI 10.1007/s11033-007-9160-9 Molecular cloning and expression analysis of a heat shock protein (Hsp90) gene from black tiger shrimp (Penaeus monodon) Shigui Jiang Æ Lihua Qiu Æ Falin Zhou Æ Jianhua Huang Æ Yihui Guo Æ Keng Yang Received: 19 August 2007 / Accepted: 28 September 2007 / Published online: 13 October 2007 Ó Springer Science+Business Media B.V 2007 Abstract The techniques of homology cloning and anchored PCR were used to clone the Hsp90 gene from black tiger shrimp The full length cDNA of black tiger shrimp Hsp90 (btsHsp90) contained a 50 untranslated region (UTR) of 72 bp, an ORF (open reading frame) of 2160 bp encoding a polypeptide of 720 amino acids with an estimated molecular mass of 83-kDa and a 30 UTR of 288 bp The sequence of the coding region showed 90 and 84% homology with that of the Chiromantes haematocheir and Homo sapiens, respectively Conserved signature sequences of Hsp90 gene family were found in the btsHsp90 deduced amino acid sequence The temporal expressions of Hsp90 gene were constitutively in the black tiger shrimp tissues including liver, ovary, muscle, brain stomach, and heart, and their levels were markedly enhanced after 30-min heat treatment at 37°C In ovarian maturation stages, the expression of btsHsp90 was strongest in the second stage, weaker in the fourth and first stage Keywords Cloning Á Hsp90 Á RT expression Á Black tiger shrimp (Penaeus monodon) Introduction Animals are capable of producing proteins in response to environmental changes such as temperature elevation [1], exposure to oxidative stress [2], and myocardial ischemia [3, 4] These proteins are highly conserved among various S Jiang (&) Á L Qiu Á F Zhou Á J Huang Á Y Guo Á K Yang Biotechnology and Aquiculture Laboratory, The South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, 231 Xingangxi Road, Guangzhou 510300, P.R China e-mail: Jingsg@zlen.com organisms and collectively termed heat shock proteins (Hsps) According to their apparent molecular weights and degrees of homology, Hsps are classified into several families, Hsp90s (83–99 kDa), Hsp70s (68–80 kDa), Hsp60s, and the small Hsps (25–28 kDa) [1] Heat shock protein 90 (Hsp 90) is one of the most abundant cytosolic proteins in eukaryotes, amounting to approximately 1% of soluble protein in some cells even in the absence of stress [5] Reported roles for Hsp90 family members include protein chaperoning protect cells against stress [6], oncogenic transformation [7, 8], cell cycle control [9] and antigen presentation [10] It possesses the ability to refold denatured proteins into proper conformations [11], associates with steroid hormone receptors and maintains them in a non-functional state until hormone binding [12, 13] Hsp90 also interacts with other nuclear or cytoplasmic proteins, including transforming or regulatory tyrosine kinases, some serine/threonine kinases, transcription factors, cytoskeletal proteins, calmodulin, and bc subunits of G proteins [9, 14–18] The deletion of Hsp90 is lethal for eukaryotic cells [5, 19, 20] Under non-stress conditions, Hsp90 has been shown to play a key role in many cellular processes and most of its identified cellular targets are signal transducers whose conformational instability is relevant to their roles as molecular switches Under stress conditions, Hsp90 prevents irreversible aggregations of proteins Hsp90 is a participant in the heat shock (stress) response of the cell, a response which is widely recognized and accepted as a major weapon in the cell’s armamentarium for protection against and recovery from environmental insult, both physical and chemical [6, 21–23] With the development of the technique of gene cloning, molecular techniques have recently enabled the identification of Hsp90 genes from the invertebrates, such as: Metapenaeus ensis (GenBank accession No EF470346), 123 128 Mol Biol Rep (2009) 36:127–134 Litopenaeus setiferus (GenBank accession No BE846722), Chiromantes haematocheir (GenBank