Expression analysis of GFAP like gene in zebrafish embryogenesis

EXPRESSION ANALYSIS OF GFAP-LIKE GENE IN ZEBRAFISH EMBRYOGENESIS ANITA BALAKRISHNAN NATIONAL UNIVERSITY OF SINGAPORE 2007 EXPRESSION ANALYSIS OF GFAP-LIKE GENE IN ZEBRAFISH EMBRYOGENESIS ANITA BALAKRISHNAN A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE DEPARTMENT OF ANATOMY NATIONAL UNIVERSITY OF SINGAPORE 2007 1 ACKNOWLEDGEMENTS I would like to express my sincere and heartfelt gratitude to my supervisors A/Prof Samuel S W Tay and Dr. S T Dheen, for their continued guidance, trust, patience and many invaluable suggestions provided during the course of the project. I am greatly indebted to Professor Ling Eng Ang, Head, Department of Anatomy for giving me a chance to work in the department. I would like to thank A/Prof Vladimir Korzh for giving me the opportunity to work in his laboratory and for his suggestions and advice for the project and thank all members of his lab; Dr. Haw Tien Fong for teaching me the required skills and for the many discussions; Kar-Lai Poon and Lee-Thean Chu for all their help and to all the rest of the lab members for making my experience there very memorable. I would like to thank Dr. Alexander Emelijanov and Mr.Anil Kumar M for their contributions to this project. I would like to acknowledge my gratitude to Mrs Yong Eng Siang and Mrs Ng Geok Lan for their excellent technical assistance; Mr Yick Tuck Yong for his assistance in computer work; Mrs Ang Lye Gek Carolyne, Mrs. Diljit Kaur Bachan Singh and Mrs Teo Li Ching Violet for their secretarial assistance; as well as Ms.Devi, Ms.Thenmozhi and Ms.Jayanthi for their support. 2 I would like to thank the staff and students of theNeuroscience Lab and Histology Lab and all other staff members and my fellow graduate students of the Department of Anatomy for contributing towards the successful completion of the project. I would like to thank the National University of Singapore for the financial assistance in the form of a research scholarship. Last, but not the least I want to thank my parents, my husband and my brother for their constant support and encouragement. 3 TABLE OF CONTENTS ABSTRACT 5 LIST OF TABLES 7 LIST OF FIGURES 8 ABBREVIATIONS 9 CONFERENCE PARTICIPATION 11 1 INTRODUCTION 1.1 GLIAL FIBRILLARY ACIDIC PROTEIN 1.2 DESCRIPTION OF THE cDNA FRAGMENT UNDER STUDY 1.3 ZEBRAFISH: A GOOD MODEL FOR DEVELOPMENTAL STUDY 1.3.1 Overview of embryonic development in Zebrafish 1.3.2 Development of the zebrafish CNS 1.3.2.1 Specification of the neuroectoderm 1.3.2.2 Regionalization of the neural tube 1.3.2.3 Neurogenesis 1.4 Objectives of the present Study 12 12 14 17 19 23 24 24 25 26 2 MATERIALS AND METHODS 2.1 ZEBRAFISH 2.1.1 Fish Maintenance 2.1.2 Stages of embryonic development 2.2 DNA APPLICATIONS 2.2.1 One-step RT-PCR 2.2.2 DNA Electrophoresis 2.2.3 Transformation 2.2.4 Isolation and purification of plasmid DNA 2.2.4.1 Miniprep of plasmid DNA 2.2.4.2 Midiprep plasmid preparation 2.2.5 Restriction digest and processing of linearized DNA 2.3 RNA APPLICATIONS 2.3.1 Isolation of total RNA from Zebrafish tissue 2.3.2 In situ hybridization 2.3.2.1 Antisense probe synthesis 2.3.2.2 Probe precipitation 2.3.2.3 Preparation of staged Zebrafish embryos 2.3.2.4 Proteinase K treatment 2.3.2.5 Prehybridization 2.3.2.6 Hybridization 2.3.2.7 Preparation of pre-absorbed anti-DIG antibody 27 27 27 27 28 28 28 29 29 29 30 31 32 32 33 33 33 33 34 34 34 35 4 2.3.2.8 Incubation with pre-absorbed antibodies 2.3.2.9 DIG staining 2.4 PROTEIN APPLICATIONS 2.4.1 Immunohistochemical staining 2.5 ADDITIONAL TECHNIQUES 2.5.1 Microinjection 2.5.2 Making of sub-slides 2.5.3 Cryostat sectioning 2.5.4 Mounting and Photography 35 36 36 36 37 37 38 39 39 3 3.1 3.1.1 3.1.2 3.2 3.3 3.3.1 3.3.2 41 41 41 43 49 51 51 RESULTS Expression analysis of zfgfap-l Temporal expression analysis of zfgfap-l Expression analysis of zfgfap-l by whole-mount in situ hybridization Expression analysis of zfgfap-l in mindbomb mutants (mib-/-) Functional analysis of zfgfap-l Injection of zfgfap-l morpholino shows no apparent phenotype Expression of GFAP protein in wild type and zfgfap-l morpholino injected embryos 3.3.3 Expression of neurogenin1 in wild type and zfgfap-l morpholino injected embryos 3.3.4 Expression of neuroD in wild type and zfgfap-l morpholino injected embryos 4 4.1 4.2 4.3 51 53 53 DISCUSSION Expression analysis of zfgfap-l in wild type embryos Expression analysis of zfgfap-l in mib-/- embryos Expression of GFAP in wild type and zfgfap-l morpholino injected embryos Expression of neuroD and neurogenin1 in wild type and zfgfap-l morpholino injected embryos 60 5 CONCLUSION 63 6 REFERENCES 64 7 7.1 APPENDIX Composition of buffers 76 76 4.4 56 56 58 59 5 ABSTRACT The present study focuses on a cDNA fragment of 2.6 kb coding for glial fibrillary acidic protein (GFAP) related gene in zebrafish. Earlier work in the lab revealed that this gene showed 72% homology, at the amino acid level, with the mammalian gene coding for GFAP. Due to variations observed in sequence of head domain of GFAP and in expression pattern compared to that of rodent GFAP, this gene was named as zebrafish GFAP like gene (zfgfap-l)( Gene Bank Accession No: AY 397679). In this project, the expression pattern of zfgfap-l was studied by RT-PCR and in situ hybridization. RT-PCR results showed that the expression of zfgfap-l started as early as 1.5 hours post-fertilization (hpf) and increased steadily up to 10 hpf, then became a constant level of expression till 30 hpf. In embryos at sphere stage, the expression was detected in the cells of the superficial layer by in situ hybridization. After gastrulation, the expression became restricted to the neural tube, particularly in the presumptive forebrain, midbrain and posterior neural tube. This expression pattern continued to be similar at least until 24 hpf. At 48 hpf, the expression was mainly detected in the subventricular zone of the forebrain, midbrain, and hindbrain and the dorsoventral axis of the presumptive spinal cord. This expression pattern of zfgfap-l in neural progenitor cells prompted the present author to speculate that this gene could be one of the key molecules involved in zebrafish neurogenesis. In accord with this, zfgfap-l was found to be absent in several distinct locations of mindbomb mutants which have a defective Delta-Notch signaling pathway, resulting in excessive differentiation of progenitors into the neuronal phenotype. 6 These results suggest that maternally transferred zfgfap-l transcripts continue to be present in the precursors of neuronal and non-neuronal cell populations during early embryogenesis and subsequently become restricted to the cellular populations in the subventricular zone where the neural stem cells lie. To confirm if zfgfap-l was indeed associated with progenitors, zfgfap-l morpholino was microinjected into embryos and the expression of two proneural markers- neuroD and neurogenin1 (ngn1) was examined. If indeed zfgfap-l was associated with progenitors, there would be significant changes in the expression of neuroD and ngn1. The expression was found to be similar in both wild type and morpholino injected embryos. However, more work needs to be done since there are a number of other factors (like redundancy of zfgfap-l) that may be involved. 7 LIST OF TABLES Table 1: Summary of the principal events during Zebrafish embryogenesis 22 8 LIST OF FIGURES Fig 1: Sequence analysis and mapping of zfgfap-l 15 Fig 2: Representative stages of zebrafish embryogenesis 21 Fig 3: RT-PCR analysis of zfgfap-l and β-actin 42 Fig 4: In situ hybridization of zfgfap-l on 6, 11 and 18 hpf embryos 44 Fig 5: In situ hybridization of zfgfap-l on 24 hpf embryos 46 Fig 6: In situ hybridization of zfgfap-l on 30 hpf embryos 47 Fig 7: In situ hybridization of zfgfap-l on 48 hpf embryos 48 Fig 8: In situ hybridization of zfgfap-l on 48 hpf mib-/- embryos 50 Fig 9: Whole-mount GFAP immuno-staining on 48 hpf zfgfap-l morpholino injected and wild type embryos 52 Fig 10: In situ hybridization of ngn1 on 30 hpf zfgfap-l morpholino injected and wild type embryos 54 Fig 11: In situ hybridization of neuroD on 30 hpf zfgfap-l morpholino injected and wild type embryos 55 9 ABBREVIATIONS % µg µl AP BCIP bHLH bp BMP BSA C Ca(NO3)2 CNS DIG DMSO DNA EB FBS FCS GFAP h H2O HCl hpf IgG K2 HPO4 kb KCl LB amp+ LB M MgSO4 mib min ml mM mRNA N Na2HPO4 NaCl NBT ngn1 NGS PBS Percent Microgram Microlitre Alkaline Phosphatase 5-bromo, 4-chloro, 3-indolil phosphate Basic Helix Loop Helix Basepair Bone Morphogenetic Protein Bovine Serum Albumin Celsius Calcium nitrate Central Nervous System Digoxygenin Dimethyl Sulphoxide Deoxyribonucleic acid Elution Buffer Fetal Bovine Serum Fetal Calf Serum Glial Fibrillary Acidic Protein Hours Water Hydrogen chloride Hours post fertilization Immunoglobulin G Dipotassium hydrogen phosphate Kilobase Potassium chloride LB medium containing ampicillin Luria-Bertani broth Molar Magnesium sulphate mindbomb gene Minutes Milliliter Millimolar Messenger RNA Normality Sodium di-hydrogen phosphate Sodium chloride Nitro Blue Tetrazolium neurogenin1 Normal Goat Serun Phosphate Buffered Saline 10 PBT PFA RNA rpm RT-PCR sec SSC TESPA tRNA UV V zfgfap-l Phosphate buffered saline with 0.1% Tween-20. Paraformaldehyde Ribonucleic acid. Revolutions per minute Reverse Transcriptase Polymerase Chain Reaction Seconds Sodium saline citrate Aminopropyl triethoxysilane Transfer RNA Ultraviolet Volts zebrafish GFAP like gene 11 CONFERENCE PARTICIPATION Poster presentation on “Expression analysis of GFAP-like gene on zebrafish embryogenesis” in the 6th National Symposium on Health Sciences, KL, 2006. 12 1 INTRODUCTION 1.1 Glial Fibrillary Acidic Protein (GFAP) Glial Fibrillary Acidic Protein (GFAP) is a type III protein of the intermediate filament family. GFAP was first characterized as the major intermediate filament protein of mature astrocytes in the Central Nervous System (CNS) (Eng et al., 1970). Mammalian GFAP has a characteristic structure composed of a highly conserved central alpha-helical rod domain flanked by non-helical head and tail domains (Onteniente et al., 1983; Eng et al., 2000). GFAP is a universally recognized marker for the astrocyte cell type. It is a key component of the astrocyte cytoskeleton (Cameron and Rakic, 1991). Astrocytes are the major non-neuronal components of the CNS. Interactions between neurons and astrocytes are critical for signaling, energy metabolism, extracellular ion homeostasis, volume regulation and neuroprotection in the CNS. The largest portion of the astrocyte membrane faces the synapse and the remainder abuts the capillaries forming end foot processes. The astrocyte end foot process domain contributes to the induction and maintenance of the blood-brain barrier, uptake of nutrients from the capillaries, ammonia detoxification and buffering of extra-cellular potassium (K+) ions. Astrocytes also play a key role in the regulation of synaptic levels of glutamate (Hertz and Zielke., 2004). Astrocytes provide metabolic support to neurons, protect them against oxidative stress and provide a parallel pathway for propagation and modulation of excitatory signals in the brain (Benarroch., 2006). Recently it has also been shown that astrocytes can also instruct unspecified cells to become neurons during neurogenesis (Song et al., 2002), 13 although neurons can be identified much earlier than the glial cells during neurodevelopment. The two main regions where the neural stem cells are thought to reside are the hippocampus and the areas surrounding the fluid filled ventricles in the middle of the brain and spinal cord-sub ventricular zone (Svendsen CN., 2002). Subventricular astrocytes have great potential to reproduce neurons (Steindler, 1993; Doetsch et al., 1999) especially in the forebrain zone, which is the most dynamic of the brain’s neurogenic regions. As a result of trauma, disease, genetic disorder or chemical exposure, astrocytes in the CNS become reactive and respond by a process called astrogliosis, which is characterized by rapid synthesis of GFAP intermediate filaments (Eng et al., 2000). The cellular specificity of GFAP makes it the universally recognized marker for astrocytes (Steinert and Roop., 1988; Tardy et al. 1989) and the role of GFAP seems vital in CNS differentiation processes. GFAP expression has been reported to be observed during late prenatal and early postnatal development in rodents and first quarter of pregnancy in humans (Landry et al., 1990; Lazarini et al., 1991; Sarthy et al., 1991; Voronina and Preobhrazehensky, 1994). Mutations in coding region of GFAP have been associated with Alexander disease, a genetic disorder of astrocytes (Brenner et al., 2001). It is still unclear as to how altered GFAP might lead to Alexander disease. One hypothesis is that altered GFAP blocks the normal assembly of intermediate filaments; leading to protein deposits inside the cell, thereby normal astrocyte functions, such as interactions with other specialized cells in the brain are disturbed. This may result in the inability to maintain the blood-brain barrier (Li et al., 2005). 