cloning and expression of a novel chemotherapeutic target

... cDNA for expression was cloned by another RT-PCR with primers fullMJEforMQ (GCATGCAGGGTGATAAAAA TCACTTTGTA) and fullMJErev (AAGGATCCATAA TATTTTTGCGAAATC), adding restriction sites for SphI and ... compounds and usually only JA content is measured If values of both JA and MeJA are published, the ratios depend on the plant species and the tissue analysed and vary from : (JA/MeJA) in Arabidopsis ... of tomato Proc Natl Acad Sci USA 99, 6416–6421 17 Meyer, R., Rautenbach, G.F & Dubery, I .A (2003) Identification and quantification of methyl jasmonate in leaf volatiles of Arabidopsis thaliana...

Ngày tải lên: 16/03/2014, 18:20

... nucleotide sequence of oyster CaLP cDNA obtained by RACE, a PCR reaction was performed using a pair of specific primers P3 (5¢-GGAAGAATACAGACACGGACAG-3¢) and P4 (5¢-ATAACAACAGTTTATACATCGCTTC-3¢) corresponding ... sequence of CaLP2 were used in the nested PCR reactions The first round of PCR reaction was performed with a forward primer UPM (a mixture of primers 5¢-CTAATACGACTCACTATAGGGC AAGCAGTGGTAACAACGCAGAGT-3¢ ... sequence, an open reading frame consisting of 483 bp, a TGA stop, a 146 bp 3¢-untranslated sequence, and a poly (A) tail of 18 nucleotides A putative polyadenylation signals (AATAAA) is recognized at...

Ngày tải lên: 16/03/2014, 23:20

... clones of 1324 and 1319 bp, designated DpAR1 and DpAR2, respectively The nucleotide sequences of DpAR1 and DpAR2 have been submitted to the EMBL database and are available under accession numbers AJ309822 ... (this study); AAC23647, AAD32792, CAB88350 and AAC2346, Arabidopsis thaliana; Medicago, M sativa [16] The amino-acid residues identical to the DpAR1 sequence are indicated by dots Gaps are introduced ... h a day) Leaves were harvested after and days Plants subjected to salt stress were watered with a solution of 250 mM NaCl and samples collected after and 48 h Leaves were also sampled from heat-shocked...

Ngày tải lên: 18/03/2014, 01:20

... great potential to serve as a model for human disease that range from heart failure and vascular disease to fields as diverse as osteoporosis, renal failure, Parkinson’s disease, diabetes and cancer ... Postlethwait and Talbot, 1997) The two main approaches of cloning mutated genes, positional cloning and candidate gene approach, have benefited greatly from the recent advances in zebrafish genomic ... et al., 2000) Similar results were obtained in another study done at the same time (Barbazuk et al., 2000) Analyses of mouse and human, as well as zebrafish and human synteny groups have also...

Ngày tải lên: 03/10/2015, 20:57

... human and rabbit erythrocytes, and kills mice and the microcrustacean Artemia salina at very low concentrations [21] Here we report the cloning of pulchellin A- chain (PAC), its cDNA characterization, ... based on DNA sequences obtained previously Thus, the sequences of the primers used for 5Â RACE were: 5Â-GGGCATCACGGA AGAAATAG-3Â for a reverse transcription and 5Â-GC TCTAGAGCATTCGTCACATCGATACC-3Â ... enzymatic activity of rPAC Figure shows an Fig Deduced amino acid sequence of recombinant pulchellin A- chain (rPAC) aligned to abrin -a, abrin-c and ricin (RTA) A- chains Conserved amino acids are highlighted...

Ngày tải lên: 07/03/2014, 16:20

... AY032675 DQ650638 AY206412 AY206413 AF244923 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA At5g40150 NA NA NA NA NA NA NA NA NA NA NA NA At5g05340 NA NA NA NA NA NA NA NA NA Unpublished Unpublished ... Primer pairs were: #GSP-4 and #PFLF1 (lanes and 2); #GSP-2 and #GSP-4 (lanes and 4); #GSP-2 and #PFLR-1 (lanes and 6); and #PFLF-1 and #PFLR-1 (lanes and 8) (B) Schematic organization of the CrPrx ... database, i.e Avicennia (BAB16317), Nicotiana secretory peroxidases (AAD33072), cotton (COTPROXDS) (AAA99868), barley grain (BP1) (AAA32973), Ar thaliana (ATP 2A) A2 (Q42578) and HRP-C (AAA33377) Residue...

Ngày tải lên: 23/03/2014, 09:21

... cubical epithelial morphology correlated with a profound redistribution of both actin microfilaments and cytokeratin intermediate filaments, and with the appearance of a marked cytokeratin and actin ... N., Madaule, P., Reid, T., Ishizaki, T., Watanabe, G., Kakizuka, A. , Saito, Y., Nakao, K., Jockusch, B.M & Narumiya, S (1997) p140mDia, a mammalian homolog of Drosophila diaphanous, is a target ... (1977) Analysis of singleand double-stranded nucleic acids on polyacrylamide and agarose gels by using glyoxal and acridine orange Proc Natl Acad Sci USA 74, 4835–4838 Savonet, V., Maenhaut, C.,...