accession No AY528900), Bemisia tabaci (GenBank accession No DQ093381), Ceratitis capitata (GenBank accession No CAJ28987), Locusta migratoria (GenBank accession No AY445913) In the Fenneropenaeus chinensis, partial sequence of Hsp90 was cloned using SSH and found the gene was up-regulated in the hepatopancreas during WSSV infection [24] In this report, we describe the cloning, sequencing, and expressions of the 83-kDa Hsp90 gene from the black tiger shrimp (Penaeus monodon) The main objectives of this study are (1) to clone the full length cDNA of Hsp90 from black tiger shrimp and compare it to other known Hsp90 genes to prove the existence of Hsp90 in black tiger shrimp, (2) to investigate the expression pattern of Hsp90 gene in the tissues in defending environmental temperature change, (3) to detect if the expression has difference during the three important ovarian maturation stages primarily because the Hsp90 gene could strongly expressed in the ovary without stimulation Table Oligonucleotide primers used in the experiments Primer name (50 ? 30 ) Nucleotide sequence Fe TGATTGGACAGTTYGGTGT Re TACAGYTTGATTTGTTCTT F1 GCCGACAAGGTGACCGTAGT R1 TGTTCTTCTGCTTGCGGTTC R2 TCCTCCCAGTCGTTGGTCAG Oligo-dT adaptor GGCCACGCGACTAGTAC(T)16 Adaptor GGCCACGCGACTAGTAC Oligo-dG GGGGGGGGGGGGGGGH b-Actin F TTGCTACATCGCCCTTGACT b-Actin R TGTGGACGGTTTCCTGAATA F R CCACGAGGATTCCACCAACC CCTTCGTCACCGAGACAAGC reagent following the protocol of the manufacturer, and resuspended in DEPC-treated water and stored at –80°C Synthesis of the cDNA first strand Materials and methods Shrimp About 40 appear healthy black tiger shrimps (P monodon) with fresh weight of about 60–300 g each were purchased from Sanya, Hainan province, P R China The shrimp were cultivated in the aerated seawater (salinity 30) for days at 24–25°C Then they were used as the examined materials in the following examination (1) (2) Gene cloning: The shrimps were cultivated without heat stimulation prior to the RNA was isolated from the ovary Expression: Three shrimp (fresh weight about 200 g) were cultivated for 30 at 37°C prior to the RNA was isolated from the tissues including hepatopancreas, ovary (belong to the yolky stage, [25]), muscle, brain stomach, heart Three appear healthy shrimp cultivated at 24–25°C were used as the control In each ovarian maturation stages, three shrimp without heat stimulation were selected which were classified according to the report of Huang [25] before the RNA was isolated from ovary O1: primordial germ cell stage; O2: chromatin nucleolus stage; O4: yolky stage Total RNA isolation Total RNA was isolated from the examined tissues (weight 50 mg) of the shrimps using Trizol (Invitrogen, Japan) 123 cDNA was synthesized from lg of total RNA by Moloney Murine Leukemia Virus reverse transcriptase (M-MLV, Promega, USA) at 42°C for 50 with oligodT-adaptor primer (Table 1) following the protocol of the manufacturer The cDNA was used as the template for PCR reactions in gene cloning and expression analysis Gene cloning and sequencing Initially, PCR was performed using the cDNA prepared above as template, with the degenerated primers of Fe and Re (Table 1) designed according to the conserved regions of other known Hsp90 gene sequences (such as Xenopus Laevis, Danio rerio, Homo sapiens, Chlamy farreri), in order to obtain the partial fragment of Hsp90 gene from the shrimp The obtained PCR products were separated by 1.2% agarose gel, and then purified by PCR purification kit The purified PCR product was ligated with the PMD20-T vector (Takara, Japan), and transformed into the competent Escherichia coli cells The recombinants were identified through blue–white color selection and screened with M13 forward and reverse primers Three of the positive clones were sequenced on an ABI3730 Automated Sequencer (Applied Biosystem) Sequences generated were analyzed for similarity with other known sequences using the BLAST programs (http://www.ncbi.nim.nih.gov/) Having