14 In zebrafish, goldfish GFAP immuno-reactivity has been shown to first appear in the brain at 15 hpf (Marcus and Easter, 1995). However, it has been established that GFAP may exist in more than one form in lower vertebrates as reported in Xenopus (Szaro and Gainer, 1988). 1.2 DESCRIPTION OF THE cDNA FRAGMENT UNDER STUDY A zebrafish cDNA fragment of size 2.6 kb was isolated earlier in the lab from a zebrafish EST. Sequence analysis revealed a 1083- bp ORF, preceded by 260 untranslated bases and a 1311 bp 3’UTR (Gene Bank Accession No: AY 397679). Translation by Blast search (Altschul et al., 1997), predicted a 361 amino acid protein sequence having about 72 % homology with mouse, rat and human GFAP. Hence, the gene that was isolated was named as zebrafish GFAP like gene (zfgfap-l). GFAP is composed of a highly conserved central α helical rod domain flanked by non-helical head and tail domains. The rod domains and the non-α helical tail domains are well conserved among the species analyzed. In addition, alignment of head domains of mouse and human GFAP with that of zfgfap-l reveals that the PR-box motif of the zfgfap-l differs from that of mouse and human GFAP (Fig 1A). However, the phylogenetic analysis indicates that zfgfap-l has a close relationship with the human and mouse GFAP (Fig. 1B). Due to differences observed in the sequence and expression pattern from the mammalian GFAP, this gene has been named as the zebrafish GFAP–like gene (zfgfap-l). Further, mapping analysis reveals that this gene is linked to zebrafish LG3 (Fig. 1C). 15 Fig 1: Sequence analysis and mapping of zfgfap-l 1A. Amino acid sequence alignment of the head domain of zfgfap-l with the human and mouse GFAP head domains. Conservative residues are indicated in bold letters. Predicted phosphorylation sites are underlined. GFAP PR-box motif in human and mouse indicated by arrows. The leucine zipper pattern in the zebrafish GFAP is shown in italic. B. Phylogenetic analysis reveals that the zfgfap-l has a closer relationship with 16 human and mouse GFAP. Numbers in nodes indicate the confidence of phylogenetic analysis (probability in 100 bootstrap analysis). Mean bootstrap value of consensus tree (sd): 64% (± 29%). Accession numbers are: zebrafish GFAP #AY 397679; human GFAP # P14136; mouse GFAP # P03995; human peripherin #P41219; mouse peripherin #P15331; goldfish plasticin #P313393; zebrafish plasticin # AAC34932; zebrafish desmin # AAB03217; human desmin #P17661; zebrafish vimentin # AAC98491; human vimentin #P08670; mouse vimentin #P20152; zebrafish gefiltin # AAC34933; Xenopus xefiltin # AAB41403; human α-internexin #AAB34482; mouse α-internexin #P46660. C. Linkage map analysis reveals that zfgfap-l is in the region of zebrafish LG3 17 1.3 Zebrafish: A Good Model for Developmental Study Zebrafish, Danio rerio is a cyprinid fish found naturally in the rivers of India and Pakistan. The work of G.Streisinger drew peoples’ attention to the potential of the zebrafish as an effective experimental system, which is highly suited to genetic analysis (Streisinger et al., 1981). Adult zebrafish are only about an inch long, so large numbers can be maintained relatively inexpensively in a small space. They reach sexual maturity in around three months, and a large number of eggs are produced during every mating. The zebrafish embryos develop externally, and are optically clear, making it possible to observe the entire course of early development (Kimmel et al., 1995). The clarity of the embryos enables scientists to label individual cells and their fate can be followed to learn how mutations affect embryonic development. The optical clarity of embryos allows noninvasive, direct, real-time video microscopic imaging of any portion of the embryo. It also permits whole-mount in situ hybridization analysis of gene expression with extraordinarily high resolution. A number of tools and methodologies have been developed to exploit the advantages of the zebrafish system. Experimental manipulation of embryos can be done by techniques such as microinjection of biologically active molecules, microbead implantation, cell transplantation, fate mapping and cell-lineage tracing (Stainier et el., 1993; Mizuno et al., 1999; Holder and Xu, 1999; Kozlowski and Weinberg, 2000; Reifers et al., 2000). In addition to all the above mentioned advantages, there are techniques for producing homozygous diploid fish (Streisinger et al., 1981). Also in zebrafish, mutants can be easily identified and their parents can still be bred to keep the mutation in the 18 heterozygotes. By mating these heterozygotes, the mutant phenotype will continue to be expressed and therefore available to be studied. The zebrafish screening strategies have provided hundreds of developmental mutations in zebrafish (Development. Volume 123, 1996). The zebrafish is highly amenable for genetic analysis and this has been an extremely valuable tool for the identification of developmentally important genes and elucidating their function in vivo (Driever et al., 1994). For example, through a forward genetic approach, a number of mutations have been used to study early embryonic patterning (Mullins and Nusslein-Volhard., 1993) and neuronal diversity in the retina (Malicki et al., 2000). Despite all the above mentioned advantages, zebrafish also has a few drawbacks. The mutants available for zebrafish are by no means saturating. Many genes, when mutated will lead to very early developmental arrest or death, thus eluding screens designed around observable phenotypic alterations. In addition, techniques for targeted mutagenesis (similar to “knockout” mice) are currently unavailable in the zebrafish. Another factor to be borne in mind is that, there is now substantial evidence that tetraploidization, rediploidization have taken place during the early evolution of the teleost and that hundreds of duplicate pairs generated by this event has been maintained over millions of years of evolution (Volff., 2005). In a nutshell, given its numerous strengths as a molecular genetic and embryological system, the zebrafish will undoubtedly contribute to our knowledge in vertebrate development. 19 1.3.1 Overview of embryonic development in zebrafish The knowledge of the stage-by-stage development of the zebrafish and a detailed understanding of its morphology and anatomy at every stage are of great importance in analyzing the spatial and temporal expression patterns of a novel gene, in order to deduce its significance in the development of the organism. The embryonic development of the zebrafish from its one cell stage to five days post fertilization, when the newly hatched larva starts feeding has been described by Kimmel et al., 1995. Development (Fig 2) starts from the one-cell stage (or the zygotic period) and this stage is characterized by the streaming of the cytoplasm towards the animal pole to form the blastodisc. The next stage is the cleavage period (0.7 hpf-2.2 hpf). Cell cycles occur rapidly and synchronously. These cells, known as blastomeres, accumulate over the yolk cell. The blastula stage (2.25 hpf-5.25 hpf) follows next, when the embryo is ball shaped, after seven cleavages and reaches the 128 cell stage. The cell cycles during the early blastula period are metasynchronous. Important events during this stage are the mid blastula transition, formation of the yolk syncytial layer (YSL) and the beginning of epiboly. Epiboly can be defined as the thinning and spreading of both the YSL and the blastodisc over the yolk cell. 20 The next stage is the gastrula period (5.25 hpf-10 hpf). Epiboly continues; involution commences and leads to the formation of two layers of cells-epiblast and hypoblast. The cells of the epiblast and hypoblast converge to the dorsal side of the embryo to create the primordium of the body axis-an embryonic shield (Strahle and Blader., 1994; Kimmel et al., 1995). Segmentation period follows next (10.3 hpf-24 hpf). Morphogenetic movements lead to the development of somites (segments). The rudiments of primary organs are visible, tail bud becomes visible and the embryo elongates. The anterior-posterior axis and the dorsoventral axis are clearly defined. The pharyngula period (24 hpf-48 hpf) is the next stage. The embryo is a bilaterally organized creature, with a well developed notochord and the nervous system is also developed. The hatching period (48 hpf-72 hpf) follows next. Hatching is indicated by the rapidly developing rudiments of the pectoral fins, the jaws and the gills. 