Exploration of role of ncrlp, yeast homologue of NPC 1, in membrane trafficking

THE ROLE OF Ncr1p, a YEAST HOMOLOGUE OF Niemann Pick protein C 1 (NPC1), IN ENDOCYTIC MEMBRANE TRAFFICKING REN JIHUI (BSC) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE DEPARTMENT OF BIOCHEMISTRY NATIONAL UNIVERSITY OF SINGAPORE 2002 ACKNOWLEDGEMENTS I’d first want to thank Dr. Robert Yang Hongyuan in Department of Biochemistry NUS, who recruited me from China as a postgraduate student. As my supervisor he gave me a lot of guidance in my project and also provided me many valuable chances to learn new techniques and knowledge. I want to take this chance to give my sincere thanks to Dr. Alan L Munn at IMCB, who taught me a lot of techniques and knowledge in the field and Dr. Robert Piper at University of Iowa, who kindly gave his help for me to finish the thesis. I would also like to give thanks to Mr. Woo Wee Hong and Mr. Sebastian Yeo for their kind help on technical assistance. I regard my two-year study in Singapore a valuable chance. It is a process of learning as well as growing up. These experiences would prepare me well for my future scientific career. I am also very happy that I met so many good friends who help me out in the difficult times. At last I want to thank my parents who support me all the time. 1 SUMMARY NPC1 is the gene, when mutated, responsible for majority the Niemann-Pick type C disease (Niemann-Pick type C) cases. The principle features of the cellular lesion in NPC cells are defects in intracellular trafficking of cholesterol and delayed sterol homeostatic responses. NCR1 (Niemann-Pick C related 1) is the yeast homologue of NPC1. Here we tested the function of various vesicular traffic pathways including endocytosis, vacuole protein biosynthesis and MVB sorting, in ncr1∆ as well as in two class E vps mutants, vta1∆ and vps20∆. Receptor-mediated endocytosis, bulk membrane endocytosis, fluid phase endocytosis, vacuole protein sorting, multivesicular body sorting, and recycling of Golgi markers between endosome and Golgi were tested by alpha factor uptake and degradation assay, FM4-64 staining, Lucifer yellow, CPY maturation, localization of CPS and Sna3p, Kex2, Vps10p localization respectively. ncr1∆ shows no obvious defects in these pathways while vta1∆ and vps20∆ showed severe defects in these pathways. Our results support the model of the existence of a NPC1 compartment. In this model, the NPC1 vesicles recognize and package free cholesterol in the late endosome/lysosome and transport them to other organelles in the cell by transient contacts between NPC vesicles and the receiving compartments. The lesion of NCR1 does not affect endocytosis, vacuole protein biosynthesis and MVB sorting. Its role in vesicular transport from vacuole to other compartments needs to be further studied. The recycling from intracellular compartments to the plasma membrane need to be studied in ncr1∆ in the future to further explore its function in membrane trafficking. Keywords: sterol homeostasis, membrane trafficking, endocytosis, endosome, lysosome, MVB 2 ABBREVIATIONS ACAT ARE ARV1 bp Acyl-Coenzyme A cholesterol acyltransferase ACAT-Related Enzyme ARE2 required for viability base pair cDNA CoA complementary DNA coenzyme A CPS CPY carboxypeptidase S carboxypeptidase Y dNTP DTT deoxyribonucleotide triphosphate dithiothreitol EDTA EM ER FM 4-64 ethylenediamine tetra-acetate Electric Microscopy Endoplasmic Reticulum N-(3-triethylammoniumpropyl)-4- (p-diethylaminophenyl- hexatrienyl) pyridinium dibromide FITC GFP HMG HRP IgG Fluorescein isothiocyanate Green Fluorescent Protein 3-hydroxyl-3-methylglutaryl coenzyme-A horseradish peroxidase immunoglobulin G LDL Low-Density Lipoprotein LiAc lithium acetate LY Lucifer Yellow MVB NaOH multi-vesicular body sodium hydroxide NCR1 NPC ORF PBS PCR PEG PM PVC RND SCAP SD SDS SDS-PAGE SREBP SSD Niemann-Pick C related 1 Niemann-Pick type C Open Reading Frame PHosphate Buffer Saline Polymerase Chain Reaction polyethylene glycol Plasma Membrane Pre-Vacuole Compartment Resistance-Nodulation-Division SREBP cleavage activation protein synthetic dropout Sodium Dodecyl Sulfate Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis Sterol Regulatory Element Binding Proteins Sterol sensing domain SS-DNA Single-Stranded DNA 3 TAME TLC Tris YACs N-tosyl-L-arginine-methylesterhydtochloride Thin-Layer Chromatography hydroxymethyl amminomethane Yeast Artificial Chromosomes 4 TABLE OF CONTENTS ACKNOWLEDGEMENTS………………………………………………. 1 TABLE OF CONTENTS…………………………………………………. 5 SUMMARY………………………………………………………………. 2 ABBREVIATIONS……………………………………………………… . 3 APPENDICE……………………………………………………………… 103 REFERENCES…………………………………………………………… 87 CHAPTER 1. INTRODUCTION 1.1 NPC disease and NPC-1…………………………………………. 8 1.2 Use yeast as a model to study membrane trafficking…………….. 14 1.3 NCR1, homologue of NPC1 in Saccharomyces Cerevisuae……. 19 1.4 Exploration of membrane traffic defect in ncr1∆ Saccharomyces Cerevisuae ………………………………………………………………………….. 20 CHAPTER 2. MATERIALS AND METHODS 2.1 Media, Reagents, Strains, and Plasmid……………………………... 24 2.2 Methods…………………………………………………………….. 25 2.2.1 Genetic Techniques………………………………………………. 25 2.2.1.1 Genetic crosses and tetrad analysis…………………………….. 25 2.2.1.2 plasmid transformation of yeast ……………………………….. 25 2.2.1.3 Genomic DNA extraction……………………………………… 26 2.2.1.4 PCR amplification……………………………………………… 26 2.2.1.5 Plasmid DNA preparation from E. Coli………………………... 27 2.2.1.6 Transformation of plasmid DNA to Escherichia coli by electroporation ………………………………………………………………………….. 28 2.2.1.7 BAR1 gene deletion…………………………………………….. 28 5 2.2.1.8 DNA sequencing……………………………………………… 28 2.2.1.9 Mating type test………………………………………………. 29 2.2.2 Membrane traffic assays………………………………………... 29 2.2.2.1 Fluid-phase Endocytosis Assays……………………………… 29 2.2.2.2 Membrane Endocytosis Assays……………………………….. 29 2.2.2.3 Receptor-mediated Endocytosis Assays………………………. 30 2.2.2.4 Carboxypeptidase Y Maturation Assays………………………. 31 2.2.2.5 Multivesicular Body Sorting Assay…………………………… 33 2.2.2.6 Fluorescence Microscopy……………………………………… 33 2.2.3 Other methods in molecular cell biology………………………… 34 2.2.3.1 Alpha factor preparation………………………………………... 34 2.2.3.2 QUINACRINE vital staining of the vacuole…………………… 38 2.2.3.3 Vps10p processing ……………………………………………... 39 CHAPTER 3. RESULTS 3.1 NCR1 knock out…………………………………………………….. 41 3.2 Localization of Ncr1p………………………………………………. 41 3.3 Phenotype exploring of NCR1 with VPS20 and VTA1 null mutants.. 44 3.3.0 Vps10p processing in wild type and NCR1∆ cells………………... 44 3.3.1 Kex2p localization in wild type and NCR1∆ cells………………… 46 3.3.2 QUINACRINE staining…………………………………………… 48 3.3.3 Endocytosis of fluid phase dye Lucifer Yellow…………………… 50 3.3.4 FM 4-64 staining…………………………………………………… 52 3.3.5 CPY maturation…………………………………………………….. 57 3.3.6 α-factor…………………………………………………………….. 60 3.3.6.1 35S labeled α-factor purification………………………………… 60 6 3.3.6.2 α-factor uptake assay…………………………………………… 65 3.3.6.3 α-factor degradation assay……………………………………… 67 3.3.6.4 Multivesicular body (MVB) sorting of carboxypeptidase (CPS) and vacuola69delivery of Sna3p…………………………………………….. 69 3.4 ARV1……………………………………………………………….. 72 3.4.1 ARV1 localization………………………………………………... 72 3.4.2 Fluid phase endocytosis in arv1∆………………………………… 74 CHAPTER 4. DISCUSSION AND FUTURE WORK…………………. 76 7 Chapter 1 Introduction 1.1 NPC disease and NPC-1 Niemann-Pick type C disease (NPC) is a rare, autosomal recessive lipid storage disorder. It is a fatal disease, which usually occurs during childhood. It prevents cells from being able to metabolize cholesterol and can cause cell death. Cholesterol has important cellular functions. It is an essential structure component of membrane as well as a precursor for steroid hormones. In NPC patients, there is a fairly large amount of free cholesterol accumulated in such organs as the spleen, the liver, the bone marrow and the central nervous system. The clinical symptoms are from moderate to severe hepatosplenomegaly and vertical supranuclear gaze palsy. Other signs like pronounced neonatal jaundice, ataxia, or seizures regularly accompany the disease (Bauer et al., 2002). The clinical onset of Niemann-Pick type C disease is in late childhood and death is in the second decade (Patterson et al., 2001). NPC fibroblasts have been extensively characterized biochemically. NP-C is one of the sphingolipids storage diseases (SLSDs) with free cholesterol and other sphingolipids accumulated in late endosome/lysosome (Vanier et al., 1991, 1992; Patterson et al., 2001). The rate of cholesterol esterification in fibroblasts of NP-C patience is also decreased (Pentchev et al., 1986; Pentchev et al., 1987). SLSDs are a subset of lysosomal storage diseases in which various lipids and cholesterol are accumulated. In most cases this accumulation results from impaired sphingolipids degradation due to the defective sphingolipids hydrolytic enzymes or their activator proteins. This is the case for Niemann-Pick type A and Niemann-Pick type B disease, in which an enzyme called “sphingomyelinase” is defective and cannot break down its substrate “sphingomyelin” properly, resulting in the accumulation of sphingomyelin in different tissues in the body. However in NP-C, 8 the cholesterol and lipid accumulation apparently results from defects in sterol trafficking (Liscum et al., 1989, Pentchev et al., 1987). There are no effective treatments for this fatal disease yet and the pathology of the disease is not clear. Recently it is showed that there are similarities between NP-C and Alzheimer’s. The buildup of a “tangle” in the brain of NPC patient mimics what occurs in Alzheimer’s. The disease has also been proven to be a valuable biological tool in the study of intracellular lipid trafficking. The elucidation the molecular mechanism of the disease will shed light on the disease therapy and help elucidate the basic cellular processes involved. At cellular level, NPC disease is characterized by lysosome/late endosome accumulation of endocytosed unesterified cholesterol and delayed induction of cholesterol homeostatic reactions (Patterson et al., 2001, Vanier and Suzuki, 1996, 1998). There are two genetic complementation groups, NPC1 and NPC2, for NPC disease (Steinberg et al., 1994, Vanier et al., 1996). NPC1, which associates with the major group (accounts for 95% of the NPC cases), encodes NPC1 (Carstea et al., 1997). NPC2, which associates with the minor group (accounts for the remaining 5% of the NPC cases), encodes a ubiquitously expressed lysosome protein (HE1) with cholesterol binding properties (Vanier et al., 1996 Naueckiene et al., 2000). The clinical, cellular and biochemical phenotypes for the two complementation group are the same, suggesting both gene products may function in tandem or sequentially (Vanier et al., 1996; Carstea et al., 1997). NPC1, the gene associates with the major group, and the gene product NPC1 are intensely studied. NPC1 is located on 18q11, with the size of about 50kb. Exonic and intronic single nucleotide polymorphisms (SNP) and disease-causing mutations screening by genomic sequencing of exons, splice sites and promoter region of NP-C1 in unrelated NPC patients were performed. 9 Figure1 shows the NP-C1 gene sequence and the mutations found at present (Bauer et al., 2002). The NPC1 cDNA sequence predicts a protein of 1278 amino acids. The protein is thought to contain 13 transmembrane domains, three large luminal hydrophilic loops, one cytoplasmic loop, a luminal N-terminus and a cytoplasmic C-terminal tail (Davies and Ioannou, 2000). The region located between amino acid residues 615 and 797 shows strong homology to sterol sensing domain identified in several other integral membrane proteins that respond to endoplasmic reticulum cholesterol, and appears to be important for the function of the protein (Watari et al., 1999a). The subcellular localization of NPC1 protein was characterized with the distribution of FLAG-tagged NPC1 (which is functional because its expression in NPC1 mouse fibroblasts can clear the lysosome-accumulated free cholesterol), the immunofluorescence microscopy using anti-NPC1 polyclonal antibodies and the subcellular fractionation studies. NPC1 is a glycoprotein that associates with membranes of a population of cytoplasmic vesicles. By double-staining with various markers for different organelles it was shown that NPC1 associates predominately with late endosomes (Rab9 GTPase-positive vesicles) and to a lesser extent, with lysosomes (Lamp1-positive) and the trans-Golgi 10 network (Rab11-positive) (Higgins, et al., 1999; Neufeld, et al., 1999). Immunogold labeling was also performed with affinity purified rabbit antibody against NPC1 (Millard, et al., 2000). EM analysis revealed that in wild type cells, NPC1 immunogold labeled endosomal structures that display numerous small intraluminal vesicles characteristic of MVBs. These structures labeled with NPC1 immunogold at both the limiting membrane and the membranes of the intraluminal vesicles (Denzer, et al., 2000). When cells were treated with a hydrophobic amine (U18666A) to block cholesterol egress from lysosomes, NPC1 localization underwent a dramatic shift from late endosome to lysosome and the TGN. A model was suggested as in Fig.2 (Higgis et al 1999). It was suggested the function of NPC1 is to facilitate the transport of cholesterol from lysosome to an endosome/TGN compartment. 