isolated a partial Hsp90 sequence, the 50 and ends of mRNA were obtained by rapid amplification of cDNA ends (RACE) methods, using gene-specific primers Mol Biol Rep (2009) 36:127–134 129 Fig The Black tiger shrimp Hsp90 gene sequence Hsp90 family c signature motif sequence was highlighted; the spark showed the stop code The polyadenylation signal sequence (AATAAA or AATAAT) is underlined, the RNA instability motif were highlighted and underlined, GxxGxG motif is in box Potential phosphorylation sites are underlined shown in Table In 30 RACE–PCR, PCR reaction was performed with primer F1 and adaptor primer (Table 1) In 50 RACE–PCR, the first strand cDNA obtained was tailed with poly (C) at the 50 ends using terminal deoxynucleotidyl transferase (TdT, Takara, Japan) PCR was performed initially with primer R1 and Oligo-dG, followed by seminested PCR with R2 and Oligo-dG The PCR products were gel-purified, sequenced, and the resulted sequences were subjected to analyze Generated sequences were analyzed for similarity with other known sequences using the BLAST program (http:// www.ncbi.nlm.nih.gov/BLAST/) Multiple sequence alignments were performed using the CLUSTAL W program at the European Bioinformatics Institute (http://www ebi.ac.uk) Analyses of the deduced amino acid sequences utilized the programs PSORT (Kenta Nakai, National Insitute Basic Biology), Scan Prosite (EXPASy Molecular Biology Server) and Predict Protein (EMBL-Heidelberg) The phylogenetic tree was constructed by the neighborjoining (NJ) method using using the programs of CLUSTAL X1.83 [26] and MEGA3.1 [27] Expression studies Reverse transcription PCR was used to study the temporal expressions of Hsp90 in black tiger shrimp Gene specific primers F and R, which gave rise to a product of 293 bp, were used in RT-PCR to detect the temporal expression of the Hsp90 gene in black tiger shrimp The products were cloned, sequenced and confirmed to be the correct form of Hsp90 gene Primer b-actin F and b-actin R were used in the RT-PCR to amplify a 220 bp fragment of black tiger shrimp b-actin gene (GenBank accession No EF087977) as a positive control to verify the successful transcription and to calibrate the cDNA template for correspond samples The products were cloned, sequenced, and confirmed to be the correct form of b-actin gene Results Cloning and sequence of btsHsp90 gene Three overlapping products were obtained by RT-PCR amplification (Fig 1), which comprised the full-length 123 130 Mol Biol Rep (2009) 36:127–134 btsHsp90 cDNA The sequence consisted of 2523 nucleotides including a 2160 bp single open reading frame (ORF), a 72 bp 50 untranslated region (50 UTR) and a 288 bp 30 UTR In the 30 UTR, there were two RNA instability motifs (ATTTA), a 24 bp poly (A) tail and two polyadenylation signal which located 40 and 20 bp, respectively, upstream of the poly (A)+ tail The ORF encoded a 720 amino acids precursor peptide with a molecular weight about 83 kDa, and theoretical point of 4.9 The complete nucleotide sequence of btsHsp90 cDNA and the deduced amino acid sequence are shown in Fig The software search yielded several obvious sequence motifs or domains In the deduced amino acids, there are five Hsp90 family signature motifs and a GxxGxG motif essential for ATP binding showed in the Fig 1; a Histidine kinase-like ATPases (HATPase-c) domain from aa33 to aa187; N-glycosylation sites: NSSDaa44–aa47, NKTKaa279– aa282 , NISRaa385–aa388, NTSKaa428–aa431; two coiled coil: 212 Lys –Val248, Leu537–Asp565 (they were not shown in the Fig 1) Homology analysis The deduced amino acid sequence of the btsHsp90 shows very high homology with that of the other invertebrates: C haematocheir (90% Identity, E = 0), L migratoria (85% Identity, E = 0), B tabaci (80% Identity, E = 0); even with the mammalians: Mus musculus (84% Identity, E = 2e – 102), H sapiens (84% Identity, E = 6e – 60) (Table 2) Multiple sequence alignments show the high conserved with the other