21 Fig 2: Representative stages of Zebrafish embryogenesis (Haffter et al., 1996) 22 Period Hpf Zygote 0 Cleavage 0.75 Description The newly fertilized egg till the completion of the first zygotic cycle Cell cycles 2 through 7 occur rapidly and asynchronously Rapid metasynchronous cell cycles give way to lengthened Blastula 2.25 asynchronous cell cycles at the mid blastula transition; epiboly begins Morphogenetic movements of involution, convergence and Gastrula 5.25 extension form the epiblast, hypoblast and embryonic axis; through the end of epiboly Segmentation 10.00 Somites, pharyngeal arch primordia, and neuromeres develop; primary organogenesis; earliest movements; the tail appears Phylotypic-stage embryo; body axis straightens from its early Pharyngula 24.00 curvature about the yolk sac; circulation, pigmentation, and fins begin to develop Completion of rapid morphogenesis of primary organ systems; Hatching 48.00 cartilage development in head and pectoral fins; hatching occurs asynchronously Early larva 72.00 Swim bladder inflates; food-seeking and active avoidance behaviors Table 1: Summary of the principal events during Zebrafish embryogenesis* * http://zfin.org/zf_info/zfbook/stages/org.html 23 1.3.2 Development of the zebrafish CNS Neurogenesis may be subdivided into several distinct processes • Establishment of neural competence of the ectoderm (neural induction). • Subdivision of the CNS into regions with distinct properties (regionalization). • Morphogenetic transformation of the neural plate into a neural tube (neurulation). • Generation of connections between neurons within the CNS and between the CNS and axons (axonogenesis). The zebrafish CNS originates as an ectodermal epithelium on the dorsal side of the embryo. This region forms a structure called the neural plate with a dorsomedial thickening of cells.The neural plate is formed immediately after gastrulation (Schmitz et al., 1993). The neural plate is visible as a thickening comprising dorsal and lateral parts of the epiblast (Schmitz et al., 1993). The neural plate, at the completion of gastrulation, is morphlogically distinct and is highlighted by the appearance of a medial thickening overlying the notochord and two lateral swellings at the lateral boundaries of the neural plate (Schmitz et al., 1993). Following this, the lateral swellings move towards the dorsal midline while the medial thickening above the notochord increases in size, forming the neural keel. Neural keel forms in anterior- posterior progression (Papan et al., 1994).The cells in the centre of the neural keel detach to form the neurocele or central canal (Schmitz et al., 1993; Papan and Campos-Ortega., 1994). Cells then cross the midline during the formation of the neural keel, so that descendants of individual neural plate cells will end up in both sides of the neural keel (Kimmel et al., 1994). A summary of the 24 mechanisms underlying the specification of the neuroectoderm and neurogenesis is given below. 1.3.2.1 Specification of the neuroectoderm Formation of the neural plate is associated intimately with the establishment of dorsoventral positional identity during gastrulation. At the molecular level, there is increasing evidence that non-neural ectoderm promoting signals are members of the Bone Morphogenetic protein (BMP) subfamily of the transforming growth factor-ß (TGF-ß) class of growth factors (Blader and Strahle ., 2000). Addition of BMP’s to dissociated ectodermal cells induces an epidermal fate and blocks them from adopting a neural fate (Wilson and Hemmati-Brivanlon., 1997). Prevention of BMP signaling causes epidermal differentiation to be inhibited and neural plate to be expanded (Graff et al., 1994; Hammerschmidt et al., 1996; Blader et al., 1997; Neave et al., 1997;). Several candidates of BMP antagonizing pathway have been identified, viz: chordin, noggin, follistatin etc (Fainsod et al., 1997; Merker et al., 1997; Bauer et al., 1998; Furthauer et al., 1999;). 1.3.2.2 Regionalization of the neural tube The neural tube of zebrafish embryos is highly polarized along the dorsoventral axis. In the spinal cord, sensory neurons form at dorsal aspects, whereas motoneurons and the floor plate develop at the ventrolateral and ventral positions respectively, and interneurons occupy intermediate regions (Blader and Strahle., 2000). An important organizing centre of the ventral neural tube is the axial mesoderm, which is composed of the notochord and prechordal plate mesoderm. The second organizing 25 centre is the floor plate, and is established in the ventral neural tube itself. There are a number of inductive signals, sonichedgehog (shh) being the most important (Briscoe and Ericson., 2001). shh is produced by the notochord and floor plate and has been shown to be necessary and sufficient in vivo and in vitro to induce the differentiation of most ventral sub-types (Marti et al., 1995; Roelink et al., 1995; Ericson et al., 1996). The important organizing centre of the dorsal neural tube is the roof plate and gives out several inductive signals, BMP being the most important. In addition to dorsoventral patterning, there is also antero-posterior patterning. The anteroposterior pattern of the CNS in the zebrafish also appears to be laid down as a differential competence to respond to neural inducing signals in the entire epiblast, comprising both neural and non-neural ectoderm (Koshida et al., 1998). 1.3.2.3 Neurogenesis The activity of members of a sub-class of basic helix loop helix (bHLH) transcription factors are instrumental in most, and perhaps all vertebrate lineages (Bertrand et al., 2002). These transcription factors are vertebrate homologues of invertebrate proneural proteins, which in flies are both necessary and sufficient for the commitment of ectodermal cells to a neural progenitor fate (Campos-Ortega., 1993; Modolell., 1997). Proneural clusters are characterized by expression of proneural genes (belonging to the bHLH family). Cells within the proneural cluster are signaled out to become neurons by a competitive mechanism based on Delta-Notch signaling (Chitnis., 1995; Appel and Eisen., 1998; Haddon et al., 1998) 26 1.4 Objectives of the present study The main objectives of this project were to analyze the expression pattern and also the function of zfgfap-l. With this in mind, the spatio-temporal expression of zfgfap-l was studied in wild-type and mutant embryos. An attempt to analyze the role of zfgfap-l was made by injection of zfgfap-l morpholinos. 27 2 MATERIALS AND METHODS 2.1 ZEBRAFISH 2.1.1 Fish Maintenance Zebrafish (Danio rerio) AB line was used as a wild-type line. This was obtained from Tubingen stock centre. The fishes were maintained according to the method described by Westerfield (1995). Fishes were fed three times per day with brine shrimps, brown powder or N+. They were kept under photoperiod cycle set at 14h of daylight and 10h of darkness. Crosses were set after the third meal at 18:00 hours with a divider and a wire mesh. Divider was removed at desired time to stimulate spawning behavior. Embryos were then collected by a sieve and rinsed thoroughly to remove any waste materials attached to the chorion. The allele of mind bomb (mib -/-) was ta52b (Jiang et al., 1996) 2.1.2 Stages of embryonic development In developmental studies, the accurate staging series is a tool important for defining the timing of various developmental events. The embryos used were raised at 28.50C. The approximate stage of a living embryo is determined by examination under a dissecting stereomicroscope (Leica). Fig 2 shows the different developmental stages. 28 2.2 DNA APPLICATIONS 2.2.1 One-step RT-PCR Total RNA was extracted from embryos of desired stages using RNeasy Mini kit (Qiagen) (section 2.3.1). cDNA for RT-PCR analysis was synthesized using Qiagen OneStep RT-PCR kit (Qiagen) according to the manufacturers instructions. A 440 bp fragment of the GFAP gene was amplified using specific primers 5’ CAG AAT CAC TGT TCC 3’ (forward) and 5’ ATA GCA CAT TCT GCG 3’ (reverse). The number of amplification cycles was optimized to ensure that PCR products were quantified during the exponential phase of the amplification. In brief, 2µg of total RNA was reverse transcribed and amplified in a 50µl reaction volume. Aliquot (5µl) of each PCR product was separated by electrophoresis on a 2% agarose gel, stained with ethidium bromide and photographed under ultra violet (UV) light (Section 2.2.2). As an internal control for the RT-PCR, a 450 bp fragment of zebrafish β-actin was also amplified using the following primers: 5' CTT CCT TCC TGG GTA TGG AAT C 3' (forward) and 5’ CGC CAT ACA GAG CAG AAG CCA 3’ (reverse). 2.2.2 DNA Electrophoresis Typical DNA electrophoresis was performed in 1% agarose gel unless there was a requirement for a change. The agarose powder was dissolved in 1X TAE (0.04M Trisacetate; 0.001 M EDTA) and heated to boil in a microwave oven. After the solution was cooled to 600C, ethidium bromide was added to a final concentration of 0.5µg/ml and mixed thoroughly by swirling the flask. The mixture was then poured into a gel caster 29 with appropriate sized comb. DNA samples were mixed with 6X loading dye (to a final concentration of 1X) and loaded into the 1% agarose gel along side a 1kb DNA ladder. The gel was run at 120V and the bands were observed under UV light with the help of a transilluminator. Syngene’s Chemigenius2 was used to obtain gel pictures. 2.2.3 Transformation To 100μl of the competent cells, 1μl of the vector, containing the fragment of interest was added. The cells were kept on ice for 30min and transferred to 42°C for 30s to provide heat shock in order to enable the uptake of the plasmid. After transformation via heat shock, the cells were placed back on ice for 10min after which 250μl Luria Bertani (LB) medium was added and the cells were incubated in an Orbital shaker for 1hour at 37°C. Following incubation, the cells were plated onto LB agar (with Ampicillin) plates (Ampicillin selects for colonies that have been transformed with the cDNA containing vector) in a fume hood. The plates were then incubated overnight at 37°C. 2.2.4 Isolation and purification of plasmid DNA 2.2.4.1 Miniprep of plasmid DNA Small scale preparation of plasmid DNA was carried out using the QIAprep Miniprep kit (Qiagen). To confirm the uptake of the vector, single colonies were picked up, inoculated in 5ml LB amp+ (LB medium containing 100µg/ml Ampicllin) medium and incubated for 12-16 h in an Orbital shaker at 37°C. 2ml of the suspension were centrifuged at 13,000 revolutions per minute (rpm) for 15min and the supernatant was discarded. To the pellet, 250μl of the re-suspension buffer, P1 were added. Following re-suspension, the cells 30 were lysed using 250μl of the lysis buffer P2 and the tubes were inverted 4-6 times. Neutralization of the lysis buffer was achieved by adding 350μl of P3 after which the tube was centrifuged at 13,000 rpm for 10min. The supernatant was applied to the miniprep spin column, centrifuged at 13,000 rpm for 60sec and the flow through was discarded. The column was first washed with 750μl wash buffer PE and centrifuged for 60sec. After discarding the flow through, the column was centrifuged for an additional 60 sec to remove all traces of the wash buffer. The spin column was then transferred to a new tube; 20μl of the elution buffer, (EB) were added, the tube was centrifuged for 1min and the plasmid DNA in EB was collected. The DNA was checked on a 1% agarose gel and the sample showing the presence of a band corresponding to the size of the vector was chosen. 2.2.4.2 Midiprep plasmid preparation 1ml of the cell suspension collected in the previous step was added to 100ml of LB amp+ medium and was incubated overnight at 37°C for 16h in an Orbital shaker. A Qiagen midiprep kit was used to extract the amplified plasmid. The suspension was centrifuged the following day at 6,000 rpm for 15min at 4°C and the supernatant was discarded. The pellet was re-suspended in 4ml of the re-suspension buffer, P1. Cell lysis was carried out by adding 4ml of lysis buffer P2 and the tube was inverted 4-6 times. 4ml of the chilled buffer P3 were added to neutralize the excess lysis buffer and the tube was inverted 4-6 times and kept on ice for 15min. The contents in the tube were then centrifuged at 12,000 rpm for 30min at 4°C, the supernatant was discarded and the tube was further centrifuged at 12,000 rpm for another 15min at 4°C. The supernatant from the final step was applied 31 to a QIA-100 column which had previously been equilibrated with 4ml of equilibration buffer, QBT. The flow through was discarded and the column was washed twice with 10ml wash buffer, QC. The DNA bound to the column was finally eluted with 5ml elution buffer QF. To the elute, 3.5ml of room temperature isopropanol were added and centrifuged at 11,000 rpm for 30min at 4°C. The supernatant was discarded and the pellet was washed with 2ml 70% ethanol and centrifuged at 11,000 rpm for 10min. The pellet, after the wash, was re-suspended with 100μl sterile nuclease free water. The DNA was quantified by optical density reading using spectrophotometer. 