11 FIG. 2. A model for NPC1 location and movement. NPC1 is transported to late endosomes where it accumulates; suggesting that the forward flow of NPC1 to these organelles is dominant to any potential retrograde transport to the TGN. The protein is transported from the TGN to late endosomes although it is possible that there is an intermediate early endosome step. On arrival to late endosomes, NPC1interacts with the lysosome in a transient manner, implying that retrograde transport of NPC1 from the lysosome is dominant to the forward transport. U18666A appears to interfere with the retrograde transport of NPC1 from the lysosome and with its forward transport from the TGN to the late endosome. This model is further supported by the live cell images of NPC1-GFP fusion protein in the living cell, which showed that NPC1 moves rapidly to and from these compartments in tubules and vesicles by a process that requires microtubules (Ko DC, etc. 2001, Zhang M,etc. 2001). The dynamic vesicular movements of NPC1 suggest the possible role of NPC1 in cholesterol sorting and packaging into transport vesicle. A recent study argued NPC1 maybe a lipid permease because of its shared homology with a procaryotic member of the RND (resistance-nodulation-division) family of 12 permeases (Davises, et al. 2000). When expressed in E.coli, NPC1 substantially increases the rate of oleic acid uptake by the cells, which suggests its possible functions of transporting lipophilic molecules, although not cholesterol, out of the endosome/lysosome system (Davises, et al. 2000). Studies also demonstrated that in addition to cholesterol, the clearance of endocytosed [14C] sucrose was also defective in NP-C cells (Neufeld et al., 1999). These findings suggested a general role that NPC1 may be involved in retrograde lysosome trafficking. This concept provides an explanation for the accumulation of multiple lipids in NP-C cells and tissues such as glycolipids (Zhang et al., 2001). It is proposed that NPC1 compartment serves as a sorting station in the endocytic trafficking of both cholesterol and glycolipids (Zhang et al 2001). Cells with mutations of NPC1 and HE1 exhibit impaired delivery of internalized membrane cholesterol to the endoplasmic reticulum (ER) and also demonstrate a defect in the mobilization of endosomal cholesterol to the plasma membrane (PM). To test if the defects are due to the mutation in NPC1 and HE1, or it is the secondary defects from the accumulation of cholesterol in late endosome/lysosome, the M87 cell line was used. The M87 cell line sequesters cholesterol in an NPC-like compartment, yet harbors a defect in a gene distinct from the NPC1 and HE1/NPC2 disease genes. The M87 cell line has no demonstrable sterol trafficking defects which means that the cholesterol trafficking problem in NPC disease is due to the NPC1 gene but not the secondary effect of cholesterol accumulation. Although there are some models about how NPC1 works as mentioned above its exact cellular function is not known yet. Different Models have been used in NPC research, such as cats, mice, flies, yeast and worms (nematode). The gene is conserved in these organisms. NPC1 knockout mice 13 have the same free cholesterol accumulation phenotype as the NPC mutant human fibroblast cells. The products of these homologue genes must share some common functions in all of these species. Yeast is an excellent model organism to study sterol homeostasis and trafficking. In this thesis we will study the NPC1 homologue in yeast, NCR1. Specially, we will examine the role of Ncr1p in membrane trafficking. 1.2 Use yeast as a model to study membrane trafficking Yeast is a simple eukaryote. Many traits make yeast a suitable model for study of various cellular processes. It is called “ E.coli of eukaryotic cells” due to its easiness of handling in research. It grows rapidly. Normally a haploid cell doubles in two hours. Many conventional genetic methods can be applied in yeast to isolate various mutants, which are valuable tools to study protein function. By various mutants the function of certain individual protein is possible to be explored. There is a versatile DNA transformation system in yeast. Exogenous genes can be introduced into the cell by replicating themselves with low copy number (CEN plasmid), high copy number (2 micron plasmid) or integrated into the genome. Through homologous recombination endogenous genes can be deleted, integrated, modified or tagged with different markers in their chromosome locations. The easiness of this technique in yeast has brought revolutionary progress in the study of yeast genes. In the Saccharomyces Genome Deletion Project, almost all the 6200 yeast ORFs (Open reading frame) have been deleted and the functions of these gene products are being studied. At the same time this project facilitates the research by providing scientists with disruption strains commercially. Many organizations around the world, such as Research Genetics, Open Biosystems, American Type Culture Collection and EUROSCARF all provide commercial disruption strains for all kinds of yeast genes. The ncr1 delete strain used in this study is bought from EUROSCAF. Many important genes in mammalian cells 14 are difficult to study due to the technique obstacles. The study of the homologues in yeast provides significant insight into their cellular functions. Leland H. Hartwell was awarded 2001 Nobel Prize in Physiology and Medicine by finding genes that control cell division in yeast and their relation to cancer. S. cerevisiae is highly suitable for cell cycle study due to its observable morphology changes at different stages of cell cycle. More than one hundreds of genes specifically involved in cell cycle control were identified and all of them are conserved in eukaryotes. Another trait which makes S. cerevisiae an easier model for genetic manipulation is that it exists as both a stable haploid and diploid strains. The recessive mutations can be conveniently isolated and manifested in haploid strains and complementation tests can be carried out in diploid strains. Unlike a bacterium, which generally consists of a single intracellular compartment surrounded by a plasma membrane, an eucaryotic cell is elaborately subdivided into functionally distinct, membrane-enclosed compartments. Each compartment, or organelle, contains its own characteristic set of enzymes and resident proteins. To maintain the characteristic of each compartment for many cellular processes, protein movement between different compartments is essential. There are three ways for proteins to move from one compartment to another. In gated transport, the protein traffic between the cytosol and nucleus occurs between topologically equivalent spaces, which are in continuity through the nuclear pore complex. In transmembrane transport, membrane-bound protein translocators directly transport specific proteins across a membrane from cytosol into a space that is topologically distinct. Another way is called vesicular transport, in which membrane-enclosed transport intermediates ferry proteins from one compartment to another. The transport vesicles first budded from donor membrane with the cargo inside the lumen or on the membrane of the 15 vesicles and then fuse with the targeting compartment. At the same time the cargo is released into the compartment or integrated with the organelle membrane. The vesicle transportation is controlled by many steps and related with many proteins. Coat protein are responsible for vesicle budding, v-SNARES and t-SNARES are involved in vesicle fusion, motor protein such as dynein and kinesin are involved in vesicle transporting along cytoskeleton and there are also many proteins involved in cargo-sorting, which is an important process to maintain different properties of organelles. The cargo ranges from proteins, to lipids including cholesterol. Vesicles are used to transport proteins both out of and into the cell. The major membrane transport pathways include exocytosis, endocytosis and vacuole (yeast equivalent of lysosome) biosynthetic pathways. Exocytosis is a process by which cell sort, package and deliver proteins through vesicles to the cell surface or secrete proteins out of the cell. This is an important process because 10 percent of the proteins the cells make are secreted. Among them include growth factors, hormones, neurotransmitters of neuron cells and insulin from pancreas cell, all of which are important to cell living. Normally, secreted proteins are synthesized in the ER (endoplasmic reticulum), transported to Golgi compartment and travel further to plasma membrane via vesicles. Endocytosis is another important process whereby extracellular materials or the plasma membrane proteins are internalized into the cell and pass different endocytic compartments. Early endosome, the tubular-vesicular located at the cell periphery with a higher density, and late endosome, the larger multivesicular compartment also called MVB (multivesicular body) adjacent to the vacuole with a lower density (Singer and Riezman, 1990; Singer-Krüger et al., 1993) are such two important compartments. One wellstudied example is LDL receptor mediated endocytosis. In NP-C cells the accumulated free cholesterol is LDL-derived. The extracellular cholesterol is transported through 16 LDL particles. LDL receptors bind LDL particles through Apo-B. The complex undergoes endocytosis. When reaching to late endosome compartment LDL receptors dissociate with LDL particles and from where LDL receptor is recycled back to the cell surface and the particles are sorted into transport vesicles and targeted to lysosome, which is full of hydrolases. Cholesterol esters are hydrolyzed into free cholesterol and fatty acids there. The mechanism for cholesterol sorting and transporting to ER or plasma membrane is unknown. Vacuole biosynthesis is another important pathway interweaving with endocytosis and exocytosis at some compartments. It is a pathway whereby the vacuole residential proteins are transported from Gogi to vacuole via late endosome. M6P is attached to these proteins in the Golgi as a sorting signal for M6P receptor to recognize and transport them to late endosome, where the receptor-cargo complex gets dissociated. The M6P (mannose-6-phosphate) receptor is returned back to TGN and the vacuolar proteins go forward to their destination, the vacuole.Fig.3 depicts the endocytic, biosyntic and vacuole protein biosynthetic pathway. 17 Fig.3 Membrane traffic pathways. Endocytosis occurs from plasma membrane then goes through early endosome, late endosome and then finally reaches to the lysosome. Some materials recycle back to plasma membrane when reaching early endosome, which is also called recycling compartment. Vacuole proteins are synthesized in the ER, transferred to Golgi for further modification and travel further to late endosome and finally reach lysosome. Different membrane traffic pathways use a common compartment called late endosome or MVB. The biosynthesis of yeast vacuole, the equivalent of lysosome in mammalian cells, is chosen as a model for membrane trafficking and protein sorting because most vacuole functions are dispensable for the cell growth thus many protein sorting mutants are not vital so that they can be studied. Many specific techniques have been developed to study endocytosis in S. cerevisiae. Many useful mutants has been screened in yeast. There are two examples. vps (vacuole protein sorting) mutants were screened by the secretion of soluble vacuolar glycoprotein carboxypeptidase Y (CPY) out of the cell. CPY is synthesized in ER, transferred to Golgi for further modification and then destinated to the lumen of the vacuole. If proteins in any of these trafficking processes 18 do not function the CPY cannot reach to the vacuole lumen but instead be secreted to the extracellular of the cell. These vps mutants are important tools extensively used in studying the biosynthetic pathway and MVB sorting. Another example is isolation of end (endocytosis) mutants. Cells that are defective in acidification of the lysosome-like vacuole are able to grow at pH 5.5. Endocytosis is required in this process. By screening strains that cannot grow at pH 5.5 some endocytosis mutants has been found. It turned out that they are important proteins functioning in uptake of endocytosised ligand and transferring of internalized materials to the vacuole (Munn AL and Riezmen H, 1994). 