Molecular cloning and expression analysis of a heat shock protein (Hsp90) gene from black tiger shrimp (Penaeus monodon)

Molecular cloning and expression analysis of a heat shock protein (Hsp90) gene from black tiger shrimp (Penaeus monodon)

Molecular cloning and expression analysis of a heat shock protein (Hsp90) gene from black tiger shrimp (Penaeus monodon)

... GGGGGGGGGGGGGGGH b-Actin F TTGCTACATCGCCCTTGACT b-Actin R TGTGGACGGTTTCCTGAATA F R CCACGAGGATTCCACCAACC CCTTCGTCACCGAGACAAGC reagent following the protocol of the manufacturer, and resuspended in DEPC-treated ... Miyata Y, Suzuki K, Yahara I (1991) Analysis of native forms and isoform compositions of the mouse 90-kDa heat shock protein, HSP90 J Biochem 266:10099–10103 18 Inan...
Ngày tải lên : 11/11/2016, 15:59
  • 8
  • 470
  • 0
Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx

Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx

... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R, 5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GTcDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTAC CTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTT CCAAGTGC-3¢ for GT-cDNA2 (3043 bp) RNA isolation and ... revealed two putative polyadenylation (ATTAAA) signals: one is located 18 bp upstream from the poly (A) of GT-cDNA1 and another is located 11 bp upstream from...
Ngày tải lên : 17/03/2014, 03:20
  • 8
  • 465
  • 0
Identification, characterization and expression analysis of a novel TPA (12 0 tetradecanoylphorbol 13 acetate) induced gene

Identification, characterization and expression analysis of a novel TPA (12 0 tetradecanoylphorbol 13 acetate) induced gene

... epidemiological and genetic studies Pancreatic adenocarcinoma is a disease that is associated with advancing age (12) It is rare before the age of 40, and culminates in a 40 fold increased risk by the age ... ( 20- 22) A molecular and pathological analysis of evolving pancreatic adenocarcinoma has revealed a characteristic pattern of genetic lesions The challenge now...
Ngày tải lên : 14/09/2015, 22:09
  • 118
  • 501
  • 0
Báo cáo khoa học: Genomic structure and expression analysis of the RNase j family ortholog gene in the insect Ceratitis capitata pptx

Báo cáo khoa học: Genomic structure and expression analysis of the RNase j family ortholog gene in the insect Ceratitis capitata pptx

... organization of the ORF region of the RNase j family genes is shown in Fig 7A In all organisms examined, the region coding for RNase j is interrupted by two introns, with the exception of the sea urchin ... describe the expression profile of the RNase j gene at various developmental stages and in several tissues of the insect C capitata W...
Ngày tải lên : 23/03/2014, 06:20
  • 11
  • 479
  • 0
Molecular characterization and developmental analysis of interferon regulatory factor 6 (IRF6) gene in zebrafish

Molecular characterization and developmental analysis of interferon regulatory factor 6 (IRF6) gene in zebrafish

... mouse, Fugu, and zebrafish 63 -64 3.5 Assembled sequences of irf6 genomic fragments 64 -66 3 .6 The irf6 gene locus on the LG22 in T51 RH panel and in the Ensembl zebrafish version (ZV6) 68 -69 3.7 Whole-mount ... morpholinos 85 3.14 Loss of irf6 function phenotypes 86- 87 3.15 Comparison of expression of molecular markers in irf6 morphants and wildtype 91-92 3...
Ngày tải lên : 14/09/2015, 12:44
  • 149
  • 297
  • 0
Báo cáo hóa học: " Ex vivo promoter analysis of antiviral heat shock cognate 70B gene in Anopheles gambiae" pptx

Báo cáo hóa học: " Ex vivo promoter analysis of antiviral heat shock cognate 70B gene in Anopheles gambiae" pptx

... response element binding protein (CREB) participates in the heat- inducible expression of human hsp90β gene Chinese Science Bulletin 2001, 46:1645-1649 Perkins ND: Integrating cell-signalling pathways ... [23,24] These in vivo findings and our current ex vivo characterization of the hsc70B regulatory region unequivocally indicate that the induction of HSC70B may be a mosqui...
Ngày tải lên : 20/06/2014, 01:20
  • 9
  • 397
  • 0
use of artemia biomass and gut weed meal as protein source in practical diets for the black tiger shrimp (penaeus monodon)

use of artemia biomass and gut weed meal as protein source in practical diets for the black tiger shrimp (penaeus monodon)

... Artemia biomass protein in the practical diets for the black tiger shrimp - Determine the proper replacement levels of soybean protein with gut weed protein in practical diets for the black tiger shrimp ... experiment 1, Artemia biomass was used as protein source to replace 0, 20, 40 and 60% fishmeal protein in practical d...
Ngày tải lên : 21/09/2015, 13:55
  • 37
  • 245
  • 0
domestication of black tiger shrimp (penaeus monodon) in recirculation systems in vietnam

domestication of black tiger shrimp (penaeus monodon) in recirculation systems in vietnam

... tijgergarnaal (Penaeus monodon) in recirculatiesystemen in Vietnam To cite this work: Hoa, N.D., 2009 Domestication of black tiger shrimp (Penaeus monodon) in recirculation systems in Vietnam PhD ... containing pollack liver oil (12.8% EPA) with a high amount of vitamin E were effective in inducing and accelerating maturation and spawning and increasi...
Ngày tải lên : 13/03/2014, 18:58
  • 199
  • 515
  • 0
Application of Bacillus spp. Isolated from the Intestine of Black Tiger Shrimp (Penaeus monodon Fabricius) from Natural Habitat for Control Pathogenic Bacteria in Aquaculture ppt