species Hsp90 It shows that the different potential btsHsp90 motifs are in conserved positions (Fig 2) and it indicated that btsHsp90 should have the similar functions with the other animals Hsp90 gene Based on the nucleotide acid sequence of Hsp90 genes, a phylogenetic tree was constructed by using the programs of CLUSTAL X1.83 and MEGA3.1 (Fig 3) All the vertebrate’ Hsp90 genes and invertebrate’ Hsp90 genes were Table Homology of Hsp90 protein of black tiger shrimp with other known Hsp90 amino acid Expression studies A product of 293 bp of expected size was amplified from most of the examined tissues including hepatopancreas, ovary, muscle, brain, stomach, and heart The sequences of the resulting RT-PCR products were identical to the Hsp90 cDNA sequences which indicated the mRNA expression could be detected by RT-PCR The expression of the btsHsp90 was observed in the most of the examined tissues, but the expression level varied significantly among the tissues There was a high level in ovary and hepatopancreas, lower in brain, stomach and heart, while lowest in muscle After stimulated with heat treatment, the Hsp90 expression level was enhanced, especially in the brain, stomach and heart (Fig 4) The Hsp90 expression in the ovary was found to be different in the ovarian maturation stages by RT-PCR analysis The expression level in the second stage (O2) is the highest among the three stages, and it is higher in the fourth stage (O4) than in the first stage (O1) (Fig 5) Discussion The Hsp90 family is a group of abundantly expressed and highly conserved molecular chaperones whose exact function is presently undefined They recognize and regulate the activity of several intracellular substrates and also operate in the absence of stress [11] In the present study, we cloned full length of Hsp90 gene from the black tiger shrimp (P monodon) using the Score (bits) Chiromantes haematocheir Bemisia tabaci Identity (%) E-value Accession number 721 91 AY528900 1011 80 AAZ17403 Ceratitis capitata 999 81 CAJ28987 Locusta migratoria 694 85 AY445913 Spodoptera frugiperda 685 84 2e – 100 AF254880 Salmo salar 989 78 AAD30275 Xenopus Laevis 123 clustered together and formed a group, respectively In the tree, the black tiger shrimp shows the closest relationship with the C haematocheir, the result is similar with the result of the BLAST So the relationships displayed in the phylogenic tree were corresponded to their classification position 1013 80 AAV41061 Gallus gallus 685 84 8e – 102 P11501 Mus musculus 683 84 2e – 102 BC094024 Homo sapiens 682 84 6e – 60 AJ890083 Mol Biol Rep (2009) 36:127–134 131 Fig Multiple alignments of black tiger shrimp Hsp90 with other known Hsp90 amino acids sequences aligned by the CLUSTAL W program Identical and similar sites were shown with sparks (*) and dots ( or : ), respectively; Residues involved in hydrogen bonding with geldanamycin are highlighted GxxGxG motif is indicated by overline Hsp90 signature sequences were in the box Organism and GenBank database accession nos for sequence are: Xenopus Laevis (AAV41061), Bemisia tabaci (AAZ17403), Ceratitis capitata (CAJ28987), Salmo salar (AAD30275), Chiromantes haematocheir (AY528900), Locusta migratoria (AY445913), Gallus gallus (P11501), Mus musculus (BC094024), Homo sapiens (AJ890083), Spodoptera frugiperda (AF254880), Penaeus monodon (unsubmitted) technique of homology and RACE (GenBank accession No ZF015589) In 30 UTR, there are two repeats of the sequence ATTTA which known to decrease both the stability and translation efficiency of an mRNA [28, 29] There are two polyadenylation signal sequences, one is AATAAA, same as most animals, the other is AATAAT which is same as Oomycete (Achlya ambisexualis) [30] The reason why there are two polyadenylation signal sequences we not know now and there is no any report about it 123 132 Fig Phylogenetic tree show the relationship among the full-length black tiger shrimp Hsp90 amino acids sequence with other