2.2.5 Restriction digest and processing of linearized DNA 10μg of the plasmid DNA was linearized at the 5’ end of the cDNA insert by using the appropriate restriction enzyme (NEB). The reaction was performed at 37°C for 2h in a total volume of 100μl containing 10μl of 10X appropriate restriction buffer and 10μl of the appropriate enzyme. The mixture was vortexed, centrifuged and incubated for 2h at 37°C. To the digested plasmid, 100μl of equilibrated phenol was added and the mixture was vortexed and centrifuged at 13,000 rpm for 10min. The supernatant was collected, carefully, avoiding the interphase. To the supernatant, 100μl of chloroform were added, the mixture was vortexed, centrifuged for 10min and the supernatant was once again collected. To this supernatant, 250μl of 100% ethanol were added and precipitated at -80 °C for 20min. The contents of the tube were then centrifuged for 10min and the pellet was retained and washed with 70% ethanol. After the wash, the pellet was thoroughly dried and then dissolved in 40μl of sterile nuclease free water. The samples were gel 32 checked to see if a linearized template was obtained for DIG labeled probe synthesis. For zfgfap-l, EcoRI (New England Biolabs) was used. 2.3 RNA APPLICATIONS 2.3.1 Isolation of total RNA from Zebrafish tissue Dechorionated zebrafish embryos were collected at desired stages and placed in a 1.5ml Eppendorf tube. Liquid was siphoned out from the tube. RNA was extracted using the RNeasy mini spin kit (Qiagen). 350μl of buffer RLT were added to the tubes and the embryos were pulverized. The lysate was then spun down at 13,000 rpm for 3min. The supernatant was decanted into a sterile 1.5ml tube. 350μl of 70% ethanol were added into the cleared lysate and mixed well. This mixture was transferred to an RNeasy mini spin column sitting on a 2ml collection tube. The column was then spun down at 10,000 rpm for 15sec. The flow through was discarded. 350μl of buffer RW1 were added to the column and again spun down at 10,000 rpm for 15sec. The flow through was discarded. 500μl of buffer RPE were added to the tube, spun down for 15sec at 10,000 rpm. The flow through was discarded and the washing step was repeated with another 500μl of buffer RPE. The column was then spun down for 2min at 10,000 rpm. The flow through and the collection tube were discarded. The column was placed in a new 2ml collection tube and spun down for an additional 1min to remove all traces of the buffer RPE. Column was then transferred to a sterile 1.5ml tube. Total RNA was eluted by the addition of 30μl of sterile nuclease free water onto the RNeasy membrane and spun down for 2min. The RNA was then quantified by optical density reading using a spectrophotometer. 33 2.3.2 In situ hybridization 2.3.2.1 Antisense probe synthesis 5µg of plasmid DNA were linearized at the 5’ end of the cDNA insert by a proper restriction enzyme at 370C for 2h. 1µg of linearized DNA was used to synthesize the DIG labeled probe. The reaction was performed at 370C for 3h in a total volume of 20µl containing 2µl of 10X transcription buffer (Ambion, USA), 2µl of DIG-NTP mix[10mM ATP, 10mM CTP, 10mM GTP, 6.5mM UTP and 3.5mM DIG-UTP(Roche Diagnostics)] and 1µl of RNase inhibitor [40U/µl (Ambion, USA)]. 2µl of RNase free DNase I were used to digest the DNA template at 370C for 15min following this reaction. The enzyme used for zfgfap-l probe was SP6 Polymerase (Ambion, USA). 2.3.2.2 Probe precipitation After digestion of the DNA template, 4µl of 2.5M lithium chloride (Ambion, USA) and 75µl of 100% ethanol were added to the sample. The sample was kept at -800C for half an hour. The sample was then spun at 13,000 rpm for 10min. The pellet was washed with 70% ethanol and re-suspended in a final volume of 50-70µl of sterile, nuclease free water. 2.3.2.3 Preparation of staged zebrafish embryos Embryos were dechorionated manually using a pair of 26 gauge hypodermic needles and fixed. Staged embryos were fixed in 4% PFA (paraformaldehyde)/PBS(0.8% NaCl; 0.02% KCl; 0.0144% Na2HPO4; 0.024% KH2PO4; pH 7.4) for 12h at room temperature 34 or at 40C overnight. Embryos younger than 15 hpf were fixed before dechorionation and the chorion was removed afterwards. Embryos older than 16 hpf were dechorionated before fixation. After fixation, the embryos were washed in PBST (0.1% Tween-20 in PBS) twice for 1min each, followed by four times for 20 min each on a nutator at room temperature. 2.3.2.4 Proteinase K treatment This step was carried out for embryos older than 14 somites (>16 hpf). Embryos were treated with 10µg/ml of Proteinase K in 1X PBST at room temperature. The embryos were exposed to Proteinase K for a time span varying from 5 to 12min.Younger embryos are more sensitive and are treated for a shorter time. To stop the Proteinase K reaction, the Proteinase K solution was completely removed, and the embryos were fixed again in 4% PFA/PBS for 20min at room temperature. Embryos were then washed in PBST twice for one minute each and four times for 20min each. 2.3.2.5 Prehybridization Prehybridization was performed by replacing PBST with hybridization buffer [50% formamide; 5X SSC; 50µg/ml heparin; 500µg/ml tRNA; 0.1% Tween-20; pH 6.0 (adjusted by citric acid)]. The tube was incubated at 680C overnight. 2.3.2.6 Hybridization 2µl of DIG-labelled probe were diluted in 200µl of hybridization buffer and denatured at 800C for 5min, followed by 5min on ice. Selected embryos were placed in a 1.5ml 35 Eppendorf tube and the original hybridization solution removed and the probe added in. Hybridization was carried out at 680C in a circulating water bath overnight. In the next morning the embryos were washed in 2X SSCT with formamide for 1h at 680C. This is followed by a second wash with 2X SSCT without formamide for 15min. The final wash was in 0.2X SSCT at 680C for 1h. 2.3.2.7 Preparation of pre-absorbed anti-DIG antibody Commercial anti-DIG-AP antibody (Roche Diagnostics) should be pre-incubated with biological tissue, to decrease the staining background and to increase signal-to-noise ratio. In the present study, sheep anti-DIG-AP antibody was diluted 1:500 in PBS/10% FBS (Fetal Bovine Serum, Gibco BRL, USA) and incubated with 50 zebrafish embryos of any stage on a nutator at 40C overnight. After that, the antibody solution was transferred to a new tube and diluted to 1:500 with PBS/10%FCS, 10µl of 0.5M EDTA (pH 8.0) and 5µl of 10% sodium azide were added to a volume of 10ml antibody solution to prevent bacterial growth. The pre-absorbed antibody was stored at 40C and can be used several times. 2.3.2.8 Incubation with pre-absorbed antibodies After hybridization and post-hybridization washes, the embryos were incubated in PBS/10%FCS for 2h at room temperature to block non-specific binding sites for antibody. After removing the blocking solution, the embryos were incubated with preabsorbed anti-DIG-AP antibody at 40C overnight. 36 2.3.2.9 DIG staining After antibody incubation, embryos were washed 4 times for 20min each in maleic acid buffer followed by 3 washes for 15min each in detection buffer. NBT/BCIP colour substrate development was performed in the presence of 0.3375µg/ml of nitroblue tetrazolium (NBT) (Sigma-Aldrich, USA) and 0.175µg/ml of 5-bromo, 4-chloro, 3indolil phosphate (BCIP) (Sigma-Aldrich, USA) dissolved in the detection buffer. Color development was allowed to proceed in the dark and monitored occasionally under light microscopy until the desired intensities were achieved. For control and experimentally injected sets of embryos, the staining procedures were started and stopped at the same time. 2.4 PROTEIN APPLICATIONS 2.4.1 Immunohistochemical staining Fresh embryos were collected at appropriate stages and fixed in 4% PFA overnight at 40C or embryos that have already undergone in situ hybridization were used. The next morning, the embryos were washed in PBT (pH 7.4) for 4X 5min each. The embryos were then rinsed with ddH2 O once for 5min. If the embryos were older than 22 hpf, they were treated with cold acetone at -200C for 7min to permeabalize the samples. The acetone was removed and the embryos were rinsed with H2O, These samples were then washed once in PBDT (0.1% Tween-20; 1% DMSO in PBS). For blocking of nonspecific binding, the samples were put in PBDT with 10% fetal bovine serum (FBS) for 2h at room temperature. Primary antibody (Monoclonal Glial Fibrillary Acidic Protein, 37 Sigma USA) was diluted to 1:500 in PBDT with 1% NGS [Normal Goat Serum (Gibco BRL, USA)]. The following day, embryos were washed 6X for 1h each in PBDT with 1% NGS and 0.1M NaCl. For secondary antibody incubation, the fluorescein labeled mouse secondary IgG (Alexa Fluor Ig G) was diluted by adding PBDT with 1% FBS followed by rocking on a nutator at 40C overnight. Washing was carried out the next day five times for 1h each using PBDT (with 0.1% NGS and 0.1M NaCl). To detect the signal of secondary antibodies, TSA fluorescein kit (Perkin Elmer) was used. Embryos were stained for 10min. The staining was observed under UV microscope and stopped when an appropriate staining intensity was reached. To stop the reaction, the embryos were rinsed in PBDT and then washed in PBDT containing Tween-20. Embryos were prepared for viewing and photography as for in situ hybridization. 2.5 ADDITIONAL TECHNIQUES 2.5.1 Microinjection of morpholinos. Morpholinos are chemically modified oligonucleotides and have been shown to be highly effective translational inhibitors in Zebrafish (Nasevicus and Ekker., 2000). Two morpholinos (both targeting the 5’UTR region of zfgfap-l) were injected at one-cell stage. 38 The sequence of the morpholinos are : Morpholino 1 5’ GAGCTAGAGTAAGAGGAGGTGGTAC 3’ Morpholino 2 5’ AGGAACGCTGGGACTCCATGGTGGA 3’ The samples for injection were prepared at different concentrations in 1X Danieu solution [58mM NaCl; 0.7mM MgSO4; 0.6mM Ca(NO3)2; 0.5mM HEPES (pH 7.6)]. Morpholinos were injected into the cytoplasmic stream of 1-2 cell stage zebrafish embryos using a mechanical oil Nanoliter injector (World Precision Instruments, USA). The injected embryos were raised in 1X egg water (1ml contains 10% NaCl; 0.3% KCl; 0.4% CaCl2; 1.63% MgSO4.7H2O) with 0.1% penicillin-streptomycin. 2.5.2 Making of sub-slides Slides may be treated with gelatine, poly-lysine, or 3-aminopropyl triethoxysilane (TESPA) to ensure that the sections stick to the slides. Plain glass slides were first loaded onto a glass holder. This was followed by rinsing in 70% ethanol followed by a single rinse in 1N HCl and then by a short rinse in distilled water. The slides were taken out again and rinsed in 95% ethanol. The slides were then allowed to dry in an oven at 600C. After this; the slides were transferred into the fume hood. The slides were dipped for 10sec in 2% TESPA in acetone at room temperature. The TESPA solution in acetone was discarded after use since it cannot be reused. The slides were rinsed twice in separate acetone dishes for 10sec each. They were then transferred into distilled water for 10sec. 39 Slides were then transferred to dry at 420C. These slides can then be stored in slide boxes at room temperature. 