1.3 NCR1, homologue of NPC1 in Saccharomyces Cerevisuae NCR1 (Niemann-Pick C related 1) is identified as a yeast homologue to NPC1 gene (42% identity, 75% similarity (Sturley,2000)). NCR1 encodes an uncharacterized open reading frame with multiple predicted membrane spanning domains, including a classical 20-residue signal peptide, suggesting its entry into the secretion pathway. In addition to marked transmembrane nature, the yeast NCR1 and human NPC1 gene products exhibit conservation to the morphogen receptor PATCHED (23% overall identity), the sterol sensing domains of SREBP clevage activating protein (SCAP: 29% identity in a 182 residue domain) and HMG-CoA reductase. NCR1 also predicts a region found in the murine and Caenorhabditis elegans NPC1 sequence homologue (Loftus, et al. 1997), termed the NPC motif, which includes a putative leucine zipper (Sturley, 2000). Table1. Shows the basic protein information for Ncr1p. 19 N-term MNVLWII C-term DSIEAED Length (aa) 1,170 MW(Da) 132,644 pI 4.93 Table.1 protein sequence calculations from predicted full-length translation This gene is not well characterized yet. Comparing with its mammalian homologue, NPC1, little is known about this gene’s role in sterol trafficking. 1.4 Exploration of membrane traffic defect in ncr1∆ Saccharomyces Cerevisuae My thesis is about testing the membrane trafficking pathways (endocytosis, biosynthesis and MVB sorting) in ncr1-deleted yeast strain as well as in two vacuole protein sorting mutants vps20- and vta1- delete strains in order to test if the primordial role of NPC1 is involved in general membrane trafficking. It is important to give an introduction about how our hypothesis was derived. Cholesterol is an essential constituent of membranes in mammalian cells and it is a precursor for steroid hormone and bile acid synthesis. Cell maintains a cholesterol gradient among different compartments. ER has the lowest cholesterol concentration while plasma membrane has the highest. Early endosome and the endosome-recycling compartment are also rich in cholesterol (Evans WH, etc.1985; Hornick CA, etc. 1997; Hao M, etc.2001). Cholesterol trafficking between these compartments is necessary to maintain the gradient. There are three possible ways for sterol trafficking. It can be sorted into and transported by vesicles. It can use non-vesicular transport by soluble 20 sterol-binding proteins. Still cholesterol can be freely moved between organelles with close apposition (Prinz W, 2002). The most characterized feature of NPC cells is the accumulation of free cholesterol in the endosome/lysosome system. Normally the LDL particles move into the lysosome by receptor-mediated endocytosis. Then the free cholesterol digested from the LDL particles in the lysosome is transported to ER and plasma membrane. The accumulation of free cholesterol in the lysosome in NPC cells suggested a cholesterol trafficking defect. Davises, et al. suggested that NPC1 is a permease, which can transport lipophilic molecules out of endosome/lysosome system. There is more evidence supporting the NPC1’s possible role in the vesicle transport of cholesterol. One piece of such evidence is that NPC1 expressed in E.coli cannot pump cholesterol out endosome/lysosome system (Davises, et al. 2000). In NPC cells free cholesterol accumulation occurs primarily in late endosome, which is the sorting site for various cellular proteins. In support of these observations tracking of the movement of NPC1-GFP fusion protein in living cells showed that NPC1 containing vesicles undergo fast movements along microtubules between different compartments in the cell (Zhang M, etc.2001). This supports the hypothesis that NPC1 is involved in the vesicular transport of the cholesterol. In addition to defective sterol trafficking, NP-C fibroblasts are also deficient in vesicle-mediated clearance of endocytosed [14C] sucrose, which implies a general deficiency in retrograde vesicle-transport (Neufeld EB, etc.1999). Another evidence for NPC1’s involvement in general vesicular trafficking is the impaired multi-functional receptor (IGF2/MPR) sorting in late endosome in NPC fibroblasts (Kobayashi T, et al. 1999). The sterol homeostasis is perturbed in NPC cells and that may affect membrane trafficking also. Cholesterol levels can modulate EGF receptor-mediated signaling by altering receptor function and trafficking (Pike KJ and Casey L, 2002). In yeast, specific sterols are required for the 21 internalization step of endocytosis (Munn AL, et al. 1999). Cholesterol is also required for sorting of the mannose-6-phosphate receptor out of late endosome to the Golgi ( Miwako I, et al. 2001). If the accumulation of cholesterol in late endosome/lysosome system perturb the sterol homeostasis in the whole cell, it is reasonable to expect some membrane trafficking defects caused by sterol accumulation in endocytic compartment. Our hypothesis is that NPC1 is involved the general membrane trafficking in addition to its role in cholesterol transport. Many studies have shown that proteins directly involved in vesicular transport can also affect sterol trafficking. Factors that are traditionally associated with the control of vesicular trafficking, such as Rabs, syntaxins, coats and others, are also involved in lipids traffic. Transient over expression of Rab11 resulted in prominent accumulation of free cholesterol in Rab11-positive organelles that sequestered transferrin receptors and internalized transferrin (Holtta-Vuori M, etc. 2002). Another important vacuole sorting protein called VPS4, which is an AAA (ATPase associated with a variety of cellular activities) -family ATPase. It is involved in many important cellular processes. Bishop N and Woodman P showed that expression of mutant human VPS4 gives rise to a kinetic block in postendosomal cholesterol sorting (Bishop N & Woodman P, 2000). VPS4 belongs to a large number of mutants called vacuolar protein sorting mutants, (vps). They are defective in the delivery of newly synthesized proteins to the vacuole. These mutants missort soluble vacuolar proteins, e.g. carboxypeptidase Y (CPY) into the extracellular medium instead of transporting them via the PVC and late endosome to the vacuole (Bankaitis et al., 1986; Robinson et al., 1988; Rothman and Stevens, 1986; Rothman et al., 1989). One group of these mutants is termed class E vps mutants that can affect the PVC (Raymond et al., 1992). Class E vps mutants 22 exhibit an abnormally enlarged PVC localized adjacent to the vacuole (known as the "class E compartment") which accumulates newly-synthesized vacuolar hydrolases en route to the vacuole as well as resident late Golgi proteins which normally recycle through this compartment back to Golgi (Raymond et al., 1992; Piper et al., 1995; Cereghino et al., 1995; Rieder et al., 1996; Babst et al., 1998). Class E vps mutants also exhibit defects in the transport of endocytosed cell surface material out of the class E compartment to the vacuole leading to their accumulation in this compartment (Davis et al., 1993; Munn and Riezman, 1994; Zahn et al., 2001). Soluble vacuole proteins are usually sorted into internal vesicles as they transit through the endosomal pathway and then delivered to the lumen of the vacuole. While in Class E vps mutants, these proteins cannot be sorted into the internal vesicles thus appearing on the limiting membrane of the vacuole (Odorizzi et al., 1998). VPS4 is one of the class E vps proteins, and is well-recognized as an important protein controls membrane trafficking. VPS20 and VTA1 are two VPS4 interacting proteins isolated in a screen by yeast twohybrid system. vps20 and vta1 are both characterized to be class E vps mutants and VTA1 is a novel class E vps gene first discovered in this study. In my project I also characterized their role in membrane trafficking and vesicular trafficking along with Ncr1, which with the same possible role in these general traffic pathways. They also worked as good controls for Ncr1. 23 Chapter 2 Materials and Methods 2.1 Media, Reagents, Strains, and Plasmids Saccharomyces cerevisiae strains used in this study are listed in Appendix A. Plasmids used are listed in Appendix B. YPUAD contained 1% yeast extract (Gibco-BRL/Life Technologies, Paisley, UK), 2% peptone (Gibco), and 2% glucose and was supplemented with 40mg adenine and 20mg uracil per liter. SD minimal medium was as described (Dulic et al., 1991). SOS contained 2% Bacto tryptone, 0.5% Bacto yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4, and 20 mM glucose. LB medium contained 1% casein peptone, 0.5 % yeast extract, 0.5 % NaCl. Ampicillin was from BioLab and was added to LB to 100 µg/ml. Geneticin 418 (G418) was from Gibco and was added to YPUAD to 200 µg/ml. All solid growth media contained 2% Bactoagar (Difco, Detroit, MI, USA). Lucifer yellow carbohydrazide (LY) was the dilithium salt from Fluka AG (Buchs, Switzerland). FM4-64 was from Molecular Probes (Eugene, OR, USA). 35 S-α-factor was purified from cell culture supernatants of metabolically labeled MATα cells over-expressing α-factor as described (Dulic et al., 1991) with slight modification (Munn and Riezman, 1994). Zymolyase 20T was from US Biologicals (Swampscott, MA, USA). Monoclonal CPY antibody was from Molecular Probes. Horseradish peroxidase-conjugated goat antimouse IgG was from Sigma-Aldrich (St. Louis, MO, USA). Protein A Sepharose CL4B was from Amersham/Pharmacia Biotech AB (Uppsala, Sweden) and protease inhibitors phenylmethylsulphonylfluoride, leupeptin, and pepstatin A were from Sigma-Aldrich. The Matchmaker LexA two-hybrid kit was from Clontech Laboratories (Palo Alto, CA, USA). Glutathione-agarose and the β galactosidase assay kit were from Pierce (Rockford, IL, USA). 24 2.2 Methods 2.2.1 Genetic Techniques 2.2.1.1 Genetic crosses and tetrad analysis Genetic crosses and tetrad analysis were performed as described in Adams et al. (1997). The haploid strains with opposite mating types are mixed together on YPUAD plate and then spread on the SD media selective for the diploid strains. The single colony were selected and spread on the same SD media. A scratch of cells were patched on pre-sporulation medium and incubated at 30 °C for 5-6 days and then transferred to the sporulation plates incubated at 30 °C for 30-48 h to allow the spores to germinate. 200 µl digestion buffer (10 µl 1 M Tris-HCl pH 7.5, 67 µl 2 M sorbitol, 123 µl water) containing 1 µl purified zymolase (5 mg/ml stock) were used to treat the diploid at room temperature for 20 min and 800 µl sterile water was added. The samples were spread on YPUAD plate. Tetrad dissection was performed by using a tetrad dissector (Singer Instruments MSM system). The dissected haploids were replicated on different SD selective plate to choose the strain with proper marker. 2.2.1.2 Plasmid transformation of yeast 7 Cells were grown in YPUAD at 30 °C to 1 - 2 x 10 cells / ml. 10ml cells were used for one transformation. Cells were spun down and washed in TE-LiAC buffer (0.01 M Tris-HCL, 1 mM EDTA, pH7.5, 0.1 M lithium acetate, pH7.5) and then suspended in 100 µl of TE-LiAC for each transformant. 10 µl salmon sperm DNA (10 mg/ml) and 1 µl of palsmid were added to the cells suspension with 100 µl 70% PEG. The samples were incubated at the 30°C for half an hour with Vortex occasionally and then heat shock at 42 °C for 15 min. Cells were collected and 500 µl of TE were added and 50 µl 25 were used to spread on the SD selection media. Transformants will appear after two days’ incubation at 30°C. 2.2.1.3 Genomic DNA extraction Yeast chromosomal DNA was extracted by using a rapid glass bead method. 5ml overnight yeast cultures were pelleted at 3000rpm for 5 minutes. The pellets were resuspended with 1ml sterile water, transferred to an Eppendorf tube and spun down again. The supernatant was decanted and the pellets were resuspended in remaining supernatant by vortexing. 0.2 ml 2% Triton X-100, 1% SDS, 100 mM NaCl, 10 mM Tris-Cl pH8.0, 1 mM EDTA. 0.2 ml phenol:Chloroform (1:1) and 0.3 mg glass beads (approximately 100 µl in volume) were added to the cell. The mixture was vortexed for 2 min and placed at RT for 3 minutes. 