representative Hsp90 sequences The sequences were aligned by CLUSTAL W program and the phylogenetic tree was constructed by neighbor-joining methods using MEGA version 3.1 Mol Biol Rep (2009) 36:127–134 82 89 Bemisia tabaci Locusta migratoria 90 Spodoptera frugiperda Ceratitis capitata Chiromantes haematocheir 100 100 Penaeus monodon Xenopus Laevis Salmo salar Gallus gallus 99 Mus musculus 100 100 Homo sapiens Fig RT-PCR analysis of Hsp90 expression in various tissues of black tiger shrimp RTC reverse transcription negative control Hep, hepatopancreas; Ov, ovary; Mu, muscle; Br, brain; St, stomach; He, heart Fig RT-PCR analysis of Hsp90 expression in ovarian maturation stages O1: primordial germ cell stage; O2: chromatin nucleolus stage; O4: yolky stage RTC reverse transcription negative control The result of the homology analysis with other known Hsp90 genes revealed that btsHsp90 showed high homology with Hsp90s of the C haematocheir over 90%, whereas a lower homology was observed with mammals such as H sapiens and M musculus of 84% approximately [31, 32] The results of the blast indicated that the E-values were lower than 0.005 [33], so the clones was the homological gene of Hsp90 Five typical Hsp90 family signature motifs could also be found in the predicted protein of this sequence, we could think that the clones should be the member of Hsp90 family and had similar primary structure with other known Hsp90 The sequence of btsHsp90 contained a highly hydrophobic and acidic C-terminal end, but no potential Nterminal signal sequence as expected for a secreted protein The glutamine-rich sequence (TQTQDQ) or the sequence PEETQTQDQPME at the amino terminus of the mammals 123 Hsp90 is phosphorylated by the dsDNA-activated protein kinase [34] Lacking both amino-terminal threonines, btsHsp90 cannot be phosphorylated Together with Hsp70 and Hsp60, Hsp90 helps newly synthesized proteins to fold and modulate the transcription factors and protein kinases [19, 35] The amino terminal domain of btsHsp90 showed high homology with other Hsp90s and contained a GxxGxG motif essential for ATP binding [36] The motif also overlaps with the GA binding motif [37] The presence of the EEVD motif at the C-terminal end suggests the cytosolic localization of btsHsp90 [38, 39] And the functional motif sequences all locate in the conserved domains (Fig 2) The structure analysis suggests that the btsHsp90 should have similar function with the other animals’ Hsp90 gene Similar to Hsp70, the Hsp90 is also a molecular chaperone, which is conserved among all living organisms to protect cells against stress [11, 40] In the present study, tissue-specific differences in levels of constitutive Hsp90 were observed The highest expression levels were in ovary not hepatopancreas, the lowest in muscle Intermediate levels were detected in hepatopancreas, brain, heart, and stomach Our findings are almost in agreement with those found in rabbits [41] and porcine [42, 43] which the highest level is in testis Mammalian Hsp90 are expressed at basal levels under unstressful conditions; various stresses increase the expression to different degrees [42] In black tiger shrimp, heat treatment could induce the Hsp90 expression level in the tissues But the highest also was in the ovary Now we Mol Biol Rep (2009) 36:127–134 not really understand the reason why the highest expression level was in the ovary not in the immune organ, and there was any report about it The result indicated that btsHsp90 was constitutive and inducible expressed and could play a critical role in defending the circumstantial temperature elevation The levels of constitutive Hsp90 in ovarian maturation stages were different When the ovary began to mature, the expression level was the highest But the expression levels were lower in the other two stages So the Hsp90 expression level could change during the ovarian maturation stages From the result we deduced that the Hsp90 might have