2.5.3 Cryostat sectioning Fixed or stained embryos were first transferred into molten 1.5% bactoagar-5% sucrose in a detached Eppendorf cap at 50C. A common syringe needle was used to adjust the embryo in a desired orientation in a gradually hardening agar. After the agar block solidified, a small block was cut with a razor blade to mount the sample in the proper position. The block was then transferred into 30% sucrose solution and allowed to stand at 40C overnight. Subsequently, the block was placed on the frozen surface of a layer of frozen tissue freezing medium (Reichert-Jung, Germany) on a pre-chilled tissue holder, and frozen in liquid nitrogen until the block had solidified completely. The frozen block was placed into a cryostat chamber (Leica) for 30min to be equilibrated with the temperature of chamber that is at -250C. 10µm thick sections were cut and collected on a Leica CM 1900 Cryostat (Leica, Germany) and the sections were transferred onto warmed slides. The slides were rinsed briefly with PBST and cover slips were placed on the slides with several drops of 50% glycerol/PBS. The slides were sealed with nail polish and ready for observation under a light microscope. 2.5.4 Mounting and Photography Stained embryos were fixed in 4% PFA for 1h at room temperature and selected embryos were washed with PBST twice for 15min each and transferred to 50% glycerol/PBS, equilibrated at room temperature for several hours. A single chamber was made by 40 placing stacks of 1-5 small cover glasses on both side of a 25.4x76.2 mm microscope slide to facilitate whole mount examination. Small cover slips in the stacks will be perfectly solid 1h after placing a drop of Permount between them. The selected embryo was transferred to the chamber in small drop of 50% glycerol/PBS and oriented by a syringe needle. A 22X44 mm cover slip with a small drop of the same buffer was superimposed onto the embryo. The orientation of the embryo can be adjusted by gently moving the cover slip. For flat specimen, the yolk of the selected embryo was removed completely with needles. The de-yolked embryo was then placed onto a slide with a small drop of 50% glycerol/PBS and adjusted to proper orientation by a syringe needle. Excess liquid was removed with tissue paper. A small fragment of cover slip (a little bigger in size than the specimen) was put onto the embryo. This was done carefully to avoid bubbles being trapped. A drop of 50% glycerol/PBS was added to fill the space under the cover glass. The specimen was sealed with nail polish along the edge of the cover glass to prevent it from drying. Photomicrographs were taken using a camera mounted to an AX-70 microscope (Olympus, Japan) with software supplied by the manufacturers. 41 3 RESULTS 3.1 Expression analysis of zfgfap-l 3.1.1 Temporal expression analysis of zfgfap-l The temporal expression of zfgfap-l mRNA was studied by RT-PCR starting from 1.5 hpf to 30 hpf. A constant level of expression was observed from 1.5 hpf .Expression levels were found to increase steadily till 14 hpf. The expression was then found to be constant till about 24 hpf and subsequently a decrease in expression was found at 30 hpf. The results are shown in Fig 3. 42 Fig 3: RT-PCR analysis of zfgfap-l and β-actin Upper panel shows the expression of zfgfap-l while lower panel shows the consistent expression of house keeping gene, β-actin. 43 3.1.2 Expression analysis of zfgfap-l by whole-mount in situ hybridization The expression pattern of zfgfap-l on wild type embryos was studied by whole mount in situ hybridization. At the sphere stage, zfgfap-l was detected ubiquitously (Fig 4A). At 11 hpf, the expression was found to largely restricted to the developing neural tube. Intense expression was observed in the anterior region of the developing neural tube, particularly in the presumptive forebrain and midbrain. Weak staining was observed in the presumptive hindbrain and posterior neural tube (Figure 4B). As can be seen by the transverse section, expression was found to be in almost all cells at the level of the forebrain and midbrain regions (Fig 4C and 4D). At 18 hpf, zfgfap-l was expressed in the neural tube and the expression in the posterior neural tube was found to be considerably stronger than at 11 hpf (Fig 4E). Transverse sections through the forebrain and posterior neural tube revealed that zfgfap-l expressing cells were found to be confined to the lateral margins and the dorso-ventral axis along the midline of the neural tube at the level of eye and the spinal cord respectively (Fig 4F and 4G). 44 fb mb sc Fig 4: In-situ hybridization of zfgfap-l on 6, 11 and 18 hpf embryos. 4A-Whole-mount in-situ hybridization at 6 hpf, showing the ubiquitous expression of zfgfap-l. 4B-Flat mounted 11 hpf embryos showing intense expression in forebrain and midbrain. Weak staining is seen in the posterior neural tube (as indicated by the arrows) 4C, D-Transverse sections of embryos at 11 hpf shows zfgfap-l positive cells in almost every cell in the developing neural tube in the forebrain and midbrain region respectively 4E- Whole-mount embryos at 18 hpf showing expression of zfgfap-l throughout the neural tube. 4F, G-Transverse sections at the level of the eye and spinal cord (18 hpf) showing that zfgfap-l expression is confined to the lateral margin and the dorso-ventral axis of the neural tube respectively. e-eye; nnotochord. Scale bar in Fig 4A-E -250µm; Scale bar in Fig 4G,F-125µm 45 The expression pattern of zfgfap-l in the forebrain, midbrain and hindbrain continued to be similar till 24 hpf (Fig 5A-E). Transverse sections at the level of the notochord revealed that, although zfgfap-l positive cells were found in the posterior neural tube, they were absent in the floor plate and roof plate (Fig 5F, G). Whole-mount in situ hybridization showed that zfgfap-l was strongly expressed in the anterior and posterior neural tube at 30 hpf (Fig 6A, B). Transverse sections at 30 hpf revealed the presence of zfgfap-l positive cells in the diencephalon (Fig 6C). Similar to the expression in 24hpf, transverse section of the 30 hpf embryos revealed the expression of zfgfap-l in the posterior neural tube, with the exception of the floor and roof plate (Fig 6D-E). At 48 hpf, intense expression of zfgfap-l was seen in the posterior neural tube (as revealed by wholemount in situ hybridization) (Fig 7A). Transverse sections of the forebrain revealed that zfgfap-l was found to be restricted to the subventricular zone, especially in the dorsal and ventral diencephalic regions (Fig 7B, C). In the hind brain the expression was confined to the presumptive cerebellar regions around the 4th ventricle (Fig 7D). In the spinal cord, the expression of zfgfap-l was found to be preserved in the dorso-ventral axis along the midline. In addition to the expression found in the lateral margins, zfgfap-l was also found to be expressed in the roof and floor plates. The expression in the roof and floor plates, at 48 hpf, was strikingly different compared to that of the expression patterns in a 24hpf embryo, in which expression appeared to be absent in the floor and roof plates (Fig 7E). 46 fb mb Fig 5: In-situ hybridization of zfgfap-l on 24 hpf embryos 5A-Dorsal view of the flat-mount embryo at 24 hpf showing intense expression in the forebrain, midbrain and hindbrain regions 5B-E-Transverse sections showing the expression of zfgfap-l at the level of the forebrain, eye, midbrain, midbrain-hindbrain boundary respectively 5F, G-Transverse sections at the level of notochord, showing the presence of zfgfap-l positive cells in the posterior neural tube. dc-diencephalon; e-eye; fb-forebrain; mb-midbrain; hb-hindbrain; mhb-midbrainhindbrain boundary; n- notochord; sc-spinal cord; v- ventricle;. Scale bar in Fig 5A-200 µm; Scale bars in Fig 5B-G-100 µm 47 Fig 6: In-situ hybridization of zfgfap-l on 30 hpf embryos 6A - Whole-mount in-situ hybridization of 30 hpf showing strong expression of zfgfap-l throughout the neural tube. 6B - Whole-mount in-situ hybridization showing intense expression in the spinal cord 6C- Transverse section at the level of eye, showing the presence of zfgfap-l positive cells in diencephalon. 6D,E-Transverse section showing zfgfap-l positive cells in the posterior neural tube. Arrows in D and E show the absence of zfgfap-l positive cells in the floor plate and roof plate. dc-diencephalon; e-eye; nnotochord; v-ventricle. Scale bar in Fig 6A- 100 µm; Fig 6B- 50 µm; Fig 6C-E – 25 µm. 48 Fig 7: In situ hybridization of zfgfap-l on 48 hpf embryos 7A-Whole-mount in situ hybridization of 48 hpf showed strong expression of zfgfap-l in posterior neural tube. (Magnification is 10X). 7B, C-Transverse section of 48 hpf showing the expression of zfgfap-l in the sub-ventricular zones of the forebrain(as shown by the arrows). 7D-Transverse section of 48 hpf showing the expression of zfgfap-l in the sub-ventricular zones of the presumptive cerebellar region. 7E-Transverse section of 48 hpf showing zfgfap-l positive cells in the dorso-ventral axis of the posterior neural tube. e-eye; n-notochord; v-ventricle. Scale bars in Fig 7B-E – 400 µm. 49 3.2 Expression analysis of zfgfap-l in mindbomb mutants (mib-/-). The expression pattern of zfgfap-l was studied on mib-/- mutants at 48 hpf. Mindbomb mutants have a defective Delta-Notch signaling, which maintains cells in an undifferentiated state. The 48 hpf mib-/- embryos mainly contain differentiated neurons in the neural tube and hence the expression of zfgfap-l was largely absent. However, the expression was evident in the floor plate (Fig 8A, B). 50 -/- Fig 8: In situ hybridization of zfgfap-l on 48 hpf mib embryos 8A- Transverse section at the level of the eye, showing the expression of zfgfap-l is largely absent, compared to the wild type embryos. 8B- Transverse section at the level of the posterior neural tube, showing zfgfap-l positive cells only in the floor plate (as indicated by the arrow). e-eye; n-notochord. Scale bar in Fig 8A,B- 400 µm 51 3.3 Functional analysis of zfgfap-l. 3.3.1 Injection of zfgfap-l morpholino shows no apparent phenotype. To analyze the role of zfgfap-l in Zebrafish, morpholino oligonucleotides were designed and injected at the one-cell stage. Two morpholinos (both targeting the 5’UTR region of zfgfap-l) were injected at the onecell stage. Doses up to 1 picomole (pmole) showed no apparent phenotype. With doses greater than 1pmole, most embryos did not survive. Both the morpholinos did not give any apparent phenotype. Embryos were allowed to grow till 48 hpf and showed no apparent phenotype. 3.3.2 Expression of GFAP protein in wild type and zfgfap-l morpholino injected embryos. To confirm, if the morpholino does knock down zfgfap-l, immuno-staining with GFAP antibody was performed on both the wild type and zfgfap-l morpholino injected embryos. Whole mount immuno-staining with mouse GFAP antibody showed the presence of GFAP positive “loops” in the hindbrain (Fig 9B) while they were absent in the morphants (Fig 9A). 52 Fig 9: Whole-mount GFAP immuno -staining on 48 hpf zfgfap-l morpholino injected and wild type embryos. 9A- Whole mount GFAP staining on injected embryos. Arrows show the absence of staining in the hindbrain 9B- Whole mount GFAP staining on wild type embryos. Arrows indicate the presence of GFAP positive loops in the hindbrain 53 3.3.3 Expression of neurogenin1 (ngn1) in zfgfap-l morpholino injected embryos. The expression of ngn1 in zfgfap-l morpholino injected embryos was compared to that of control embryos. This was to check if knocking down zfgfap-l does cause a change in proneural genes. ngn1 was expressed in the diencephalon, midbrain and hindbrain regions. The expression of ngn1 was found to be the same in both injected and the control for 30 hpf embryos (Fig 10A, B). 