0.2 ml TE pH 8.0 was added and 5-minute spin down at top speed allowed yeast genomic DNA to stay in top aqueous layer. The aqueous phase was transferred to a new tube with 1ml of 100% ethanol and inverted several times to attain homogeneity. DNA was precipitated by centrifugation at full speed for 5 min. DNA was dried at room temperature and dissolved in 50µl TE containing RNase. Yeast genomic DNA was stored at -20°C for later use. 2.2.1.4 PCR amplification PCR amplification was carried with Pfu polymerase (Stratagene, La Jolla, CA, USA) or Tag polymerase (Stratagene). Usally 50 µl reaction system was used. Template, primers, polymerase and its buffer, dNTPs were mixed in the reaction tube. The Gene Amp PCR system 2400 (Perkin Elmer) was used for the amplification reaction. The program is like this. (i) 95°C, 2minutes 26 (ii) 95°C, 30seconds (iii) Annealing temperature depend on the primer sequence (4*(GC)+2*(TA)), 20 seconds. (iv) 72°C, extention time depends on the length of the gene to be amplified (1 kb/min). (Repeat (ii), (iii), (IV) for 30 cycles) (v) 72°C, 10minutes (vi) 4°C, end 2.2.1.5 Plasmid DNA preparation from E. Coli A modified alkaline lysis method was used for the rapid extraction of plasmid DNA from bacteria (Ausubel et al, 1989). Normally a 5ml of overnight-cultured cells were collected. The bacterial pellet was resuspended in 100µl of ice-cold solution I (50 mM glucose, 25 mM Tris·Cl (ph 8.0), 10 mM EDTA (ph 8.0)) by vigorously vortexing and then added with 200µl of freshly prepared solution II (0.2 M 1% SDS). The contents were mixed thoroughly by gently inverting the tube rapidly five times but not vortexing. The cells were stored on ice for 3 minutes to process lyses and then 150 µl of solution III (60 ml 5 M potassium acetate, 11.5 ml glacial acetic acid, 28.5 ml water) were added. The tube was stored on ice for 5 minutes. The lysates were centrifuged at 14000rpm for 5 minutes to remove cell debris. The supernatant was added with 900µl of 100% ethanol to precipitate DNA by vortexing and allowed to stand on ice for 5 minutes. DNA was centrifuged to pellet at 14000rpm for 5 minutes and washed with 1ml of 70% ethanol. DNA pellet was dried and then dissolved in 50µl of TE buffer (pH 8.0) containing RNase. The plasmid DNA was stored at -20°C. 27 2.2.1.6 Transformation of plasmid DNA to Escherichia coli by electroporation BioRad electroporation cuvettes were chilled on ice at least for 5 min. The GenePulser apparatus were set to 25 uF capacitor, 2.5 kV, and the Pulse Controller Unit was set to 200 Ω. Aliquot(s) of electrocompetent cells were thawed and put on ice. 40 µl of cell suspension was added to a cold 1.5 ml eppendorf tube mixed with 1 µl of DNA in a low ionic strength buffer such as TE and then transferred to the bottom of a cold 0.2 cm elctroporation cuvette. The electroporation cuvette was placed in the sliding cuvette holder and one pulse was applied at the above settings. 1 ml of SOC or LB media was added and 100 µl of cells were spread on the LB plate containing Ampicilin. The plate was allowed to incubate at 37°C over night. 2.2.1.7 BAR1 gene deletion The BAR1 gene encodes an extracellular protease synthesized in a-cell that cleaves and inactivates alpha factor. The gene was disrupted and replaced with LYS2 in strains used for α-factor internalisation and degradation assays by a bar1:: LYS2 construct (pEK3) as described previously (Kübler and Riezman, 1993). pEK3 was digested by restriction enzyme E.CoRI . The digested products were used to transform the lys2- strain by the lithium acetate protocol (Munn et al., 1995) to make the strain bar1::LYS2. 2.2.1.8 DNA sequencing 20 µl sequencing mixture contains 8 µl Terminator Ready Reaction Mix, 0.2 µg template, 10 pmol primer. It is subjected to amplification reaction ([96°C 10seconds + 50°C 5 seconds+60°C 4minutes] 25 cycles+4°C) in PCR machine. The final products were precipitated by 60% ethanol at room temperature for 15 min. Washed once in 70% ethanol and dry the samples in a vacuum centrifuge (Eppendorf Concentrator 28 5301). The samples were delivered to the sequencing lab in IMA for sequencing analysis. 2.2.1.9 Mating type test Strains to be tested were mixed with RH2947 (his1 MATa) or RH2948 (his1 MATα) and spread on separate SD plates without any amino acids. A-cells will form colonies and grow on plate with RH2947; α-cells will form colonies and grow on plate with RH2948. 2.2.2 Membrane traffic assays 2.2.2.1 Fluid-phase Endocytosis Assays Fluid-phase endocytosis was measured by vacuolar accumulation of the membraneimpermeant fluorescent dye lucifer yellow carbohydrazide (LY). Cells were grown in YPUAD at 24°C to 0.75 - 1 X 107 cells/ml, concentrated to 1 X 108 cells/ml in YPUAD containing 5 mg/ml LY, and incubated for 1hr at 24°C. Accumulation was stopped by adding ice-cold 50 mM sodium phosphate buffer pH7 containing 10 mM each sodium azide and sodium fluoride to the cell. Cells were then washed and examined by fluorescence microscopy for vacuolar LY using a fluorescein isothiocyanate filter. 2.2.2.2 Membrane Endocytosis Assays Endocytosis of plasma membrane was assayed by uptake and vacuolar membrane accumulation of the lipid-soluble styryl dye FM4-64 (Vida and Emr, 1995). Cells were grown in YPUAD at 24°C to 0.75 - 1 X 107 cells/ml. Culture containing 5 X 108 cells was chilled and the cells were harvested. Cells were then resuspended in 50 ml 29 ice-cold YPUAD and FM4-64 was added to a final concentration of 2 mM. The cells were then incubated at 15°C for 20min. An aliquot of cells was taken (0min) and membrane transport was stopped by addition of sodium azide and sodium fluoride to 12 mM each and chilling on ice. The remaining cells were then washed in ice-cold YPUAD to remove uninternalised FM4-64, resuspended in YPUAD prewarmed to 30°C, and a second aliquot of cells was taken and treated as described above (0min wash). The remainders of the cells were incubated at 30ºC and at 5, 10, 15, and 30min after shift aliquots of cells were taken and treated as described above. Each sample of cells was washed twice in 50mM sodium phosphate pH7 buffer containing 10mM each sodium azide and sodium fluoride and viewed by fluorescence microscopy using Texas Red light filters. 2.2.2.3 Receptor-mediated Endocytosis Assays 35 S-α-factor internalization assays were performed using the continuous presence protocol (Dulic et al., 1991). Cells were grown in YPUAD at 24°C to 0.75 - 1.0 X 107 cells/ml and then 1 X 109 cells were harvested and resuspended in 1 ml YPUAD medium prewarmed to 30°C. 35 S-labelled α-factor (approximately 1 X 105 cpm) was added and the cells were allowed to bind and internalise the α-factor at 30°C. At various time points 100 µl samples of cells were taken in duplicate and diluted into 20 ml of either 50 mM sodium phosphate ph6 buffer or 50 mM sodium citrate pH1 buffer on ice. The cells were collected by filtration on GFC filters (Whatman, Maidstone, U.K.). The filters were then washed with either pH6 or pH1 buffer and counted in a scintillation counter. Percentage internalisation was determined by dividing the pH1resistant cpm by the total cell-associated cpm (ph6-resistant) at each time point. 30 35 S-α-factor degradation assays performed using the pulse-chase protocol (Dulic et al., 1991), were used to measure transport of internalised α-factor to the vacuole. Cells were grown in YPUAD at 24°C to 0.75 - 1.0 X 107 cells/ml and then 1 X 109 cells were harvested and resuspended in 1ml ice-cold YPUAD. 35 S-labelled α-factor (approximately 1 X 105 cpm) was allowed to bind to the cells for 50 minutes on ice. Unbound 35 S-α-factor was removed by sedimenting the cells at 4°C and the cells were resuspended in 1ml pre-warmed YPUAD and incubated at 30°C to allow internalisation of the surface-bound 35 S-α-factor and transport to the vacuole. Samples of cells were taken in duplicate at various time points, washed at either pH1 or pH6, and the labeled α-factor extracted from each cell sample by several cycles of freeze and thaw in 150 µl of extraction solution (40% v/v methanol/0.025% v/v trifluoroacetic acid/0.008% v/v β-mercaptoethanol/0.06% v/v acetic acid) as described in Dulic et al. (1991). Intact and degraded forms of 35 S-α-factor in the cell extracts were separated by thin layer chromatography on Silica gel 60 plates (Merck, Darmstadt, Germany) in a developing acid/butanol/water). Intact and degraded 35 solvent (50:100:70 propionic S-α-factor spots after running through thin layer chromatography were visualized by fluorography as described in Dulic et al. (1991). 2.2.2.4 Carboxypeptidase Y Maturation Assays Cells were grown in SD containing 0.2% yeast extract at 24°C overnight and 20 A600 units of cells were harvested. Cells were washed in SD without yeast extract, resuspended in SD containing 2mg/ml bovine serum albumin, and labeled by addition 31 of 50 µl of EasyTag TM 35 EXPRE S protein labeling mix (NEN Life Science Products, Inc., Boston, MA, USA) at 24°C for 5 min. The cells were then chased at 24°C by addition of 50 µl of 50X chase mix (1 mg/ml each methionine and cysteine, and 100 mM sodium sulphate). At various time points of chase, samples of cells were removed and further membrane transport was stopped by the addition of 20 mM sodium azide and sodium fluoride. The cells in each sample were pelleted at 6 Krpm in a micro centrifuge and the supernatants were removed (medium fraction). The cells were resuspended in 150 µl of spheroplasting medium containing 50 mM Tris-HCl ph7.5/1.4 M sorbitol/2 mM MgCl2/20 mM β-mercaptoethanol and 0.33 mg/ml Zymolyase 20T. Cells were incubated at 30°C for 45 min for digestion of cell walls. Spheroplasts were pelletted in a micro centrifuge and the supernatants were removed (periplasm fraction). Medium and periplasm fractions were supplemented with protease inhibitors (1 µg/ml each of leupeptin and pepstatin, and 0.5 mM phenylmethylsulphonylfluoride) and SDS was added to 1% final concentration before heating to 100°C for 3 min. The spheroplast pellets were supplemented with protease inhibitors as above, lysed by resuspension in boiling 1% SDS, and heated to 100°C for 3 min. The medium and periplasm fractions were combined and insoluble material in the total extracellular fractions and spheroplast fractions was cleared by centrifugation in a microfuge at 13 Krpm for 10 min prior to dilution of the cleared lysates into 7.5 ml of 100 mM Tris-HCl pH8/100 mM NaCl/5 mM EDTA/1% Triton X-100 (TNET) with 10 µl of monoclonal anti-CPY antiserum. Immunoprecipitation was performed at 4°C overnight. 50 µl of 30% slurry of protein A-Sepharose beads in TNET was added to each sample and the samples were incubated for 1 h at room temperature. The protein A-Sepharose beads with bound immunoprecipitates were pelletted and washed 32 once with 10 ml TNET, twice with 1ml TNET, and once with 20 mM Tris-HCl pH 7.5 prior to resuspension in 100 µl 2 X Laemmli sample buffer and heating to 100°C for 3 min. Samples were subjected to SDS-PAGE on 7.5% gels. Gels were soaked in 1 M sodium salicylate, dried under vacuum, and the CPY bands were visualized by exposure to X-ray film at –80°C. 2.2.2.5 Multivesicular Body Sorting Assay The ability of cells to sort vacuolar membrane proteins into intralumenal vesicles of the endocytic pathway was assessed using a construct (pGO45) expressing a functional green fluorescent protein (GFP)–carboxypeptidase S (CPS) fusion protein (a gift of D. Katzmann and S.D. Emr, HHMI, UCSD, CA, USA) A plasmid expressing a Sna3p– GFP fusion protein was constructed by amplifying SNA3 without a termination codon by PCR using RH1800 genomic DNA and then subcloned into a YCplac111-based plasmid 5' and in-frame with yEGFP (pAM397). In both constructs GFP is fused to a cytoplasmic domain (N-terminus for CPS and C-terminus for Sna3p). Cells to be tested were transformed with these constructs respectively, grown to exponential phase in SD medium at 30°C, and the presence or absence of GFP-CPS and Sna3p-GFP in the lumen of the vacuole (as compared to the limiting membrane of the vacuole and Class E compartment) were observed by fluorescence microscopy using FITC light filters. 2.2.2.6 Fluorescence Microscopy All microscopy was performed using a Leica DMLB (Leica Pte. Ltd., Singapore) microscope fitted with differential interference contrast (Nomarski) light filters and appropriate fluorescence light filters. 