Ngày tải lên: 23/03/2014, 21:20

... using a general rat endothelial cell marker, and calculation of the vessel-positive area was performed in the ipsilateral and contralateral gray matter in vehicle- and bpV-treated animal groups ... the dynamics of cervical SCI and related intracellular signaling and death mechanisms is essential Through behavior, Western blot, and histological analyses, alterations in phosphatase and tensin ... (Unoki and Nakamura, 2001) It is widely known that activity of the mammalian target of rapamycin (mTOR) is a major inhibitor of the progression of apoptosis, and stability of mitochondrial function...

Ngày tải lên: 24/08/2014, 09:14

... primer, 5¢-ATGGAGTATAAGGGGAAGGTTGTTGC-3¢, and reverse primer, 5¢-TTGGATTTCCAGAAACACTGGA-3¢ PCR was carried out in a 50-lL reaction mixture containing 0.5 lL (from a total of 10 lL) cDNA template, 0.5 ... ADPase/ATPase ratios vary significantly at different pH values For example, a higher ADPase/ATPase ratio was obtained at pH 6.4 ( 0.5) than at pH 8.0 ( 0.1) Because of the lower Km for ADP and ... CaADPase activity is  80% of the MgADPase activity at a divalent ion-ADP concentration of mM (data not shown) The ATPase and ADPase activities of the purified chicken liver ecto-ATPDase were affected...

Ngày tải lên: 22/02/2014, 04:20

... The major differences were a 26 bp insertion in the 5¢-UTR of the cDNA and an insertion of 12 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the 3¢-UTR of the cDNA sequence ... by ‘|’ and insertions indicated by ‘-’ The two insertions in the 5¢- and 3¢-UTR are underlined and the 13 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the 3¢-UTR are numbered ... isolated and sequenced, and the expression and modulation of this molecule was studied Results Cloning and characterization of rainbow trout IL-11 A cDNA clone containing a 2936 bp insert has...

Ngày tải lên: 07/03/2014, 16:20

... domain of human LBR (71%), A thaliana D14-SR (59%), Saccharomyces cerevisiae D14-SR (55%) (Fig 1), and other sterol reductases [50% and 49% similarity to human and A thaliana sterol D7-reductases, ... vector, and sequenced on both strands The cloned cDNA was 1370 bp long and contained an ORF of 1257 bp, encoding a protein of 418 amino acids with a calculated molecular mass of 46 751 Da The N-terminal ... proteins and terminated by the addition of mL of 20% KOH in 50% methanol, followed by additional 30 incubation at 37 °C After the addition of 5a- cholestane (5 lg) as an internal standard, sterols...

Ngày tải lên: 08/03/2014, 16:20

... b-aryl ether cleavage activity was measured as described above Localization of b-aryl ether cleavage activity A 14-day-old culture (4 mL) of 2BW-1 cells was separated into supernatant and residue ... ether cleavage activity, we prepared a hyphae fraction (HP), an extracellular fraction (EC), a cytoplasmic fraction (CY) and a membrane fraction (M) from cultures of 2BW-1 (see Materials and methods) ... indicated that the b-aryl ether cleavage enzyme accumulated and was stable in the extracellular fraction The extracellular fraction of 2BW-1 generated abundant GG and 4MU from GOU by cleaving...

Ngày tải lên: 17/03/2014, 03:20

... site of a pQM vector containing a C-terminal E2-Tag /A (Quattromed Ltd, Tarto, Estonia) The forward primer was 5¢-ATCTCTAGAATGGAGCAGTCAGA G-3¢ and the reverse primer was 5¢-ATCTCTAGAGGT GGTGCCCACTTC-3¢ ... transcription, was 5¢-TAGCAGCAGACTTGAAGAGG TA-3¢ PCR was performed by using the forward primer 5¢-GCCAGAATGGAGCAGTCAGAGGGAGTC-3¢ and the reverse primer 5¢-GCAGCTCTAGGTGGTGCCCA CTTCAGAG-3¢ The PCR ... and Sirkka-Liisa Kauranen for skilled technical assistance in molecular biology, and Kati Venalainen and ¨ ¨ Leena Penttila for assistance in HPLC and MALDI-TOF MS analysis ¨ The work was supported...

Ngày tải lên: 30/03/2014, 13:20

... that associates with nuclear matrix DNA Cell Biol 17, 849–858 Lee JY, Nakane Y, Koshikawa N, Nakayama K, Hayashi M & Takenaga K (2000) Characterization of a zinc finger protein ZAN75: nuclear ... Thanumalayan S, Muralikrishna B, Rangaraj N, Karande AA & Parnaik VK (1999) Colocalization of intranuclear lamin foci with RNA splicing factors J Cell Sci 112, 4651–4661 11 Gueth-Hallonet C, Wang ... 58 B E B A A A A A A A A C A B D A A A A B A 71 47 217 42 S S M S 1 – – – 25 – B A C A 67 130 160 98 S S M M – – – 13 30 A A B B Accession no in the NCBI protein database proteins Filamentous...