relationship with the ovarian maturation Certainly this need further work to verify Acknowledgments This study was supported by National nature foundation of China (No 30571447), National ‘‘863’’ Project of China (No 2003AA603120 ) and Agriculture Department Project of China(06-05-01B) References Lindquist S, Craig EA (1988) The heat-shock proteins Annu Rev Genet 22:631–677 Liao F, Andalibi A, Qiao JH, Allayee H, Fogelman AM, Lusis AJ (1994) Genetic evidence for a common pathway mediating dative stress, inflammatory gene induction, and aortic fatty streak formation in mice J Clin Invest 94:877–884 Benjamin IJ, Williams RS (1994) Expression and function of stress proteins in the ischemic heart In: Morimoto RI, Tisserees A, Geogopoulos C (eds) The biology of heat shock proteins and molecular chaperones Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp 533–552 Mestril R, Dillmann WH (1995) Heat shock proteins and protection against myocardial ischemia J Mol Cell Cardiol 27:45–52 Buchner J (1999) hsp90 and Co.—a holding for folding Trends Biochem Sci 24:136–141 Craig EA, Weissman JS, Horwich AL (1994) Heat shock proteins and molecular chaperones: mediators of protein conformation and turnover in the cell Cell 78:365–372 Gress TM, Muller-Pillasch F, Weber C, Lerch MM, Freiss H, Buchler M, Beger HG, Adler G (1994) Balance of expression of genes coding for extracellular matrix proteins and extracellular matrix degrading proteases in chronic pancreatitis Cancer Res 54:547–551 Whitesell L, Mimnaugh EG, De Costa B, Myers CE, Neckers LM (1994) Inhibition of heat shock protein HSP90-pp60v-src heteroprotein complex formation by benzoquinone ansamycins: essential role for stress proteins in oncogenic transformation Proc Natl Acad Sci USA 91:8324–8328 Aligue R, Akhavan-Niak H, Russell P (1994) A role for Hsp90 in cell cycle control: Wee1 tyrosine kinase activity requires interaction with Hsp90 EMBO J 13:6099–6106 10 Srivastava PK, Udono H, Blachere NE, Li Z (1994) Heat shock proteins transfer peptides during antigen processing and CTL priming Immunogenetics 39:93–98 11 Jakob U, Buchner J (1994) Assisting spontaneity: the role of HSP90 and small HSPs as molecular chaperones Trends Biochem Sci 19:205–211 12 Smith DF, Toft DO (1993) Steroid receptors and their associated proteins Mol Endocrinol 7:4–11 133 13 Czar MJ, Welsh MJ, Pratt WB (1997) Geldanamycin, a heat shock protein 90-binding benzoquinone ansamycin, inhibits steroid dependent translocation of the glucocorticoid receptor from the cytoplasm to the nucleus J Biochem 36:7776–7785 14 Stancato LF, Chow YH, Hutchison KA, Perdew GH, Jove R, Pratt WB (1993) Raf exists in a native heterocomplex with hsp90 and p50 that can be reconstituted in a cell-free system J Biochem 268:21711–21716 15 Sanchez FR, Toft DO, Schlesinger MJ, Pratt WB (1985) Evidence that the 90-kDa phosphoprotein associated with the untransformed L-cell glucocorticoid receptor is a murine heat shock protein J Biochem 260:12398–13401 16 Czar MJ, Galigniana MD, Silverstein AM, Pratt WB (1996) Immunofluorescence localization of the 90-kDa heat-shock protein to cytoskeleton Eur J Cell Biol 70:322–330 17 Minami Y, Kawasaki H, Miyata Y, Suzuki K, Yahara I (1991) Analysis of native forms and isoform compositions of the mouse 90-kDa heat shock protein, HSP90 J Biochem 266:10099–10103 18 Inanobe A, Takahashi K, Katada T (1994) Association of the beta gamma subunits of trimeric GTP-binding proteins with 90-kDa heat shock protein, hsp90 J Biochem 115:486–492 19 Csermely P, Schnaider T, Soti C, Proha´szka Z, Nardai G (1998) The 90-kDa molecular chaperone family: structure, function, and clinical applications A comprehensive review Pharmacol Ther 79:129–168 20 Voss AL, Thomas T, Gruss P (2000) Mice lacking hsp90_fail to develop a placental labyrinth Development 127:1–11 21 Schlesinger MJ (1994) How the cell copes with stress and the function of heat shock proteins Pediatr Res 36:1–6 22 Macario AJL (1995) Heat-shock proteins