33 2.2.3 Other methods in molecular cell biology 2.2.3.1 Alpha factor preparation 35 S-α-factor was purified as described (Munn and Riezman, 1994). The whole process took several days long with multiple steps. A. Transformation of RH449 with pDA6300. RH449 (MAT α, his4, leu2, ura3, lys2, bar1) were grown to approximately 1x107cells/ml shaking in YPUAD at 30°C. 10 ml cells were harvested at 3 K rpm in a tabletop centrifuge for each transformation. The cells were washed in TE-LiAC buffer (0.01 M Tris-HCL, 1 mM EDTA, pH7.5, 0.1 M lithium acetate, pH7.5) and then suspended in 100 µl of TE-LiAC. 10 µl salmon sperm DNA (10 mg/ml) and 1 µl of palsmid were added to 100 µl cell suspension with 100 µl 70% PEG. The cells were mixed well and incubated at the 30°C for half an hour with Vortex occasionally and then heat shocked at 42 °C for 15 min. Cells were spun down and the supernatant was aspirated off. 500 µl of TE were added to the cell pellet and 200 µl were used to spread on the SD + complete – LEU selection media. After 2 days there are colonies appears. 15 colonies were selected randomly and cultured in 5 ml precultures in SD + complete –LEU liquid media for the halo assay. B. Siliconization of Eppendorf tubes. Eppendorf tubes were siliconizd to avoid the non-specific binding of alpha factor on the wall of the tubes (the production of alpha factor is very low so the treatment of the tubes is critical). The lids of the 1.5 ml Eppendorf tubes were removed and the tubes were put on the rack. Silicon solution (dimethyl, dichloro silane, BDH) was filled to the top of the tubes and then aspirated out of the tubes under the 34 vacuum pump and harvested in a glass flask for reuse. This process of siliconizing was repeated for 3 times and then let tubes dry in the hood. Two more washes with milli-Q water were needed to get rid of the HCl released by the siliconization process. The tubes were dried in 60°C oven. Other tubes including 50 ml Falcon tubes used in the alpha factor preparation and purification process were also siliconized in this way. C. Halo plates preparation and halo assay. a. Halo plates preparation: RH123 (mating type A) strain was grown in YPUAD at 30 °C with shaking to stationary phase. 1 ml culture was added to the 200 ml melt YPUAD (2 peptone, 1% yeast extract, 2% glucose, 40 µg/ml each uracil and adenine, 0.8% Bactoagar) and mixed well. Pour 5 ml into each of petri dishes. The dishes were allowed to set and dry at room temperature for at least 2 to 3 hours and stored in cold room wrapped in plastic bag. b. Halo assay: RH449 and pDA6300 transformants are grown in 5 ml SD+HIS+URA+LYS+LEU or SD+HIS+URA+LYS, repectively with shaking at 30°C to stationary phase which will take about 3 days. 1 ml of each total culture were collected and spun in a siliconized Eppendorf tube. 0.5 ml of supernatant were transferred to fresh siliconized Eppendorf tubes and spun for 10 min at 13 K rpm. This process was repeated by transferring 0.1 ml of supernatant to a fresh new tube. 1 µl, 5 µl and 10 µl of final supernatants were spotted on halo plates and incubated at 30°C. After one night the halo size was measured. 35 D. Labeling alpha factor with 35 2- SO4 a. Media preparation: (The requirement for the media is pretty high when making alpha factor. The media must be prepared freshly for each labeling.) All the SD media used for alpha factor purification were made by adding all the necessary components instead of using the commercial one. The solution and media used: 1000XTE (Trace Elements) (0.01 mM H3BO3, 0.01 mM CuCl2, 0.1 mM KI, 0.05 mM FeCl3, 0.07 mM ZnCl2 ) , 100Xvitamin (0.2 mg/L biotin, 40 mg/L calcium pantothenate, 200 mg/L inositol, 40 mg/L niacin, 20 mg/L p-aminobenzoic acid, 40 mg/L pyridoxin, 40 mg/L thiamin, 20 mg/L riboflavin), 50Xsolution A( 43.75g/L KH2PO4, 6.25 g/L K2HPO4, 5 g/L NaCl, 50 g/L (NH4)2SO4), 50 Xsolution B (25 g/L MgCl2, 5 g/L CaCl2), 50Xsolution A no sulfate (43.75g/L KH2PO4, 6.25 g/L K2HPO4, 5 g/L NaCl, 50 g/L NH4Cl), 1L SD+complete-Leu (20 g normal glucose, 1 ml 1000X TE, 20 ml 50X solution A, 20 ml 50X solution B, 20 mg uracil, 20 mg histidine, 30 mg lysine, 10 ml 100X vitamin were added after autoclave), 2- SD+complete-Leu no SO4 (20 g extra pure (sulfate-free) glucose (BDH), 1 ml 1000XTE, 20 ml 50Xsolution A, 20 ml 50Xsolution B, 20 mg uracil, 20 mg histidine, 30 mg lysine, 10 ml 100X vitamin were added after autoclave). b. Labeling alpha factor with 35 2-: SO4 The labeling start with pre-culture of transformant with the largest halo. The cells were inoculated in 22 ml 2 SD+complete –Leu (with SO4 -) so that their density at 5:30 am of the next day is 5X106 cells/ml. The following day 4X107 cells were spun down and washed twice in Milli-Q water to get rid of the trace sulfate. The cell pellet was suspended in 25 ml SD+complete-Leu medium containing no SO4 and incubated at 30°C water bath for 30 min. Half volume of the whole package of 35 2- SO4 were added to the 36 culture. After 4 hours of labeling the culture was transferred to 50 ml ice-cold Falcon tube containing 25 µl 0.2 M EDTA, 10 mg TAME (N-tosyl-L-argininemethylesterhydtochloride) and 1.75 µl β-mercaptoethanol. The cells were allowed to sit on ice for about half an hour before spinning down and the supernatant was transferred to new 50 ml siliconized Falcon tube and ready for purification by CG50 columns. c. Incorporation efficiency determination: 1.5 µl supernatant were removed to a 1.5 ml Eppendorf tube and diluted in 30 µl of water. 5 µl of this material were added to 500 µl of 20% trichloroacetic acid (TCA) in duplicate and incubate on ice for 30min. The TCA precipitate was filtered through GFC-filters in the cold room and washed with ethanol and diethylether. The incorporation was counted as percentage of counts after TCA precipitation divided by the total counts which is determined by the counts of 5 µl of diluted supernatants as mentioned above. E. Alpha factor purification by Amberlite CG-50 column a. Preparation of column: 5 ml of dry resin (Sigma Amberlite CG-50) were put into a 50 ml Falcon tube and suspended in 40 ml solution#1 (3 M HCl, 1 mM βME) by shaking the tube gently. After being washed twice with milli-Q water it is resuspended in solution#2 (0.01 M HCl, 80% ethanol, 1 mM βME) and followed by washing twice in milli-Q water. Then the resin was equilibrated in solution#3 (0.1 M HAc, 1 mM βME) overnight. Half-hour before loading the sample the column was packed with 2.5 ml resin poured into Bio-Rad econo column, which has been siliconized. 15 to 20 ml of solution#3 were used to equilibrate and to make sure that the column runs well. b. Separation of α-factor: The culture supernatants after labeling were loaded on the top of the column at the flow rate around 1 to 2 ml/min. Let solution# 4 37 (50% ethanol, 1 mM βME) run through the column until the radio counts of last drop are below 30,000 cpm/drop. Then α-Factor was eluted with solution#2(0.01 M HCl, 80% ethanol, 1 mM βME) and collected at 1 ml per fraction. 1 µl elutes from each fraction was counted to determine α-factor peak. Tubes of elutes with most alpha factor measured by the radio counts were concentrated in Spedvac to about 200 µl each fraction and combined together so that the total volume was reduced to 500 µl which is the loop volume of HPLC. F. α-Factor purification on HPLC: the program ((B is 80% gradient grad acetonitrile), t=0’ 30% B, t=0’ to t=5’ go from 30% to 40% B, t=5’ to t=15’ remain at 40% B, t=15’ to t=17’ go to 100% B, t=17’ to t=20’ remain at 100% B, t=20’ to t=30’) is used for running α-factor sample. Cold α-factor (synthesized peptide) was first control to test if the HPLC system works well and to determine the alpha factor peak position. Then the hot sample was applied and fractions were collected. 1 µl of each fraction was taken into 5 ml of scintillation fluid and the counts were measured. 1 µl of each fraction of the purified hot α-factor with high cpm (good qualification) was spotted onto thin (aluminum foil) TLC plate. After drying for 1 to 2 hours the plate was run for 4 to 6 hours in 220 ml developing solvent (50 ml propionic acid, 100 ml butanol, 70 ml milliQ water). The purified hot α-factor with highest counts was stored in liquid nitrogen for the assay. 2.2.3.2 QUINACRINE vital staining of the vacuole To test the changes of vacuole pH, QUINACRINE (6-chloro-9-[(4-diethylamino)-1methyl-butyl] amino-2-metjoxyacridine;Mepacrine) Dihydrochloride (Sigma) was 38 used. Cells were grown to 1 X 107 cells/ml. 1 ml cells were collected by centrifugation at 4 K rpm for 1min and incubated in 500 µl of YPUAD (50 mM sodium phosphate pH 7.8) containing 200 µM QUINACRINE for 5min. Cells were then washed in YPUAD (50 mM sodium phosphate buffer PH 7.8) once and visualized within 10 min using fluorescence microscopy with a FITC filter. Vacuolar accumulation of QUINACRINE was assessed as described by Roberts et al. Cells were viewed under Nomarski optics to observe normal cell morphology and under a fluorescein isothiocyanate filter with a 100 X objective to observe vacuolar staining. 2.2.3.3 Vps10p processing Cells were grown in SD-Met media to 0.5 to 1 at OD630. They were pelleted and resuspended in 0.5 ml minimal media containing 50mM KPO4 (ph5.5)/0.1% BSA. After growing at 30 °C for 30 minutes 10 µL of EASYTAG 35S-Mey/Cys were added and the cells were pulsed for 10 minutes. After chasing for 0, 30, 60,110 minutes with 50µ L cold Met/Cys a shift of cells from the culture was transferred to empty tubes with 50 µl of 5% Azide Solution in them. Cells were collected by centrifugation at high-speed for 1 min and resuspended with 200 ul Spheroplast Mix (1.4 M Sorbitol, 50 mM Tris pH8.0, 10 mM NaN3 with 3 µl β-mercaptoethanol and 20 µl oxylyticase stock/1 ml). The cells were incubated for 30 minutes at 30 °C. The spheroplasts were then spun down and resuspended with 50 µl of lysis solution (1% SDS, 45% Urea), then heated at 95 °C for 5 minutes. After chilling on ice IP buffer was added and the unbroken cells were spun down and discarded. The supernatant were transferred to new tubes with 1 µl of VPS10 anti-serum and incubated on ice for 1.5 hours. Then 50 µl of IgGSorb beads were added and incubated on ice for another 50 minutes. The beads pellets were washed 3 times with IP buffer followed by adding 20 µl loading 39 buffer with 10% β-mercaptoethanol to each sample and heated at 95 °C for 5 minutes. Samples were run on SDS-PAGE and the phosphor autoradiography signal was detected by a Phosphoimager. 40 Chapter 3. Results 3.1 NCR1 knock out Y10000 (MATα lys2), Y00000 (MATa met 15) (wild-type) and Y12822 (MATa lys2 ncr1∆) were obtained from Euroscarf (European Saccharomyces Cerevisiae ARchives for Functional Analysis) (Frankfurt, Germany). MATa lys2 NCR1∆ (AMY158) strains were obtained by crossing Y00000 to Y10000 and tetrad dissection. The BAR1 gene was deleted in AMY158 and Y12822, yielding AMY165 and ∆ ncr1. The deletion strain were confirmed by PCR and western blot with polyclonal antibody against Ncr1p (other student in the lab did the experiments). 3.2 Localization of Ncr1p To test localization of NCR1p, NCR1 full length with 1kb upstream was subcloned into YCplac111-sc-GFP and YEplac181-sc-GFP. The primers used for amplifying the full-length NCR1 gene with 1kb upstream are: NCR1-5: AGCGCGGCCGCAGCTCGAATCCAGTTTA NCR1-3: CAGCTGGCCAACTAGTGC NCR2-5: CTATGGATTATAGCACTAGT NCR2-3: ATTTCCCACATTCCTGCAG NCRG-5: CATTGTTTGGTGGTGAAAGCTATAGGGACGATTCCA NCRG-3: AAAATTTTCCCACAGATTTTCTGGTGTGGCATCAGA YCplac111-sc-Ncr1p-GFP, YEplac181-sc-Ncr1p-GFP was transformed into wild type strain (AMY165) and ncr1∆ strain (AMY172). The transformants were cultured in SD selection medium to exponential phase at 30°C. The cells were observed by fluorescence microscopy using FITC filters. In both YCplac111-sc-Ncr1p-GFP and YEplac181-sc-Ncr1p-GFP transformants, the GFP tagged Ncr1p localized on the 41 limiting membrane of the vacuole. The signal for YEplac181-sc-Ncr1p-GFP is much stronger than YCplac111-sc-Ncr1p-GFP due to the different expression level between CEN plasmid and 2 µ plasmid. So we took pictures of YEplac181-sc-Ncr1p-GFP transformants. Since this is the construct with GFP tag, it is possible that the tagged protein behaves differently with the native protein. We generated anti-Ncr1p polyclonal antibody in our lab. Gradient centrifugation and western blot were done by another student. The data further confirmed the vacuole membrane localization of Ncr1p. So we can conclude that Ncr1p is localized on the vacuole membrane and this is different from its mammalian homologue, Npc1p, which was reported localized on the late endosome/lysosome. The Ncr1p-GFP localization is shown in the following figure, 42 Fig.3.2 43 3.3 Phenotype exploring of NCR1 with VPS20 and VTA1 null mutants 3.3.0 Vps10p processing in wild type and NCR1∆ cells In NPC fibroblast IGF2/MPR was largely redistributed to vesicles labeled by late endosome markers instead of its localization in Golgi in wild type cells. Accordingly the authors claimed that protein sorting in late endosome is impaired. Vps10p is the yeast homologue of MRP (Miwako,etc. 2001). So by the 35S pulse-chase assay I want show the distribution of Vps10p by monitoring its localization. Vps10p is synthesized in the ER, transported to Golgi where it binds M6P tagged proteins and transport them to late endosome, where the cargo and the receptor dissociate and the cargo moves forward to vacuole while the Vps10p moves back to Golgi for further round of transport of vacuole proteins. In class E vps mutant such as vps20∆, there is a delay of Vps10p recycling back to the Golgi from late endosome and due to the protease-active class E compartment, the Vps10p gets cleaved there. So detection of the cleaved form of Vps10p can indicate its accumulation in Class E compartment. The results showed that in the ncr1∆ strain, Vps10p does not get cleaved and remain one intact band with the longer chase time. Along with the result shown in figure 3.3.5 CPY maturation (there is no CPY, one of Vps10p cargoes, secretion phenotype in ncr1∆) we can conclude that vps10p’s recycling back from late endosome to Golgi is normal in ncr1∆ yeast strain. The defect of IGF2/MPR recycling from late endosome to Golgi in NPC fibroblast is not due to the defective MVB sorting but because cholesterol is required for sorting of the mannose-6-phosphate receptor out of late endosome to Golgi. The result is shown in the following Fig. 3.3.0. 