Application of Bacillus spp. Isolated from the Intestine of Black Tiger Shrimp (Penaeus monodon Fabricius) from Natural Habitat for Control Pathogenic Bacteria in Aquaculture ppt

... or on the sediments (Moriarty, 1998) So, we isolated Bacillus spp from intestine of P monodon captured from natural habitat and tested for antagonistic activity to pathogenic bacteria in aquaculture ... inhibit the growth of the pathogenic bacteria; Bacillus W806, Bacillus W902, Bacillus WL01 and Bacillus W1106 showed competitively exclude the...
Ngày tải lên : 07/07/2014, 19:20
  • 8
  • 358
  • 1
Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx

Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx

... to their positions The arrowheads depict the residues important for the structural core of the IL-10 gene The underlined amino acid residues are the signal sequences of the respective genes The ... conclusion, the IL-10 gene from carp has been isolated and its genomic structure and expression analysis investigated This work will pave the way for further inves...
Ngày tải lên : 20/02/2014, 02:21
  • 8
  • 584
  • 0
Báo cáo Y học: Heterologous expression and folding analysis of a b-tubulin isotype from the Antarctic ciliate Euplotes focardii ppt

Báo cáo Y học: Heterologous expression and folding analysis of a b-tubulin isotype from the Antarctic ciliate Euplotes focardii ppt

... the Materials and methods section and analysed by SDS/ Fig Immunodetection of CCT a- subunit in the cytoplasm of E focardii SDS/PAGE of an E focardii cytoplasmic fraction (20 lg, lane 1) and of ... two additional b-tubulin isotypes were identified in E focardii They are denoted as b-T3 and b-T4 Comparison of the primary structure of b-tubulin isotypes from...
Ngày tải lên : 23/03/2014, 21:20
  • 7
  • 500
  • 0
báo cáo khoa học: " Isolation, identification and expression analysis of salt-induced genes in Suaeda maritima, a natural halophyte, using PCR-based suppression subtractive hybridization" doc

báo cáo khoa học: " Isolation, identification and expression analysis of salt-induced genes in Suaeda maritima, a natural halophyte, using PCR-based suppression subtractive hybridization" doc

... Rev5'TACCTCCTGGCTTCAACCAT; P5 CSFor5'GATGTTTTTGCTGCCATTGA, Rev5' GC TAATC CC AACCTCAGCAC; DnaJ-For5'GGAATACAGGAGGGG GA CAT, Rev5'CCTTTTGGGAGAACCAAACA; BADH-For5' TGGAAAATTGCTCCAGCTCT, Rev5'CTGGACCTAATCCC GTCAAA; ... glycinebetaine synthesis even in the plants not accumulating glycinebetaine naturally, like Arabidopsis thaliana, Brassica napus and Nicotiana tobacum [98] Moreover, modelling...
Ngày tải lên : 12/08/2014, 03:20
  • 25
  • 292
  • 0
Báo cáo khoa học: " Molecular characterization and phylogenetic analysis of the complete genome of a porcine sapovirus from Chinese swine" pdf

Báo cáo khoa học: " Molecular characterization and phylogenetic analysis of the complete genome of a porcine sapovirus from Chinese swine" pdf

... GTCCACATCAACGGCCGCCGGCTCG AGCCAACAGACACTCCTGTGTTCC CATGCCAGACCCTGATATTATCACC ACCTACACCAATGTCACCTGGAC GTGCCACACCTACTATGACCACAG TCAAGCCTCCAAACCAAGCC TGGCGGTCCATAAATGAGGTG TATGCAGCTTTGGCAATTCCC TTGATCTTTAGCAACTGTATCTG ... TGGTGGAGGCCTGTTCAGAGC CCAAGTTGTGGGCTGTCAACAC CAGAGTCCTCCTGGTGGACATTC ATTACCAAGCGCAACGCTAGGC CATGTGGCCAACATGTGTG TGATTTGGTCAAGGTAGCC CCTTCTACAACACCAAATGATTGCC AGGCCAGGATGTCAACAC...
Ngày tải lên : 12/08/2014, 04:21
  • 10
  • 401
  • 0
Báo cáo khoa học: Identification and expression analysis of an IL-18 homologue and its alternatively spliced form in rainbow trout (Oncorhynchus mykiss) doc

Báo cáo khoa học: Identification and expression analysis of an IL-18 homologue and its alternatively spliced form in rainbow trout (Oncorhynchus mykiss) doc

... translating two proteins of 199 amino acids and 182 amino Fig Alternative splicing of the IL-18 gene in rainbow trout (A) An alternative mRNA splicing site is present in exon of the trout IL-18 ... exons and five introns The Fig Comparison of the genomic organization of IL-18 and IL-1b genes in human, rainbow trout and the predicted Fugu/tetraodon orga...
Ngày tải lên : 16/03/2014, 16:20
  • 11
  • 426
  • 0
Báo cáo khoa học: Purification, characterization, cDNA cloning and nucleotide sequencing of a cellulase from the yellow-spotted longicorn beetle, Psacothea hilaris ppt

Báo cáo khoa học: Purification, characterization, cDNA cloning and nucleotide sequencing of a cellulase from the yellow-spotted longicorn beetle, Psacothea hilaris ppt

... PCR and sequencing A QuickPrepÒ Micro mRNA Purification Kit (Amersham Bioscience) was used for isolation of mRNA from P hilaris larval midguts First-strand cDNA synthesis from the isolated mRNA and ... degradation activity of P hilaris cellulase against crystalline cellulose, Avicel (Merck) was used under the same conditions as the CMCase assay Optimal pH for P h...
Ngày tải lên : 17/03/2014, 10:20
  • 6
  • 361
  • 0

Xem thêm