and molecular chaperones; implications for pathogenesis, diagnostics, and therapeutics Int J Clin Lab Res 25:59–70 23 Georgopoulos C, Welch WJ (1993) Role of the major heat shock proteins as molecular chaperones Annu Rev Cell Biol 9:601–634 24 Wang B, Li F-h, Dong B, Zhang X-j, Zhang C-s, Xiang J-h (2006) Discovery of the genes in response to white spot syndrome virus (WSSV) infection in Fenneropenaeus chinensis through cDNA microarray Mar Biotechnol 8:491–500 25 Huang JH, Zhou FL, Ma ZM, Jiang SG (2005) Morphological and histological observation on ovary development of Penaeus monodon from northern South China Sea J Trop Oceanogr 25(3):47–52 26 Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The CLUSTALX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools Nucleic Acids Res 25:4876–4882 27 Kumar S, Tamura K, Nei M (2004) MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment Brief Bioinform 5:150–163 28 Bevilacqua A, Ceriani MC, Capaccioli S, Nicolin A (2003) Posttranscriptional regulation of gene expression by degradation of messenger RNAs J Cell Physiol 195:356–372 29 Zhang T, Kruys V, Huez G, Gueydan C (2002) AU-rich element mediated translational control: complexity and multiple activities of trans-activating factors Biochem Soc Trans 30:952–958 30 Brunt SA, Silver JC (2004) Molecular cloning and characterization of two different cDNAs encoding the molecular chaperone Hsp90 in the Oomycete Achlya ambisexualis Fungal Genet Biol 41:239–252 31 Rebbe NF, Ware J, Bertina RM, Modrich P, Stafford DW (1987) Nucleotide sequence of a cDNA for a member of the human 90-kDa heat-shock protein family Gene 53:235–245 32 Hickey E, Brandon SE, Smale G, Lloyd D, Weber LA (1989) Sequence and regulation of a gene encoding a human 89-kilodalton heat shock protein Mol Cell Biol 9:2615–2626 123 134 33 Anderson I, Brass A (1998) Searching DNA databases for similarities to DNA sequences: when is a match significant? Bioinformatics 14(4):349 34 Lees-Miller SP, Anderson CW (1989) The human double-stranded DNA-activated protein kinase phosphorylates the 90-kDa heat shock protein, hsp90 alpha at two NH2-terminal threonine residues J Biochem 264:17275–17280 35 Eggers DK, Welch WJ, Hansen WJ (1997) Complexes between nascent polypeptides and their molecular chaperones in the cytosol of mammalian cells Mol Biol Cell 8:1559–1573 36 Prodromou C, Roe SM, O’Brien R, Ladbury JE, Piper PW, Pearl LH (1997) Identification and structural characterization of the ATP/ADP-binding site in the Hsp90 molecular chaperone Cell 90:65–75 37 Stebbins CE, Russo AA, Schneider C, Rosen N, Hartl FU, Pavletich NP (1997) Crystal structure of an Hsp90-geldanamycin complex: targeting of a protein chaperone by an antitumor agent Cell 89:239–250 38 Buchberger A, Bakau B (1997) Escherichia coli DnaK In: Gething MJ (ed) Guidebook to molecular chaperones and proteinfolding catalysts, vol 147 Oxford University Press, Oxford 123 Mol Biol Rep (2009) 36:127–134 39 Ahn HJ, Kim S, Nam HW (2003) Molecular cloning of the 82kDa heat shock protein (HSP90) of Toxoplasma gondii associated with the entry into and growth in host cells Biochem Biophys Res Commun 311:654–659 40 Nathan DF, Vos MH, Lindquist S (1997) In vivo functions of the Saccharomyces cerevisiae Hsp90 chaperone Proc Natl Acad Sci USA 94:12949–12956 41 Quraishi H, Brown IR (1995) Expression of heat shock protein 90 (hsp90) in neural and nonneural tissues of the control and hyperthermic rabbit Exp Cell Res 219:358–363 42 Huang HC, Yu JS, Tsay CC, Lin JH, Huang SY, Fang WT, Liu YC, Tzang BS, Lee WC (2002) Perification and characterization of porcine testis 90-kDa heat shock protein (Hsp90) as a substrate for various protein kinases J Protein Chem 21:111–121 43 Huang H-c, Lee W-c, Lin J-h, Huang H-w, Jian S-c, Mao SJT, Yang P-c, Huang T-y, Liu Y-c (1999) Molecular cloning and characterization of porcine cDNA encoding a 90-kDa heat shock protein and its expression following hyperthermia Gene 226:307–315