44 WT vps20∆ Intact Cleaved 0 30 60 110 WT 0 30 60 110 Chase (min) ncr1∆ Intact Nonspecific 0 30 60 110 0 30 60 110 Chase (min) Fig.3.3.0 Vps10p is cleaved in vps20∆ but not in ncr1∆ vps20∆ , ncr1∆ and their isogenic wild type strains were pulsed with 10uL of EASYTAG 35S-Mey/Cys for 10 minutes at 30 oC .After 0,30,60,110 minutes’ chase time as shown above a fraction of cells was collected, spheroplasted, lysed and incubated with Vps10p anti-serum and IgGSorb beads to do the immunoprecipitation. After boiling the beads the samples were loaded on 7% SDS-PAGE and signals were detected by phosphor autoradiography. 45 3.3.1 Kex2p localization in wild type and NCR1∆ cells The yeast (Saccharomyces cerevisiae) Kex2 protease is required in MATα haploid cells to produce mating pheromone α factor (Julius et al. 1984). A type I transmembrane protein, Kex2p, is localized to a late Golgi compartment that is analogous to TGN in mammalian cells (Fuller et al. 1984, Redding et al. 1991, Wilcox et al. 1992). Several studies suggested that steady-state localization of membrane proteins to TGN is mediated by a cycling pathway between the TGN and the prevacuolar compartment (PVC), where the vacuolar biosynthetic pathway and endocytic pathway intersects (Piper et al. 1995, Raymond et al.1992, Rieder et al. 1996, Vida at al. 1993). In class E vps mutants, which accumulate active vacuolar proteases in an aberrant PVC, both Kex2p and VPS10p are degraded in a vacuolar protease-dependent manner (Cereghino et al. 1995, Piper et al. 1995), consistent with continual cycling of these proteins between the TGN and PVC. Moreover, when class E vps27-ts mutant cells are shifted to the restrictive temperature, Vps10p is rapidly and reversibly redistributed from the TGN to the PVC (Piper et al .1995), which shows that there is a delay of the TGN marker recycle back to the TGN from PVC in Class E vps mutants. Some studies also showed that after removing the TGN localization signal from the Kex2p, caused it to localize to the vacuole (Brickner and Fuller. 1997). To test if Ncr1p is involved in the recycling of Golgi marker protein recycling from PVC, we checked the distribution of Kex2p between PVC, which is contained in P13 fraction, and Golgi, which is contained in P100 fraction. The result showed that there is no obvious difference between the ratio of Kex2p in P13 and P100 for the wild type stain and ncr1∆ strain. The result is shown in the following Fig. 3.3.1. 46 47 3.3.2 QUINACRINE staining Many organelles of the vacuolar network of eukaryotic cells, including the vacuoles/lysosomes, Golgi apparatus, endosomes, clathrin-coated vesicles, synaptic membrane vesicles, chromaffin granules, and other secretory vesicles, are acidified by a single class of proton pumps, the vacuolar proton-translocating ATPases (VATPases) (Forgac et al. 1989). The electrochemical gradient generated by the VATPases is crucial for processes such as protein sorting, zymogen activation, receptormediated endocytosis, and the transport of ions, amino acids, and other metabolites (Anvaku et al.1992, Mellman et al. 1986). From previous data we know that Ncr1p is mainly localized on the membrane of the vacuole, which suggests its possible role in the vacuole acidification. QINACRINE is a weak fluorescence dye, which has affinity to the acidic environment (Roberts, et al. 1991). For the wild type cells (RH1800) (AMY165) the fluorescence is in the vacuole lumen. For the class E vps mutants RH2906 (vps4∆), vps20∆, vta1∆, the vacuole membrane and class E compartment were labeled with QUINACRINE. That is due to the V-ATPases in class E vps mutants are blocked in the PVC. For the ncr1∆ the lumen of the vacuole was stained. That means the Ncr1p is not involved in vacuole acidification. The result is shown in the following Fig. 3.3.2. 48 49 3.3.3 Endocytosis of fluid phase dye Lucifer Yellow LY (Lucifer Yellow) is a hydrophilic fluorescent dye, which accumulates in the vacuole in a temperature and energy dependent manner and therefore can be used as a marker for liquid phase endocytosis in yeast. To examine whether Ncr1p, Vps20p and Vta1p are required for fluid-phase endocytosis, we carried out LY accumulation assays at 24°C on ncr1∆, vps20∆, vta1∆ and the corresponding isogenic wild-type strains. Of all the three null mutants only vps20∆ showed a defect in LY accumulation in the vacuole. In ncr1∆, vta1∆ strain they behaved the same as the wild type strains with strong fluorescence signal accumulate in the vacuole. The result is shown in the following Fig. 3.3.3. 50 51 3.3.4 FM 4-64 staining To characterize the post-internalization step (or steps) of endocytic membrane transport affected by loss of Ncr1p, Vps20p or Vta1p, we assayed endocytic membrane transport through early endosomes and late endosomes to the vacuole, using the fluorescent lipid-soluble styryl dye FM4-64 (N-(3-triethylammoniumpropyl)-4- (pdiethylaminophenyl-hexatrienyl) pyridinium dibromide) (Vida and Emr, 1995), which is one of the most commonly used membrane-selective dyes reported as markers of endocytosis due to its staining pattern, greater photostability and low cytotoxity. After incubation of ncr1∆, vps20∆ or vta1∆ cells and their isogenic wild type cells with FM4-64 for 20min at 15°C and without chase, we observed punctate labeling characteristic of peripheral early endosomes. After washing the cells at 0°C the distribution of the FM4-64 was not significantly altered. In the case of wild-type cells, incubation for 5 min at 30°C in fresh medium caused the FM4-64 to disappear from peripheral early endosomes and appear in a single large structure adjacent to the vacuole and at this time point we also observed weak labeling of the vacuolar membrane itself. After 10min at 30°C the FM4-64 labeled only the vacuolar membrane. In contrast, in vps20∆ cells FM4-64 persisted in early endosomes, and it was only after incubation at 30°C for 10 min that we observed labeling of the class E compartment. The FM4-64 then persisted in the early endosome and class E compartment and even after 30 min not all of the FM4-64 had reached the vacuolar membrane, indicating an additional defect in late endosome to vacuole transport. In contrast to vps20∆, in vta1∆ FM4-64 reached the class E compartment after 5 min indicative of only a brief delay in transport out of early endosomes compared to wildtype cells. Transport out of the class E compartment was more strongly delayed, 52 however after 30 min most FM4-64 had moved from the class E compartment to the vacuole. Hence, in both vta1∆ and vps20∆ there are significant delays in transport between early endosomes and the class E compartment as well as between the class E compartment and the vacuole, but vps20∆ has stronger defects than vta1∆. For the ncr1∆ the cells behave exactly the same with wild type strain, indicating that Ncr1p has no effect on the forwards transport of membrane dye FM 4-64 from plasma membrane to the vacuole. The result is shown in the following Fig. 3.3.4. 53 54 55 56 3.3.5 CPY maturation To test the carboxypeptidase Y (CPY) secretion phenotype for all the mutants we use the 35S pulse-chase assay to see the CPY maturation. Upon translocation into the ER, newly synthesized CPY is core glycosylated to yield a p1 form. Transport to Golgi is followed by further glycosylation to yield a p2 form, which is then proteolytically processed to the mature (m) form upon delivery to the vacuole (Stevens et al., 1982). ncr1∆, vps20∆, vta1∆, and their appropriate isogenic wild-type strains were metabolically labeled with 35 S-methionine and then chased for varying times before lyses and visualization of CPY by immunoprecipitation, SDS-PAGE, and fluorography. With wild type, the mature form of CPY was the main form found in the internal fraction after 30 min of chase, indicating that CPY was properly delivered to the vacuole. vps20∆ exhibit significant accumulation of an intracellular pool of p2 (Golgi-modified) CPY as well as secretion of the remaining p2 CPY into the extracellular medium. vta1∆ also secreted p2 CPY to the extracellular but much less compared with vps20∆ and there is not much p2 form CPY accumulating intracellularly. And it is noticed that in vta1∆, a higher amount of p1 CPY was observed, suggesting that there maybe some problems for the maturation from p1 to p2 form in vta1∆. The two class E vps mutants both have the CPY secretion defect. For ncr1∆, there is no problem for the CPY maturation process. The result is shown in the following Fig. 3.3.5. 57 58 59 3.3.6 α-factor 3.3.6.1 35S-α-factor purification 35 S-α-factor was purified as described (Munn and Riezman, 1994). The process contained multiple steps. pDA6300 is a construct containing α-factor gene. Transforming of RH449 with the construct confers 10 times more α-factor expression level compared with the alpha type haploid strain. After transformed with pDA6300, many colonies appeared on the selection SD medium. To choose the best one with possible highest expression level of α-factor, we selected 15 transformants and pre-culture them in SD medium to stationary phase that took about 3 days. The cells were removed from the supernatant by centrifugation for several times. 1 µl, 5 µl and 10 µl from the final supernatant were spotted on the Halo plates. The diameter of the “Halo” was measured after incubating the plates at 30°C. The result is shown in the following table. 60 “Halo” Size (cm) 1 µl 5 µl 10 µl RH449 (1) 1.5 2.0 2.4 RH449 (2) 1.6 2.2 2.6 Transformant(1) 2.2 2.5 3.0 Transformant(2) 2.2 2.8 3.0 Transformant(3) 2.3 2.7 3.0 Transformant(4) 2.2 2.8 3.1 Transformant(5) 2.2 2.6 2.9 Transformant(6) 2.3 2.7 3.1 Transformant(7) 2.3 2.6 3.0 Transformant(8) 2.5 2.7 3.3 Transformant(9) 2.4 3.1 3.2 Transformant(10) 2.3 2.6 3.1 Transformant(11) 2.2 2.8 2.9 Transformant(12) 2.1 2.8 2.9 Transformant(13) 2.1 2.8 3.1 Transformant(14) 2.2 2.8 3.2 Transformant(15) 2.3 2.7 3.0 Table 3.3.6.1.1 RH441 (1), RH449 (2) are RH449 strains without pDA6300. Transformants (1 to 15) are 15 different transformants of RH449 with pDA6300 61 Transformant (9) gave largest “halo” of all the transformants tested. So this pre-culture was used for the further labeling of 35S. First α-factor was purified by a CG-50 column. After loading the supernatant and washing, α-factor was eluted and collected around 1 ml/fraction. 1 µl was removed from each fraction and put in 5 ml scintillation fluid to count DPM. The result is listed in the following table. Fraction Auto DPM 1 351,784.4 2 122,159.2 3 3,584.7 4 3,316.7 5 4,686.4 6 11,077.3 7 49,824.7 8 74,907.6 9 147,107.8 10 96,401.2 11 81,276.7 12 16,547.3 13 2881.5 14 5097.9 15 4314.0 16 4390.4 62 17 2130.2 18 4188.2 The first two peaks are junk peaks containing unbound radioactive stuff. The α-factor peaks are from fraction 7 to 11. Fraction 9 is the “hottest” fraction and it was subjected to HPLC purification. The following is the record of DPM counts for fractions separated by HPLC. The readings are listed in the following table. Fraction auto DPM 25 813.3 26 1,588.6 27 1,235.8 28 2,283.5 29 4,608.3 30 7,907.9 31 10,598.1 32 16,455.7 33 11,464.9 34 7,014.8 35 3,707.7 36 1,949.1 37 1,069.0 38 880.4 39 413.3 63 The purified α-factor is contained in fraction 31, 32, 33. To further check the quality and radioactive quantity of the purified alpha-factor 1 µl from each fraction was run on TLC plate. The result is shown below. i * o 31 32 33 34 35 Fig.3.3.6.1 purified alpha factor the fractions from HPLC containing alpha factor were spotted on the TLC plate and run in developing solvents. Fluography was performed. I, intact form of full-length alpha factor; *, the immature form of alpha factor; o, origin where samples were loaded. 