3.3.4 Expression of neuroD in zfgfap-l morphants The expression of neuroD in zfgfap-l morphants was compared to that of control embryos. neuroD was expressed in the telencepahlon, diencephalon, acoustic ganglia, vagal and rhombomeric boundaries. The expression of neuroD was found to be similar in both the control and injected embryos at 30 hpf (Fig 11A, B). 54 Fig 10: In situ hybridization of ngn1 on 30 hpf zfgfap-l morpholino injected and WT embryos 10A-Dorsal view of injected embryo showing ngn1 staining at forebrain, midbrain and hindbrain regions 10B-Dorsal view of wild type embryos showing ngn1 staining at forebrain, midbrain and hindbrain regions. fb-forebrain; hb-hindbrain and mb-midbrain. 55 Fig 11: In situ hybridization of neuroD on 30 hpf zfgfap-l morpholino injected and WT embryos 11A-Dorsal view of zfgfap-l injected embryo showing neuroD staining at forebrain, trigeminal ganglia eye and otic vesicle 11B-Dorsal view of wild type embryos showing neuroD staining at forebrain, trigeminal ganglia, eye and otic vesiclefb-forebrain; ov-otic vesicle; tr-trigeminal ganglia. 56 4 DISCUSSION In this project, the author aimed at studying a 2.6 kb cDNA ,which showed 72% homology with mammalian GFAP at the amino acid level (named as zebrafish gfap like gene; zfgfap-l). The spatio-temporal expression of this gene was studied and an attempt was made to analyze the possible functions of the zfgfap-l gene. 4.1 Expression analysis of zfgfap-l in wild type embryos The temporal expression of zfgfap-l (Figure 4.1) shows that it is expressed from 1.5 hpf, suggesting that this gene is maternal. A previous immuno-histochemical study has demonstrated that GFAP positive cells (Marcus and Easter., 1995) appear in the neural tube starting from 15hpf. In contrast to this, zfgfap-l mRNA is maternal, indicating that zfgfap-l might have a completely different role (as compared to the known function of GFAP in higher vertebrates) in zebrafish embryogenesis. The spatial expression of zfgfap-l also favors the same hypothesis. zfgfap-l is initially expressed ubiquitously at 6 hpf (Figure 4.2), but after gastrulation, zfgfap-l transcripts are restricted to the developing neural tube. Further, zfgfap-l is restricted to the subventricular zone (SVZ) of the forebrain, mid-brain and hindbrain and to the dorso-ventral axis around the central canal in the spinal cord. SVZ is the germinal region, which persists into adulthood (Altman, 1969; Sturrock & Smart, 1980). SVZ contains multipotent neural stem cells that give rise to both neurons and glia (Lois & Alvarez-Buylla., 1993; Kirschenbaum & Goldman., 1995). The three major cell types in SVZ are astrocytes, neuroblasts and a novel putative precursor cell 57 (Doetsch et al., 1997). SVZ astrocytes are GFAP positive and act as neural stem cells in both normal and regenerating brain (Doetsch et al., 1999). It is possible that all astrocytes are neurogenic by nature, but the action of a few inhibitory signals, may suppress these cells from producing neurons. Neurogenic factors may be present only in regions close to the brain ventricles or SVZ (Doetsch et al., 1999). The expression pattern of zfgfap-l raises the possibility that zfgfap-l could be an important factor that may be involved in cell fate choice between glia and neurons. These data show that zfgfap-l are expressed in precursors of neuronal and non-neuronal populations and later become restricted to the SVZ. Having said that zfgfap-l could be expressed in precursors, it raises another interesting question if zfgfap-l expressing cells could be radial glia. Radial glia arise during development and are known to express vimentin, nestin, GLAST, etc. Radial glia are known to be neurogenic precursors and in mammals it has been shown that radial glia give rise to neural stem cells in the SVZ (Merkle et al., 2004). Radial glia disappears in most parts of the adult mammalian brain; however in non-mammalian species, radial glia have been shown to persist into adulthood. There are however not many well characterized radial glial antibodies in zebrafish. An example of radial glial antibody in zebrafish is the C4 antibody. C4 antibody has been shown to stain a subset of ependymal cells in adult zebrafish brain (Tomizawa et al., 2000). zrf-1 antibody is known to be specific for radial glial fibres in zebrafish (Raymond et al., 2006). Earlier experiments (Data not shown) in the lab has shown that zfgfap-l mRNA does not co-localize with zrf-1. However, this is not very convincing since the experiment looked at the expression 58 domain of protein (zrf-1) and mRNA (zfgfap-l). Co-localization of zfgfap-l and GFAP could be a possible way to better understand the role of zfgfap-l, but, this is complicated since the present author does not have an antibody for zfgfap-l. Thus, it might be useful, to raise antibody for zfgfap-l in future and perform co-localization with GFAP, zrf-1 and C4 antibodies. 4.2 Expression analysis of zfgfap-l in mib-/- embryos The zebrafish mindbomb gene, although not fully characterized, is deduced to be an important part of the Delta-Notch signaling pathway. Mutants lacking this gene show a neurogenic phenotype, similar to that seen in the Drosophila species with mutations in the delta gene, an important component of the Delta-Notch signaling pathway (Jiang et al., 1996; Schier et al., 1996). Delta-Notch signaling has been shown to be important for lateral inhibiton or lateral specification, which is a process by which fine patterns of distinct cell types are generated (Greenwald and Rubin., 1992; Raible and Eisen., 1995.). The molecular mechanism of lateral inhibition is rooted in interaction of the ligand, Delta and its receptor, Notch (Artavanis-Tsakonas et al., 1995). A large increase in the number of early differentiating neurons and reduced number of late differentiating neurons, radial glial cells and some non-neural cell types have been demonstrated in mib mutants (Jiang et al., 1996; Schier et al., 1996). The reduced lateral inhibition mediated by Notch signaling permits excessive numbers of cells to become neurons and depletes the population of progenitors needed for neurogenesis in the CNS to continue. The expression of zfgfap-l in mib-/- shows that although the expression of the zfgfap-l gene is still confined to the developing brain and spinal cord of the embryo, the expression levels 59 have been significantly reduced in the mindbomb mutant. The altered expression pattern in this mutant validates the hypothesis that the zfgfap-l gene may be involved in neurogenesis in the developing brain and spinal cord of the embryo. The reduced or the lack of expression of the zfgfap-l gene in mindbomb mutant therefore indicates that the gene may be associated with the progenitor cells, i.e. cells with undifferentiated phenotype that can eventually differentiate to form neurons. These results concur with the expression pattern of the zfgfap-l gene in the wild type embryos in which the expression was found to be restricted to the subventricular zone, which is the stem cell niche of the brain. 4.3 Expression of GFAP in zfgfap-l morpholino injected embryos and in wild type embryos The expression of GFAP was studied on zfgfap-l morpholino injected and in wild type embryos. To validate the morpholino injection, GFAP whole mount immuno-staining was carried out. GFAP expression was found to be absent in the rhombomeric loops in the morphants, However, it is very difficult to conclude much from this experiment, since some embryos in the same tube did not show staining. Western blot might have been more ideal but despite several attempts, the technique did not work. There is now substantial evidence that tetraploidization and rediploidization have taken place during the early evolution of the teleost and that hundreds of duplicate pairs generated by this event has been maintained over millions of years of evolution (Volff., 2005). Therefore, the functional significance of zfgfap-l is not clear. 60 4.4 Expression of neuroD and ngn1 in morphants and in wild type embryos Neurogenesis in vertebrates is a highly complex process .With respect to the genetic pathways underlying neurogenesis, the activity of members of a subclass of basic helix loop helix (bHLH) transcription factors is instrumental in most, and perhaps all, vertebrate neuronal lineages (Bertrand et al., 2002). These transcription factors are vertebrate homologues of invertebrate proneural proteins, which in flies are both necessary and sufficient for the commitment of ectodermal cells to a neural progenitor fate (Campos-Ortega, 1993; Modolell, 1997). In invertebrates, neural bHLH transcription factor activity is required at several discrete stages during the formation of neurons, and both loss- and gain-of-function data support the notion that bHLH proteins can function both in networks and in cascades in various neuronal lineages (Ma et al., 1996, 1998; Kanekar et al., 1997; Fode et al., 1998; Perron et al., 1999; Cau et al., 2002). Proneural bHLH factors belong to the olig, neurogenin, neuroD, achaete-scute and atonal subfamilies and are expressed in partially overlapping or complementary patterns within the vertebrate embryonic neural tube (Adolf et al., 2004). The combinatorial expression of these factors likely drives the generic and cell type specific properties of neurogenesis throughout the nervous system (Adolf et al., 2004). If the present author’s hypothesis (that zfgfap-l might be associated with progenitors and that zfgfap-l maybe involved in cell fate choice) is true, then a knock down of zfgfap-l would affect neurogenesis. One possible way to check if neurogenesis is affected or not, is to look at the changes (if any) in the expression of proneural genes. Keeping this in 61 mind, the present author analyzed the expression of two pro neural genes-ngn1 and neuroD. Expression of ngn1 in the neuroectoderm, at the end of gastrulation forecasts differentiation of primary neurons (Ma et al., 1996; Blader et al., 1997 and Korzh et al., 1998). ngn1 is expressed in a complex pattern in the neural plate of zebrafish embryos, demarcating the site of primary neurogenesis. In the posterior neural plate, three stripes of expression at lateral, intermediate and medial position highlight the areas of RohonBeard sensory neurons, interneurons and motoneurons respectively. In anterior neural plate, distinct groups of cells, including, the anterior lateral edge of the neural plate, a cluster of cells in the midbrain anlage and several regions in hindbrain representing reticulospinal neurons, express ngn1 (Blader et al., 1997; Korzh et al., 1998). The trigeminal ganglia also express ngn1 (Blader et al., 1997; Korzh et al., 1998). The spatially complex pattern on ngn1 expression, suggests that ngn1 is a target of multiple signals and an integration point of both dorsoventral and anteriorposterior positional cues in gastrula and early neural stage. This was indeed true and a number of regulatory elements that control ngn1 activity was identified (Blader et al., 2003). These regulatory sequences with temporally and spatially distinct activities control ngn1 expression in the primary neurons of zebrafish embryos. These regulatory sequences are very important since they are highly similar to the 5’ sequences in the mouse and human ngn1 gene, suggesting that amniote embryos, despite lacking primary neurons, utilize related mechanisms to control ngn1 expression (Blader et al., 2003). 