Ngày tải lên: 30/03/2014, 20:20

... supported in part by an Ontario Graduate Scholarship, Natural Sciences and Engineering Research Council of Canada and the Canada Research Chairs program The authors acknowledge Mr Ka Lun Tam for his ... the 1.2-2.5 range, and was adjusted for each participant such that false activations due to blinks and movement were avoided and participants were able to activate the switch by raising their ... Acoustic and surface EMG diagnosis of pediatric muscle disease Muscle Nerve 1990, 13(4):286-290 23 Akataki K, Mita K, Watakabe M: Electromyographic and mechanomyographic estimation of motor unit activation...

Ngày tải lên: 19/06/2014, 08:20

... the optimal locations for sensors In addition, processing algorithms for extraction of patterns from gathered data are required, as well as wearable and wireless hardware to allow the data to be ... outer garment layer was a 100% polyester satin weave, and the inner layer was a 100% acrylic satin weave The collar was 80% nylon, 20% elastine jersey knit The structure of the garment was crucial ... direction Breathing As seen in Figure 3a, deep breathing resulted in a sinusoidal resistance curve, varying between approximately kΩ and kΩ These are absolute values and a low total change compared to...

Ngày tải lên: 19/06/2014, 10:20

... 5’-GGGCATCACAGACCTGTTAT-3’ 5’-AAYATGGAYATHGAYTGYGA-3’ 5’-RTCDCCCCADATNCCRTA-3’ 5-CCAGAGCACGTTGGCATCAA-3 5-ACCATAGTCGGACTTGACCT-3 5’-GGTCTGCAACAACAAGCTCATC-3’ 5’–GAGTCGATGCCGTCTTGATC-3’ 5’-CGCCATATGAAAACAGCTGCCATT-3 ... Acta 1205:183–188 Gupta V, Prasanna R, Natarajan C, Srivastava AK, Sharma J (2010) Identification, characterization, and regulation of a novel antifungal chitosanase gene (cho) in Anabaena spp Appl ... activity and stability of chitosanases Chitosanase activity was measured at the pH range of 2.5 to 8.0 for 30 before assayed by standard assay method The residual chitosanase activity was also measured...

Ngày tải lên: 21/06/2014, 19:20

... the maintenance of synovial inflammation, aggravating the destruction of cartilage and bone and stimulating the development of the pannus Because FLSs can exhibit significant phenotypic changes ... tissue.(b) Intense staining of the synovial lining layer and perivascular regions of OA (paraffin section) tissue (c) An area demonstrating a thin lining layer and perivascular region populated with c19orf10-positive ... Diego, CA, USA), resulting in a glutathione S transferase (GST)-His-c19orf10 fusion gene Primers Orf10NdeI (gaattccatatGGTGTCCGAGCCCACGA) and Orf10R2 (catggctcgagcAGCTCAGTGCGCGAT) were used to amplify...

Ngày tải lên: 09/08/2014, 10:20

... GGGTTTCATATGACTATCGGAGCTCGTGAT CGGGATCCCTAGAAGTCATACAAGCATTT TTTTTAAGCTAACACGAGAC TCTCATAGGAGCTGTAATTG TAAAATGGACGATCAGTATC TTATGTTCAGATTTGGACTC TACTTTCTACAACGAGCTTC ACATGATTTGAGTCATCTTC GGGTTTCATATGAAGATCGAGGTGAGAGAA ... CGGGATCCTTAGATATCATATAGGAACTTGC ATATTCACGACGACTCCGATAGCGGTATCG CACGTCGGCTTCGACTGTAGGTCGACT CACGAGACCAAGTCAATGCACTCAAAGGA GATTCGGGCACTTAAACGTATGAGCCCC CGTGGACTATCAGACGATCAACCATCC TCGTCCGTCAGTAGCCACGTACAGTATC ... TCGTCCGTCAGTAGCCACGTACAGTATC CACAAAACCAAAACTTCACATCCCATCC CTCACTATGGATTCTCCTAGCGGTGTCG Page 10 of 13 (page number not for citation purposes) BMC Plant Biology 2009, 9:30 μg protein was incubated in presence of...

Ngày tải lên: 12/08/2014, 03:20

... glucosyltransferase from Arabidopsis thaliana (AB025634); FaGT3 and FaGT7, flavonol-O-glucosyltransferases from Fragaria × ananassa (AAU09444) and (ABB92748); NtGT 1a and NtGT1b, broad substrate specificity ... glucosyltransferases from Nicotiana tabacum (BAB60720) and (BAB60721); AtA5GT, glucosyltransferase from Arabidopsis thaliana (AAM91686); anthocyanin 5-O-glucosyltransferases from Torenia hybrida (BAC54093), ... Ubukata T, Hayashida N, Yamamoto H, Okazaki M: Cloning and characterization of a glucosyltransferase that reacts on 7-hydroxyl group of flavonol and 3-hydroxyl group of coumarin from tobacco...

Ngày tải lên: 12/08/2014, 03:21