64 3.3.6.2 alpha-factor uptake assay 35 S-alpha-factor uptake at 30°C was analyzed in ncr1∆, vps20∆ and vta1∆ and their corresponding isogenic wild-type strains. 35 S-alhpha-factor was internalized efficiently by all five strains, although in the vps20∆, vta1∆ and ncr1∆ strains the internalization kinetics were slightly slower than those of the corresponding wild-type strains and this difference was reproducible. One possible explanation is that in the NCR1, VPS20 and VTA1 null mutant, the internalized 35 S-α-factor can be recycled back to the cell surface from internal endosomes. The a-factor receptor Ste3p has been shown to recycle out of endosomal compartments to the cell surface in wild-type cells treated with a-factor (Chen and Davis, 2000). The uptake result is shown in the following Fig.3.3.6.2. 65 66 3.3.6.3 α-factor degradation assay To investigate whether the mutants affect transport of the internalized the vacuole we assayed the kinetics of 35 S-α-factor to 35 S-α-factor degradation at 30°C in the various strains. For the wild-type strains (RH1800 and AMY165) after 30 min, the intact α-factor spots disappeared and the degraded ncr1∆ strain the rate of 35 S- 35 S-α-factor spots were observed. In 35 S-α-factor degradation is almost the same as the wild-type strain. While for the vps20∆ and vta1∆, the intact form of 35 S-α-factor remained even 35 after 90 min. That means the kinetics of the S-α-factor degradation in these mutants were severely affected. The result is shown in Fig.3.3.6.3. 67 68 3.3.6.4 Multivesicular body (MVB) sorting of carboxypeptidase (CPS) and vacuolar delivery of Sna3p CPS and Sna3p are vacuolar membrane proteins that are delivered by the secretory pathway to the PVC and from there to the vacuole. These proteins are sorted into intraluminal vesicles by MVB sorting such that they are delivered to the vacuole lumen. The presence of internal membranes is one of the characteristics of late endosome. Late endosome is showed by some labs to be the cholesterol accumulation sites in NPC1 mutant cells. Although we did not see the sterol accumulation phenotype in NCR1 delete cells due to technical difficulties in yeast checking if the MVB sorting function is affected in these cells is necessary. In vps20∆ and vta1∆ GFP-CPS localized to the limiting membrane of the vacuole and class E compartment as it did in vps4∆ (RH2906), indicating a defect in MVB sorting (Fig. 3.3.6.4.1). In contrast, in isogenic wild-type cells GFP-CPS localized to the vacuole lumen. In ncr1∆ cells GFPCPS localized to the vacuole lumen. Ncr1p does not function in the MVB sorting of CPS. The MVB sorting of Sna3p-GFP is also checked in all of our mutants. ncr1∆ cells behave the same with wild type in which case Sna3p-GFP is localized in the lumen of vacuole. While in vps20∆ and vta1∆ cells, Sna3-GFP cannot reach the vacuole at all. It accumulated in the Class E compartment besides the vacuole. That means transport of Sna3p to the vacuole is solely dependent on VPS pathway. The result is shown in Fig.3.3.6.4.1 and Fig.3.3.6.4.2. 69 70 71 3.4 ARV1 3.4.1 ARV1 localization In a screening for mutants of S. cerevisiae that were inviable in the absence of the genes encoding the ACAT-related enzymes (Are1p and Are2p) (Yang, et al. 1996, Yu, et al. 1996), ARV1 (ARE2 required for viability) was identified (Tinkelenberg, et al. 2000). arv1∆ mutants showed an ~50% increase in free sterols and an ~75% increase in steryl ester levels. Relative to wild-type cells the mutant cells showed significantly elevated sterol levels in ER and vacuolar membrane fractions. Overall sterol levels in plasma membrane decreased. This suggests that ARV1, like NPC1 is another gene involved in sterol trafficking in S. cerevisiae. We want to check if the membrane traffic pathways are affected in this sterol transport mutant. First we want to check the localization of Arv1p. The primers we used for subcloning of ARV1 full length to YCplac111-sc-GFP and YEplac181-sc-GFP are: ARVGFP5: TTCCCCGCACCTGCAGGTC ARVGFP3: CGGGATCCTAACAATAAATAAGTTCCTG We transformed each of the plasmid based on YCplac111-sc-GFP and YEplac181-scGFP into wild type and arv1∆ cells. The transformants were picked and cultured to exponential phase and investigated under fluorescence microscope. For all the transformants, typical ER staining was observed. Because the signal for YEplac181sc-GFP-Arv1p transformants is much stronger than the YCplac111-sc-GFP-Arv1p transformants we took pictures of that as shown in Fig.3.4.1. 72 73 3.4.2 Fluid phase endocytosis in arv1∆ To examine whether Arv1p is required for fluid-phase endocytosis, we carried out LY accumulation assay at 24°C on wild-type and arv1∆ strain. For arv1∆ strain there is a significant defect in accumulation of LY in the vacuole compared to wild type. And the vacuole is fragmented in ARV1 null mutant as shown in Fig.3.4.2. 74 75 CHAPTER 4. DISCUSSION AND FUTURE WORK From previous study of NPC in mammalian cells we know that the major features of the cellular lesion in NPC cells are defects in intracellular trafficking of cholesterol and delayed sterol homeostatic responses. NP-C is one of the lysosomal storage disorders, which are characterized by lysosomal accumulation of cholesterol, sphingolipids, etc. Mutations in lipids hydrolase or an activator are the major causes of the lysosomal storage diseases because they can lead to defective hydrolysis and intracellular accumulation of lipids. Cholesterol accumulate in late endosome/lysosome in NP-C disease which is not the result of defective lipid hydrolysis, instead it is due to the defects in cholesterol transport to and from lysosome (Pagano, E.R. etc., 2000). The widely accepted model for cellular cholesterol trafficking is shown as the following figure (Ory, D.S., 2000). 76 It is suggested that in normal cells LDL (low density lipoprotein) particles go to lysosomes where the cholesterol esters are hydrolyzed to free cholesterol (Brown, M.S. etc., 1983). The bulk of LDL-derived cholesterol then moves from lysosome to the PM (plasma membrane), and subsequently cycles to the endoplasmic reticulum (ER) (Neufeld, E.B. etc., 1996). Delivery of cholesterol to ER stimulates cholesterol esterification by acyl-CoA : choleterol acyltransferase (ACAT). ER cholesterol levels also regulate cellular cholesterol homeostasis through the regulated cleavage of sterol regulatory element binding proteins (SREBPs), which are transcription factors that govern de novo synthesis and cellular uptake of LDL cholesterol. NPC cells exhibit impairment of LDL-mediated homeostatic responses (Liscum, L. etc, 1987) due to a defect in the mobilization of unesterified cholesterol from lysosomes, while the uptake of LDL cholesterol and the hydrolysis of cholesterol esters are normal. It is generally believed that NPC cells are defective in the delivery of lysosomal cholesterol to ER for esterification (Neufeld, E.B. etc, 1996; Liscum, L. etc, 1989) and in the movement of delivering lysosomal cholesterol to the PM (Neufeld, E.B. etc, 1996) (Lange, Y. etc, 2000). In NPC cells the sequestered lysosomal cholesterol can be rapidly detected by staining with filipin, a specific fluorescent marker of unesterified cholesterol (Pentchev, P.G. etc, 1985). [14C] Sucrose, a fluid-phase marker for vesicular transport (Marsh, M. etc, 1980; Griffiths, G. etc, 1989), was used to monitor endocytic trafficking (Neufeld, E. B., etc.1999). In this experiment NPC cells were labeled with [14C] Sucrose and then chased for different periods of time. [14C] Sucrose was monitored by counting aliquots of the medium and the solubilized cell monolayers in a scintillation counter. The percentage of cell-associated [14C] Sucrose compared with the total [14C] Sucrose including cell-associated and those recycled back in medium is calculated. The result showed that there is a block in retrograde lysosomal trafficking 77 of the [14C] Sucrose to the plasma membrane in NPC cells. NPC1 protein localized in a vesicular compartment, which is lysosome-associated membrane protein (LAMP)-2 – positive and mannose 6-phosphate receptor-negative. It is distinct from cholesterolenriched LAMP-2 positive structures. This subcellular distribution has also provided important insights into its cellular function. The structure of NPC1 protein is shown in Fig.2. (Ory, D.S., 2000). The human NPC1 protein has 13-16 predicted membrane spanning domains, five of which share sequence homology with the putative sterol sensing domains (SSD) of 3hydroxy-3-methylglutaryl (HMG)-CoA reductase, SREBP cleavage activating protein (SCAP), and the morphogen Patched, which suggests its sterol regulating function. The NPC1 protein has also 19 potential N-linked glycosylation sites and a dileucine motif (LLNF) at the COOH terminus, which suggests NPC1 is targeted to the endocytic pathway. From all of this evidence we can see that NPC1 localized in the endocytic compartment, late endosome/lysosome, and its quite possible involvement in the vesicular trafficking of cholesterol and additional lysosomal cargo such as sucrose out of lysosome. NPC’s role in vesicular transport of cholesterol is further improved by a recent study showed that overexpression of Rab7 or Rab9, small GTPases involved in late endosome trafficking, can correct the lipid trafficking defect in NP-C cells (Choudhury, A. and Dominguez, M. etc., 2002). 78 Yeast is a good system to study membrane traffic with many conventional methods available. The localization of GFP tagged Ncr1p and the immunofluorescence staining with polyclonal antibody against Ncr1p showed clearly that Ncr1p is on the membrane of the vacuole. Combining with the mammalian data of NPC1 we presume that most possibly the primordial role of Ncr1p is involved in the vesicular trafficking. In this work I studied vacuolar protein sorting, post-internalisation transport through the endocytic pathway, and MVB sorting pathways in ncr1∆ along with two class E vps null mutants, vps20∆ and vta1∆.. The intracellular compartments involved in these pathways include early endosome, late endosome (also called MVB), PVC, vacuole and Golgi. There are no defects for ncr1∆ in these pathways. The ratio of distribution of Kex2p, a Golgi marker, between late endosome and Golgi does not change in the NCR1 null mutant. Vps10p, another Golgi marker, which is also recycled between the Golgi and late endosome, also behaves normally. That means the transport between Golgi and late endosome is not affected in ncr1∆, which is also shown by the result of CPY secretion and maturation assay. Different from the two class E vps mutants vps20∆ and vta1∆, ncr1∆ has no CPY secretion phenotype. The phenotype of CPY secretion is due to the blocked CPY receptor (Vps10p) recycling from the PVC to the late Golgi (Cereghino et al., 1995). Inefficient sorting of newly synthesized CPY from late Golgi into PVC-directed vesicles can be corrected by over-expression of VPS10p (Babs et al., 1997). Although the two class E vps mutants have the CPY secretion defect it is much less obvious for vta1∆ than vps20∆. The possible reason maybe the slower conversion from p1CPY to p2CPY form in vta1∆, which can be seen from the CPY maturation results. p2CPY is accumulated intracellularly and secreted a lot extracellularly in vps20∆ while in vta1∆ there is less p2CPY accumulation and the secretion out of the cell is much less. The alternative explaination is that the CPY 79 secretion in vta1∆ is really minor enough that can be neglected (in fact this is further improved by the Vps10p processing assay, which shows that Vps10p recycle from late endosome to Golgi normally). Lucifer yellow uptake assay were used to test the fluid phase endocytosis. For this assay only vps20∆ showed to be defective. FM4-64 staining was performed to test the endocytosis of membrane-soluble dyes to the vacuole. Due to various time points were taken in this experiment, it is a good method to detect the dynamic endocytosis process of this dye. Ncr1p is not required for the delivery of this dye to the vacuole. It behaved like the wild type cells taking the same time to different endocytic compartments, early endosome, late endosome, PVC and vacuole. For vta1∆ and vps20∆, we can see the class E compartment accumulation of the dye. The delay for FM4-64 to be internalized and endocytosed to the vacuole is obvious in vta1∆ and vps20∆, especially in vps20∆. They are not only required for the transport of endocytosed dyes from the PVC to the vacuole, but that transport