62 Another proneural bHLH factor is neuroD. Over expression of neuroD in zebrafish and Xenopus leads to the formation of ectopic neurons (Lee et al., 1995; Blader and Strahle., 2000). neuroD expression is initiated at the end of gastrulation, at 10 hpf. The expression starts at least one hour later than ngn1, in the anterior region of the neural plate. In contrast to ngn1, neuroD expression is much more restricted and is found only in a subset of primary neurons. Anteriorly, neuroD transcripts are found in clusters of cells that may represent the primordium of the forebrain and the symmetric primordial of the trigeminal ganglia (Korzh et al., 1998). The expression pattern suggests that there are several factors upstream of neuroD. This was later confirmed when it was found the ash1a (achaetescute homologue 1 a) and ngn1 act in parallel redundant pathways to regulate neurogenesis downstream of floating head, but upstream of neuroD (Cau and Wislon., 2003). The expression of ngn1 and neuroD was found to be similar in both the zfgfap-l morpholino injected embryos and control embryos. If zfgfap-l was indeed associated with progenitors, then there should be an up regulation or down-regulation in the proneural genes. Though there seems to be no change in the expression of both ngn1 and neuroD, it is very difficult to come to any conclusion; since there exists the possibility that zfgfap-l might be redundant in zebrafish. Therefore, knocking down one particular copy of zfgfapl might not have any significant effect. One more factor to be borne in mind is that the zfgfap-l morpholino itself might not be working since it has not been shown conclusively that zfgfap-l is indeed knocked down (Discussed in section 4.3). 63 5. CONCLUSION RT-PCR results showed that the expression of zfgfap-l started as early as the 16 cell stage and increased steadily up to 10 hours post-fertilization (hpf), then became a constant level of expression till 30 hpf. In embryos at sphere stage, the expression was detected in the cells of the superficial layer by in situ hybridization. After gastrulation, the expression became restricted to the neural tube. This expression pattern continued to be similar at least until 24 hpf. At 48 hpf, the expression was mainly detected in the subventricular zone of the forebrain, midbrain, and hindbrain and the dorsoventral axis of the presumptive spinal cord. These data suggest that zfgfap-l might be associated with progenitors and in accord with this zfgfap-l was found to be absent in several distinct locations of mindbomb mutants which have a defective Delta-Notch signaling pathway, resulting in excessive differentiation of progenitors into the neuronal phenotype. These results suggest that maternally transferred zfgfap-l transcripts continue to be present in the precursors of neuronal and non-neuronal cell populations during early embryogenesis and subsequently become restricted to the cellular populations in the subventricular zone where the neural stem cells lie. To confirm if zfgfap-l was indeed associated with progenitors, zfgfap-l morpholino was injected and the expression of two neuronal markers- neuroD and neurogenin1 (ngn1) were analyzed. The expression was found to be similar in both wild type and morpholino injected embryos. However, more work needs to be done since there are a number of other factors that may be involved. 64 6 REFERENCES Adolf B, Bellipanni G, Huber V, Laure Bally-Cuif (2004). atoh 1.2 and beta 3.1 are two new bHLH- encoding genes expressed in selective precursors of the zebrafish anterior hindbrain. Gene Expr Patterns 5 (1):35-41 Adams MD et al., (2000). The genome sequence of Drosophila melanogaster. Science 287: 2185- 2195 Altman J (1969). Autoradiographic and histological studies of postnatal neurogenesis. IV. Cell proliferation and migration in the anterior forebrain, with special reference to persisting neurogenesis in the olfactory bulb. J Comp Neurol 137 (4): 433– 458. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ(1997 Sep 1). Gapped BLAST and PSI-BLAST- A new generation of protein database search programs. Nucleic Acids Res 25 (17): 3389-3402. Appel B and Eisen J (1998). Regulation of neuronal specification in the zebrafish spinal cord by Delta function. Development 125 (3): 371-380. Artavanis-Tsakonas S, Matsuno K, Fortini ME (1995). Notch signaling. Science 268 (5208): 225–232. Bauer H, Meier A, Hild M, Stachel S, Economides A, Hazelett D, Harland RM, Hammerschmidt M (1998). Follistatin and noggin are excluded from the zebrafish organizer. Dev Biol 204 (2): 488-507. 65 Bennaroch EE (2006). Neuron-Astrocyte interactions: Partnership for normal function and disease in the central nervous system. Mayo Clin Proc 80(10):1326-1338. Bertrand N, Castro DS, Guillemot F (2002).Proneural genes and the specification of neural cell types. Nat Rev Neurosci 3 (7): 517-530. Blader P, Fishcer N, Gradwohl G, Guillemot F, Strahle U (1997). The activity of neurogenin1 is controlled by local cues in the zebrafish embryo. Development 124 (22): 4557-4569 . Blader P, Rastegar S, Fischer N, Strahle U (1997). Cleavage of the BMP-4 antagonist chordin by zebrafish tolloid. Science 278 (5345): 1937-1940. Blader P, Strahle U (2000). Zebrafish developmental genetics and central nervous system development. Hum Mol Genet 9 (6): 945-51. Blader P, Plessy C, Strahle U (2003). Multiple regulatory elements with spatially and temporally distinct activities control neurogenin1 expression in primary neurons of the zebrafish embryo. Mech Dev 120 (2): 211-218. Brenner M, Johnson AB, Boespflug-Tanguy O, Rodriguez D, Goldman JE, Messing A (2001). Mutations in GFAP are associated with Alexander Disease. Nat Genet 27 (1): 117-120. Briscoe J, Ericson J (2001). Specification of neuronal fates in the ventral neural tube. Curr Opin Neurobiol 11 (1): 43-49. 66 Cameron RS, Rakic P (1991). Glial cell lineage in the cerebral cortex: review and synthesis. Glia 4(2): 124-137. Campos-Ortega JA (1993). Mechanism of early neurogenesis in Drosophila melanogaster. J Neurobiol 24 (10): 1305-1327. Cau E, Casarosa S, Guillemot F (2002). Mash1 and ngn1 control distinct steps of determination and differentiation in olfactory sensory neuron progenitors. Development 129 (8): 1871-1890. Cau E, Wilson SW (2003). Ash1a and neurogenin1 function downstream of floating head to regulate epiphysial neurogenesis. Development 130 (11): 2455-2466 Cheng KC , Moore JL (1997). Genetic dissection of vertebrate processes in the zebrafish: a comparison of uniparental and two-generation screens. Biochem Cell Biol 75 (5): 525533. Chitnis AB (1995). The role of Notch in lateral inhibition and cell fate specification. Mol Cell Neurosci 6 (4): 311-321. Doetsch F, Garcia-Verdugo JM., Alvarez-Buylla A (1997).Cellular composition and three-dimensional organization of the sub-ventricular germinal zone in the adult mammalian brain. J Neurosci 17 (13): 5046-5061. Doetsch F, Caille I, Lim DA, Garcia-Verdugo JM, Alvarez-Buylla A (1999). Subventricular zone astrocytes are neural stem cells in the adult mammalian brain. Cell 97 (6): 703-716. 67 Driever W, Solnica-Krezel L, Schier AF, Neuhauss SCF, Malicki J, Stemple DL, Stainier DYR, Zwartkruis F,Abdelilah, S, Rangini Z, Belak J., Boggs C (1996). A genetic screen for mutations affecting embryogenesis in zebrafish. Development 123: 37 - 46. Driever W, Stemple D, Schier A, Solnica-Krezel L (1994). Zebrafish: genetic tools for studying vertebrate development. Trends Genet 10 (5): 152-159. Eng LF, Gerstl B, Vanderhaeghen JJ (1970). A study of proteins in old multiple sclerosis plaques. Trans Am Soc Neurochem 1: 42. Eng LF, Ghirnikar RS, Lee YL (2000). Glial fibrillary acidic protein: GFAP thirty-one years (1969–2000). Neurochem Res 25: 1439–1451. Ericson J, Morton S, Kawakami A, Roelink H, Jessell TM (1996). Two critical periods of shh signaling required for the specification of motoneuron identity. Cell 87 (4): 661-673. Fainsod A, Deissler K, Yelin R, Marom K, Epstein M, Pillemer G, Steinbeisser H, Blum M (1997). The dorsalizing and neural induing gene follistatin is an antagonist. Mech Dev 63 (1): 39-50. Fode C, Gradwohl G, Morin X, Dierich A, LeMur M, Goridis C, Guillemot F (1998). The bHLH protein Neruogenin2 is a determination factor for epibranchial placode derived sensory neurons. Neuron 20 (3): 483-494. 68 Furthauer M, Thisse B, Thisse C (1999). Three different noggin genes antagonize the activity of bone morphogenetic proteins in the zebrafish embryo. Dev Biol 214 (1): 181196. Graff JM, Thies RS, Song JJ, Celeste AJ, Melton DA (1994). Studies with a Xenopus BMP receptor suggest ventral neuroderm inducing signals override dorsal signals in vivo. Cell 79 (1): 169-179. Greenwald I, Rubin GM (1992). Making a difference: the role of cell-cell interactions in establishing separate identities for equivalent cells. Cell 68 (2): 271-281. Haddon C, Smithers L, Schneider-Maunoury S, Coche T, Henrique D, Lewis J (1998). Multiple delta genes and lateral inhibition in zebrafish primary neurogenesis. Development 125 (3): 359-370. Haffter P, Granato M, Brand M, Mullins MC, Hammerschmidt M, Kane DA, Odenthal J, van Eeden FJ, Jiang YJ, Heisenberg CP, Kelsh RN, Furutani-Seiki M, Vogelsang E, Beuchle D, Schach U, Fabin C, Nusslein-Volhard C (1996). The identification of genes with unique and essential functions in the development of the Zebrafish, Danio rerio. Development 123: 1-36. Hammerschmidt M, Serbedzija GN, McMahon AP (1996). Genetic analysis of dorsoventral pattern formation in the zebrafish: requirement of a BMP-like ventralizing activity and its dorsal repressor. Genes Dev 10 (19): 2452-2461. 69 Hertz L, Zielke HR (2004). Astrocytic control of glutamatergic activity: astrocytes as stars of the show. Trends Neurosci 27 (12): 735-743. Holder N, Xu Q (1999). Microinjection of DNA, RNA, and protein into the fertilized Zebrafish egg for analysis of gene function. Methods Mol Biol 97: 487-490. Jiang, YJ., Brand M., Heisenberg CP, Beuchle D, Furutani-seiki M, Kelsh R N, Warga RM, Granato M, Haffter P, Hammerschmidt M. et al.,(1996). Mutations affecting neurogenesis and brain morphology in the zebrafish, Danio rerio. Development 123: 205-216. Kanekar S, Perron M, Dorsky R, Harris WA, Jan LY, Jan YN, Vetter ML (1997). Xath5 participates in a network of bHLH genes in the developing Xenopus retina. Neuron 19 (5): 981-994. Kimmel CB, Ballard WW, Kimmel SR, Ullman B, Schilling TF (1995). Stages of embryonic development of the zebrafish. Dev Dyn 203 (3): 253-310. Kimmel CB, Warga RM (1994). Cell cycles and clonal strings during the formation of the zebrafish CNS. Development 120 (2): 265-276. Kirschenbaum B, Goldman SA (1995). Brain-derived neurotrophic factor promotes the survival of neurons arising from the adult rat forebrain subependymal zone. Proc Natl Acad Sci USA 92 (1): 210 –214. 