Expression analysis of GFAP like gene in zebrafish embryogenesis

... RESULTS Expression analysis of zfgfap-l Temporal expression analysis of zfgfap-l Expression analysis of zfgfap-l by whole-mount in situ hybridization Expression analysis of zfgfap-l in mindbomb ... analysis of zfgfap-l in wild type embryos Expression analysis of zfgfap-l in mib-/- embryos Expression of GFAP in wild type and zfgfap-l morpholino...

Ngày tải lên: 05/10/2015, 22:31

... the expression of genes that respond to hypoxia in cranial neural tubes of mouse embryos ……………………………………… 96 3.2.1 Expression of hypoxia-inducible factor 1α (Hif-1α) in cranial neural tubes of embryos ... altered in cranial neural tubes of embryos from diabetic mice …….………… 110 Expression of genes that are involved in glucose metabolism and t...

Ngày tải lên: 11/09/2015, 16:07

... and Talbot, 1997) The two main approaches of cloning mutated genes, positional cloning and candidate gene approach, have benefited greatly from the recent advances in zebrafish genomic infrastructure ... represents just the data acquisition phase Faced with an avalanche of sequence data, researchers are now faced with the daunting task of deciphering and interpreting the...

Ngày tải lên: 03/10/2015, 20:57

... on Murrah buffaloes maintained at Central cattle breeding farm, Alamadi, Tamilnadu Individual blood samples of ml each were collected from 110 Murrah buffaloes using ml vacuitainer tubes containing ... IV to intron IV (enclosing 94 base pairs of exon IV and 168 base pair of intron IV ) and resulted in 262 bp fragment in cattle The same primers were used for amplifying b-lg...

Ngày tải lên: 18/02/2014, 02:20

... Rev5'TACCTCCTGGCTTCAACCAT; P5 CSFor5'GATGTTTTTGCTGCCATTGA, Rev5' GC TAATC CC AACCTCAGCAC; DnaJ-For5'GGAATACAGGAGGGG GA CAT, Rev5'CCTTTTGGGAGAACCAAACA; BADH-For5' TGGAAAATTGCTCCAGCTCT, Rev5'CTGGACCTAATCCC GTCAAA; ... glycinebetaine synthesis even in the plants not accumulating glycinebetaine naturally, like Arabidopsis thaliana, Brassica napus and Nicotiana tobacum [98] Moreover, modelling...

Ngày tải lên: 12/08/2014, 03:20

... Amino acid sequence alignment of Zebrafish, Human, Mouse and Chick ColIXα2 88 Phylogenetic tree of FACIT family comprising of chains of collagen IX, collagen XII, collagen XIV and collagen XIX ... chains of zebrafish type IX collagen and type II collagen alpha in the tail bud during segmentation and post-segmentation period 106 Translation inhibition of col...

Ngày tải lên: 15/09/2015, 22:06

... organization of the ORF region of the RNase j family genes is shown in Fig 7A In all organisms examined, the region coding for RNase j is interrupted by two introns, with the exception of the sea urchin ... describe the expression profile of the RNase j gene at various developmental stages and in several tissues of the insect C capitata W...

Ngày tải lên: 23/03/2014, 06:20

... al.: Microarray analysis of Foxl2 mediated gene regulation in the mouse ovary derived KK1 granulosa cell line: Over-expression of Foxl2 leads to activation of the gonadotropin releasing hormone receptor ... resulted in finding a total of 42 genes common to both (Additional file 10) In order to begin to understand the signif...

Ngày tải lên: 20/06/2014, 07:20

... clarify the role of BCL11B in T-cell malignancies, we further analyzed the expression levels of TNFSF10, BCL2L1, SPP1, and CREBBP genes and their correlations with BCL11B in patients with T-ALL and ... of the SPP1 gene in T-cell malignancies is unclear, because low expression of SPP1 was detected in T-ALL Conclusions The expression pattern...

Ngày tải lên: 10/08/2014, 22:21

... identification of specific pathways whose gene expression is coordinately regulated in association with obesity, defined genomic regulatory loci controlling the expression of these genes, and novel genes ... for genes involved in insulin signaling Two hundred and fortyfour gene sets were obtained by querying all the pathways available at Biocarta [16] The latter set comprises...

Ngày tải lên: 14/08/2014, 14:21

... Global analysis of microRNA target gene expression reveals the potential roles of microRNAs in maintaining tissue identity Zhenbao Yu* , Zhaofeng Jian, Shi-Hsiang Shen, Enrico Purisima, and Edwin ... its targets for their expression Theoretically, the tissues with low level of the expression of the targets of a miRNA are probably the tissues in...

Ngày tải lên: 14/08/2014, 16:20

... mouse, Fugu, and zebrafish 63 -64 3.5 Assembled sequences of irf6 genomic fragments 64 -66 3 .6 The irf6 gene locus on the LG22 in T51 RH panel and in the Ensembl zebrafish version (ZV6) 68 -69 3.7 Whole-mount ... morpholinos 85 3.14 Loss of irf6 function phenotypes 86- 87 3.15 Comparison of expression of molecular markers in irf6 morphants and wildtype 91-92 3...

Ngày tải lên: 14/09/2015, 12:44

... mutants, trunk notochords are present.  This shows that spt mutation can suppress the 35   Molecular characterization and developmental analysis of the TGF Beta 3 gene in zebrafish flh  mutation,  suggesting  that  in the midline,  flh  is  involved  in promoting  ... Molecular characterization and developmental analysis of the TGF Beta 3 gene in zebrafish phosphorylating  TβR­...

Ngày tải lên: 14/09/2015, 18:03

... expressed in Pichia strain X-33 with the addition of a signal sequence for secretion of the recombinant protein into the medium Approximately 12 mg of the recombinant lectin was purified from the medium ... similarly docked into the saccharide-binding site of Calsepa (RCSB Protein Data Bank code 1OUW) [28] Cartoons showing the docking of Man ⁄ MeMan in the m...

Ngày tải lên: 14/03/2014, 23:20

... translating two proteins of 199 amino acids and 182 amino Fig Alternative splicing of the IL-18 gene in rainbow trout (A) An alternative mRNA splicing site is present in exon of the trout IL-18 ... exons and five introns The Fig Comparison of the genomic organization of IL-18 and IL-1b genes in human, rainbow trout and the predicted Fugu/tetraodon orga...

Ngày tải lên: 16/03/2014, 16:20