70 Korzh V, Sleptsova I, Liao J, He JY, Gong Z (1998). Expression of zebrafish bHLH genes ngn1 and neuroD defines distinct stages of neural differentiation. Dev Dyn 213 (1): 92-104. Koshida S, Shinya M, Mizuno T, Kuroiwa A, Takeda H (1998). Initial anteroposterior pattern of the zebrafish CNS. Development 125 (10): 1957-1966. Kozlowski DJ, Weinberg ES (2000). Photoactivatable(caged) fluorescein as a cell tracer for fate mapping in the Zebrafish embryo. Methods Mol Biol 135: 349-55. Lazarini F, Deslys JP, Dormant D (1991). Regulation of glial fibrillary acidic proteins, beta actin and prion protein mRNAs during brain development in mouse. Mol Brain Res 10 (4): 343-346. Landry CF, Ivy GO, Brown IR (1990). Developmental expression of glial fibrillary acidic protein mRNA in the rat brain analyzed by in situ hybridization. J Neurosci Res 25 (2): 194-203. Lee JE, Hollenberg SM, Snider L,Turner DL, Lipnick N, Weintraub H (1995). Conversion of Xenopus ectoderm into neurons by neuroD, a basic helix-loop-helix protein. Science 268 (5212): 836-844. Li R, Johnson AB, Salomons G, Goldman JE, Naidu S, Quinlan R, Cree B, Ruyle SZ, Banwell B, D'Hooghe M, Siebert JR, Rolf CM, Cox H, Reddy A, Gutierrez-Solana LG, Collins A, Weller RO, Messing A, Van der Knaap MS, Brenner M (2005). Glial fibrillary 71 acidic protein mutations in infantile, juvenile and adult forms of Alexander disease. Ann Neurol 57 (3): 310-26. Lois C, Alvarez-Buylla A (1994). Long-distance neuronal migration in the adult mammalian brain. Science 264 (5162): 1145-48. Ma Q, Kintner C, Anderson DJ (1996). Identification of neurogenin, a vertebrate neuronal determination gene. Cell 87 (1): 43-52. Ma Q, Chen Z, del Barco Barrantes I, de la Pompa JL, Anderson DJ (1998). neurogenin1 is essential for determination of neuronal precursors for proximal cranial sensory ganglia. Neuron 20 (3): 469-482. Marcus RC, Easter SS, Jr. (1995). Expression of glial fibrillary acidic protein and its relation to tract formation in embryonic zebrafish. J Comp Neurol 359 (3): 365-381. Malicki JJ, Pujic Z, Thisse C, Thisse B, Wei X (2000). Forward and reverse genetic approaches to the analysis of eye development in zebrafish. Vision Res 42 (4): 527-533. Marti E, Bumcrot DA, Takada R, McMahon AP (1995). Requirement of 19K form of sonic hedegehog for induction of distinct ventral cell types in CNS explants. Nature 375 (6529): 322-325. Merker S, Lee KJ, McMahon AP, Hammerschmidt M (1997). The zebrafish organizer requires chordino. Nature 387 (6636): 862-863. 72 Merkle FT, Tramontin AD, Garcia-Verdugo GM, Alvarez-Buylla A (2004). Radial glia give rise to adult neural stem cells in the subventricular zone. Proc Natl Acad Sci USA 101 (50): 17528-17532. Mizuno T, Shinya M, Takeda H (1999). Cell and tissue transplantation in zebrafish embryos. Methods Mol Biol 127: 15-28. Modolell J (1997). Patterning of the adult peripheral nervous system of Drosophila. Perspect Dev Neurobiol 4 (4): 285-296. Mullins MC, Nusslein-Volhard C (1993). Mutational approaches to studying embryonic pattern formation in zebrafish. Curr Opin Genet Dev 3 (4): 648-654. Neave B, Holder N, Patient R (1997). A graded response to BMP-4 spatially coordinates patterning of the mesoderm and ectoderm in zebrafish. Mech Dev 62 (2): 183-195. Onteniente B, Kimura H, Maeda T (1983). Comparative study of the glial fibrillary acidic protein in vertebrates by PAP immunohistochemistry. J Comp Neurol 215 (4): 427-36. Papan C, Campos-Ortega JA (1994). On the formation of the neural keel and neural tube in the zebrafish. Wilhelm Roux’s Arch Dev Biol 203: 178-186. Perron M, Opdecamp K, Butler K, Harris WA, Bellefroid EJ (1999). X-ngnr-1 and Xath3 promote ectopic expression of sensory neuron markers in the neurula ectoderm and have distinct inducing properties in the retina. Proc Natl Acad Sci USA 96 (26): 14996150001. 73 Raible DW, Eisen JS (1995). Lateral specification of cell fate during vertebrate development. Curr Opin Genet Dev 5 (4): 444-449. Raymond PA, Barthel LK, Bernardos RL, Perkowski JJ (2006). Molecular characterization of retinal stem cells and their niches in adult zebrafish. BMC Dev Biol 6: 36. Reifers F, Walsh EC, Leger S, Stainier DY, Brand M (2000). Induction and differentiation of the zebrafish heart requires fibroblast growth factor 8(fgf8/cerebellar). Development 127(2): 225-35. Roelink H, Porter JA, Chiang C, Tanabe Y, Chang DT, Beachy PA, Jessell TM (1995). Floor plate and motoneuron induction by different concentrations of the amino-terminal cleavage product of shh autoproteolysis. Cell 81 (3): 445-455. Sarthy PV, Fu M, Huang J (1991). Developmental expression of the glial fibrillary acidic protein gene in mouse retina. Cell Mol Neurobiol 11 (6): 623-637. Schier AF, Neuhauss SC, Harvey M, Malicki J, Solnica-KrezelL, Stainier DY, Zwartkruis F, Abdelilah S, Stemple DL, Rangini Z. et al., (1996). Mutations affecting the development of the embryonic zebrafish brain. Development 123: 165-178. Schmitz B, Papan C, Campos-Ortega JA (1993). Neurulation in the anterior trunk region of the zebrafish. Dev Genes and Evol 202 (5): 250-259. Song H, Stevens CF, Gage FH (2002). Astroglia induce neurogenesis from adult neural stem cells. Nature 417 (6884): 29-32. 74 Stainier DY, Lee RK, Fishman MC (1993). Cardiovascular development in the Zebrafish. Myocardial fate map and heart tube formation. Development 119 (1): 31-20. Steinert PM, Roop DR (1988). Molecular and cellular biology of intermediate filaments. Annu Rev Biochem 57: 593-625. Strahle U, Blader P (1994). Early neurogenesis in the zebrafish embryo. The FASEB Journal 8 (10): 692-98. Streisinger G, Walker C, Dower N, Knauber D, Singer F (1981). Production of clones of homozygous diploid fish (Brachydanio rerio). Nature 291 (5813): 293-296. Sturrock RR, Smart IHM (1980). A morphological study of the mouse subependymal layer from embryonic life to old age. J Anat 130 (Pt 2): 391-415. Szaro BG, Gainer H (1988). Immunocytochemical identification of nonneuronal intermediate filament proteins in the developing Xenopus laevis nervous system. Dev Brain Res 471 (2): 207-224. Svendesen CN (2002). The amazing astrocyte. Nature 417 (6884): 39-44. Tardy M, Fages C, Riol H, LePrince G, Rataboul P, Charriere-Bertrand C, Nunez J (1989). Developmental expression of the glial fibrillary acidic protein mRNA in the central nervous system and in cultured astrocytes. J Neurochem 52 (1): 162-7. Tomizawa K, Inoue Y, Nakayasu H (2000). A monoclonal antibody stains radial glia in the adult Zebrafish CNS. J Neurocytol 29 (2): 119-128. 75 Trevarrow B, Marks DL, Kimmel CB (1990). Organization of hindbrain segments in the zebrafish embryo. Neuron 4 (5): 669-679. Volff J-N (2005). Genome evolution and biodiversity in teleost fish. Heredity 94 (3): 280-294. Voronina AS, Preobrazhensky AA(1994). Developmental expression of glial fibrillary acidic protein gene in human embryos. Neurosci Lett 174 (2): 198-200. Westerfield M (1995). The Zebrafish Book. Eugene, OR: University of Oregon Press. Wilson PA, Hemmati-Brivanlou A (1997). Vertebrate neural induction-inducers, inhibitors and a new synthesis. Neuron 18 (5): 699-710. 76 7 APPENDIX 7.1 Compositions of Buffers BUFFER QBT 750mM NaCl 50mM MOPS (pH 7.0) 15% isopropanol 0.15% Triton X-100 (v/v) BUFFER QC 1M NaCl 50mM MOPS (pH 7.0) 15% isopropanol (v/v) BUFFER QF 1.25M NaCl 50mM TrisCl (pH 8.5) 15% isopropanol (v/v) BUFFER QBT 750mM NaCl 50mM MOPS (pH 7.0) 15% isopropanol (v/v) 0.15% Triton X-100 (v/v) BUFFER P1 10mM Tris-Cl (pH 8.0) 1mM EDTA 100µg/ml RNase A BUFFER P2 200mM NaOH 1% SDS (w/v) BUFFER P3 3M potassium acetate (pH 5.5) 77 BUFFER EB 10mM Tris-Cl (pH 8.5) The composition of some of the buffers in commercial kits was unavailable [...]... peripherin #P15331; goldfish plasticin #P313393; zebrafish plasticin # AAC34932; zebrafish desmin # AAB03217; human desmin #P17661; zebrafish vimentin # AAC98491; human vimentin #P08670; mouse vimentin #P20152; zebrafish gefiltin # AAC34933; Xenopus xefiltin # AAB41403; human α-internexin #AAB34482; mouse α-internexin #P46660 C Linkage map analysis reveals that zfgfap-l is in the region of zebrafish. .. is linked to zebrafish LG3 (Fig 1C) 15 Fig 1: Sequence analysis and mapping of zfgfap-l 1A Amino acid sequence alignment of the head domain of zfgfap-l with the human and mouse GFAP head domains Conservative residues are indicated in bold letters Predicted phosphorylation sites are underlined GFAP PR-box motif in human and mouse indicated by arrows The leucine zipper pattern in the zebrafish GFAP. .. presentation on Expression analysis of GFAP- like gene on zebrafish embryogenesis in the 6th National Symposium on Health Sciences, KL, 2006 12 1 INTRODUCTION 1.1 Glial Fibrillary Acidic Protein (GFAP) Glial Fibrillary Acidic Protein (GFAP) is a type III protein of the intermediate filament family GFAP was first characterized as the major intermediate filament protein of mature astrocytes in the Central... motif of the zfgfap-l differs from that of mouse and human GFAP (Fig 1A) However, the phylogenetic analysis indicates that zfgfap-l has a close relationship with the human and mouse GFAP (Fig 1B) Due to differences observed in the sequence and expression pattern from the mammalian GFAP, this gene has been named as the zebrafish GFAP like gene (zfgfap-l) Further, mapping analysis reveals that this gene. .. Objectives of the present study The main objectives of this project were to analyze the expression pattern and also the function of zfgfap-l With this in mind, the spatio-temporal expression of zfgfap-l was studied in wild-type and mutant embryos An attempt to analyze the role of zfgfap-l was made by injection of zfgfap-l morpholinos 27 2 MATERIALS AND METHODS 2.1 ZEBRAFISH 2.1.1 Fish Maintenance Zebrafish. .. inflates; food-seeking and active avoidance behaviors Table 1: Summary of the principal events during Zebrafish embryogenesis* * http://zfin.org/zf_info/zfbook/stages/org.html 23 1.3.2 Development of the zebrafish CNS Neurogenesis may be subdivided into several distinct processes • Establishment of neural competence of the ectoderm (neural induction) • Subdivision of the CNS into regions with distinct properties... rat and human GFAP Hence, the gene that was isolated was named as zebrafish GFAP like gene (zfgfap-l) GFAP is composed of a highly conserved central α helical rod domain flanked by non-helical head and tail domains The rod domains and the non-α helical tail domains are well conserved among the species analyzed In addition, alignment of head domains of mouse and human GFAP with that of zfgfap-l reveals... is shown in italic B Phylogenetic analysis reveals that the zfgfap-l has a closer relationship with 16 human and mouse GFAP Numbers in nodes indicate the confidence of phylogenetic analysis (probability in 100 bootstrap analysis) Mean bootstrap value of consensus tree (sd): 64% (± 29%) Accession numbers are: zebrafish GFAP #AY 397679; human GFAP # P14136; mouse GFAP # P03995; human peripherin #P41219;... as interactions with other specialized cells in the brain are disturbed This may result in the inability to maintain the blood-brain barrier (Li et al., 2005) 14 In zebrafish, goldfish GFAP immuno-reactivity has been shown to first appear in the brain at 15 hpf (Marcus and Easter, 1995) However, it has been established that GFAP may exist in more than one form in lower vertebrates as reported in Xenopus... cDNA containing vector) in a fume hood The plates were then incubated overnight at 37°C 2.2.4 Isolation and purification of plasmid DNA 2.2.4.1 Miniprep of plasmid DNA Small scale preparation of plasmid DNA was carried out using the QIAprep Miniprep kit (Qiagen) To confirm the uptake of the vector, single colonies were picked up, inoculated in 5ml LB amp+ (LB medium containing 100µg/ml Ampicllin) medium ... RESULTS Expression analysis of zfgfap-l Temporal expression analysis of zfgfap-l Expression analysis of zfgfap-l by whole-mount in situ hybridization Expression analysis of zfgfap-l in mindbomb... analysis of zfgfap-l in wild type embryos Expression analysis of zfgfap-l in mib-/- embryos Expression of GFAP in wild type and zfgfap-l morpholino injected embryos Expression of neuroD and neurogenin1... Functional analysis of zfgfap-l Injection of zfgfap-l morpholino shows no apparent phenotype Expression of GFAP protein in wild type and zfgfap-l morpholino injected embryos 3.3.3 Expression of neurogenin1