from early endosomes to PVC is also strongly delayed. We also tested the receptor-mediated endocytosis by radio-labeled alpha factor. For uptake of alpha factor into the cell there is only a slight delay of uptake of the alpha factor for the three mutants (vta1∆, vps20∆ and ncr1∆) compared with wild type, although the delay was reproducible. Although for fluid-phase and membrane-soluble endocytosis vta1∆ and vps20∆ behaves differently, both of them have strong defect at almost of the same extent for the alpha factor degradation assay. That means their role in sorting and/or transport of membrane proteins in the endocytic pathway (receptor-mediated endocytosis) is not entirely linked to bulk transport of membranes and fluid-phase materials. (In Dr. Robert piper’s lab, I generated vta∆ in a new strain background. The new VTA1 null mutant is as defective as the vps20∆ in these membrane traffic pathways). ncr1∆ has no defect in this alpha factor uptake and degradation assay. Thus we had a thorough check of the 80 forward endocytic pathway for ncr1∆. Although no obvious defects were detected, it does not mean that our idea about the primordial role of Ncr1p is in membrane traffic is wrong. On the contrary this has been a significant exploration about the function of Ncr1p and greatly narrowed down the potential targets that need to be studied in the future. The endosomal system coordinates protein transport from both the biosynthetic and the endocytic pathways (Gruenberg and Maxfield, 1995). Late endosome is a critical compartment in the pathway especially for clearing/down regulation of receptor when the limiting membrane invaginates and buds into the lumen of the organelle to form a multivesicular body (MVB) (Felder et al. 1990; Gruenberg and Maxfield, 1995). Proteins sorted into these invaginating vesicles are delivered to the lumen of the vacuole after the fusion of late endosome with the vacuole. While the remaining late endosome membrane proteins that are not sorted into the invaginating vesicles stay on the limiting membrane of the vacuole. To test the defects in MVB sorting, the localization of vacuole membrane protein CPS and Sna3 were checked in all of the three mutants. CPS and Sna3p are synthesized from ER and transported to the Golgi. Then through MVB they are directed to PVC and finally go to the vacuole. In wild type cells they are sorted into the lumen of the MVB so they are vacuole lumen proteins while in vta1∆ and vps20∆ cells CPS localized on the vacuole membrane, which indicate the MVB sorting defect. Sna3 is completely blocked in the class E compartment, which means transport of Sna3 to the vacuole is completely Vpsdependent. In ncr1∆ there is no MVB sorting defect from the data of CPS and Sna3, both of which are localized in the lumen of the vacuole just like the wild type. Since Ncr1p is localized on the limiting membrane of vacuole we use QUINACRINE staining to see if it is involved in the acidification of the vacuole. It seems that the 81 vacuole pH in ncr1∆ did not change much compared with the wild type. And that also indicated the transport of vacuole H+ ATPase through the biosynthetic pathway is not blocked. In vta1∆ and vps20∆, due to the blockage of V-ATPase in the class E compartment the QUINACRINE staining is mainly on the vacuole membrane and class E compartment. That is also evidence that in ncr1∆ there is no block for the biosynthetic transport from Golgi through MVB and PVC to the vacuole. Thus far we have checked the complete endocytic pathway as well as the vacuole protein biosynthetic pathway including MVB sorting. From the data we got we can say that Ncr1p has no obvious effect on these pathways. Previous study on NPC1 in mammalian cells showed that the retrograde transport of cholesterol and [14C] Sucrose from lysosome is affected in NPC cells. From these data we can propose that maybe the Ncr1p is functioning in the retrograde vesicle transport from lysosome to plasma membrane or elsewhere, such as ER directly. One of our results, the slightly slower dynamics in alpha factor uptake in the mutant cells may be due to the recycling problem. Some of the alpha factor which is already uptaken into the cell may be recycled from one or more than one internal compartments to the cell surface with the receptor. The a-factor receptor Ste3p has been reported to recycle out of endosomal compartmants in wild-type cells treated with a-factor (Chen and Davis, 2000), although it is not known whether the recycling can occur from the vacuole. If Ncr1p is really functioning in transporting material out of lysosome to the cell surface then the kinetics of alpha factor uptake in the ncr1∆ strain should be faster. An explanation is that there is an alternative endocytic pathway and some novel compartments exist in the cell and the accumulation in the lysosome in mutant cells may result in slower endocytosis of the recycled material from the cell surface. So the assays measuring the dynamics of recycling from internal compartments to the cell surface need to be set up 82 in yeast to elucidate this issue. The experiments of cholesterol and [14C] Sucrose retrograde trafficking from lysosome should be set up in yeast. Recycling assay in yeast is still an technique obstacle although there are some publications (Bryant NJ, etc.,1998, Wiederkehr A,etc. 2000).From our study and results from the known publications it is very possible that Npc1p affects the vesicles trafficking of cholesterol from late endosome/lysosome to somewhere else in the cell (plasma membrane or ER). It is most possible that Npc1p is specific for transporting sterol by the sterol-sensing domain it contains. The most recent studies revealed there is a highly mobile NPC1 compartment existing in the cell. By observation of GFP fusion proteins in living cells it was showed that the NPC1-containing vesicles undergo tubulation and fission. They move anterograde and retrograde rapidly along the microtubules suggesting the possible role of NPC1 in sorting and transporting free cholesterol (Zhang M etc, 2001; Strauss JF, 2002). It is suggestive the possible role of NPC1 in sterol trafficking. NCP1 recognize free cholesterol in the late endosome/lysosome by sterol sensing domain, sort and package cholesterol to NPC1 vesicles and transport them to the various organelles in the cell. This is a dynamic process so the transient NPC1 vesicles are difficult to detect while most of them appeared on the vacuole membrane to recognize the free cholesterol there. Our data showing that the endocytic pathway, vacuole proteins biosynthetic pathway and MVB sorting are not affected in ncr1∆ strain strongly support NPC1’s specific role in cholesterol trafficking by vesicles. Until now we are mainly testing different membrane traffic pathways in ncr1∆ strain. In fact we also did some basic biochemistry experiments of the protein such as the localization to better understanding the function of the protein. The gas chromatography (GC) and the 14C acetate-labeling assay have been set up in the lab to monitor the free cholesterol change in ncr1∆ strain. More detailed biochemistry 83 testing needs to be done, such as to find the interacting partner of Ncr1p or genetic screening to find the synthetic lethal mutants. in NCR1 null mutant to identify genes with more obvious phenotype. Although there is no obvious membrane traffic defects found yet in ncr1∆ strain, it does not mean the NCR1, yeast homologue of NPC1, which thought to be functioning in sterol trafficking and homeostasis, is not involved in membrane trafficking. Here we have some preliminary data about the role of another gene involved in sterol trafficking, ARV1, in membrane trafficking. The yeast ARV1 (ARE2 required for viability) was isolated in a screening for genes required for the viability in the absence of ARE (ACAT-Related Enzyme) genes. Cells lacking Arv1p is dependent on sterol esterification for growth, nystatin-sensitive, temperature- sensitive, and anaerobically inviable because their altered intracellular sterol distribution and defective in sterol uptake. Relative to wild-type cells arv∆ mutants showed significantly elevated sterol levels in ER and vacuolar membrane and decreased overall sterol levels in the plasma membrane. All of these facts are consistent with a role for Arv1p in trafficking sterol to plasma membrane (Tinkelenberg et al, 2000). The sterol homeostasis has been intensely studied in this mutant. In this study we did some preliminary membrane traffic assays to see if the vesicular transport is also affected in this mutant. From our localization data we can see that it is located on the ER, where SREBP and ACAT locate, which suggests its possible direct role in sterol homeostasis regulation. We can see under the microscope that the vacuole of arv∆ cell is heavily fragmented. And for the fluid-phase endocytosis assay there is a severe defect in the Lucifer yellow uptake to the vacuole. So it is worth for us to study more membrane trafficking phenotypes in this strain. ARV1, like NPC1, is a gene involved in the sterol trafficking and homeostasis and not out of our surprise the membrane traffic defects were also 84 detected in the null mutant. From the predicted structure of Arv1p we can see that it is 321-amino acid transmembrane protein with a potential zinc-binding motif. Zinc binding motifs serve a number of functions in membrane-associated proteins including regulation of small molecule transport (Loland et al, 1999), recruitment of signaling molecules to PM microdomains (Hostager et al, 2000), and charged lipid binding (Kutateladze et al, 1999). From these we can speculate it is possible that the protein is directly involved in sterol homeostasis and the membrane traffic defect is secondary to the changed sterol distribution. An alternative possibility is that Arv1p is involved in membrane trafficking due to it itself a trafficking protein or interact with proteins function in membrane traffic. In general, the purpose of our study is to test if there are any relationships between sterol homeostasis and membrane trafficking by using null mutants of NCR1 and ARV1, which is thought to involve in lipids homeostasis. We know that sterols are essential structural and regulatory components of eukaryotic cellular membranes (Bloch, 1983; Parks et al, 1995). Since over-accumulation of cholesterol in the cell is toxic, the mechanisms to maintain this metabolite at appropriate levels are critical. Intracellular cholesterol redistribution is regulated by ACAT activity, sterol and fatty acid biosynthesis, and lipoprotein uptake via LDL receptors (Tabas et al, 1986; Brown, et al, 1999). Sterols are maintained at a high concentration in the plasma membrane relative to the ER, where SREBP and ACAT reside. Thus trafficking of sterol to and from ER as well as between different compartments inside the cell is very critical. That means in addition to proteins involved directly in the biosynthesis, esterification or uptake of cholesterol, the mechanisms and proteins involved in transporting cholesterol are also of great importance for the sterol homeostasis. It is intriguing to 85 find the link between cholesterol transport and protein traffic. Our study will definitely contribute to the better understanding of cellular cholesterol homeostasis. 86 REFERENCES Amerik A. Y., Nowak J., Swaminathan S., Hochstrasser M. (2000) The Doa4 deubiquitinating enzyme is functionally linked to the vacuolar protein-sorting and endocytic pathways. Mol Biol Cell. 11, 3365-80. Anraku, Y., Umemoto, N., Hirata, R., and Ohya, Y. (1992) Genetic and cell biology aspacts of the yeast vacuolar H(+) –ATPase. J. Bioenerg. Biomembr. 24, 395-405 Babst, M., Sato, T.K., Banta, L.M., and Emr, S.D. (1997) Endosomal transport function in yeast requires a novel AAA-type ATPase, Vps4p. EMBO J. 16,1820-1831. Bauer, P., etc. (2002) NPC1: complete genomic sequence, mutation analysis, and Characterization of Haplotypes. Human Mutation 19:30-38. Babst, M., Wendland, B., Estepa, E.J., and Emr, S.D. (1998) The Vps4p AAA ATPase regulates membrane association of a Vps protein complex required for normal endosome function. EMBO J. 17,2982-2993. Bankaitis, V.A., Johnson, L.M., and Emr, S.D. (1986) Isolation of yeast mutants defective in protein targeting to the vacuole. Proc. Natl. Acad. Sci. USA. 83,90759079. Bishop N and Woodman P. (2000) ATPase-defective mammalian VPS4 localizes to aberrant endosomes and impairs cholesterol trafficking. Mol Biol Cell. 11,227-239. 87 Bloch, K. E. (1983) Sterol structure and membrane function. CRC Crit. Rev. Biochem. 14, 47-92. Brown, M.S., and Goldstein, J.L. (1983) Lipoprotein metabolism in the macrophage: implications for cholesterol deposition in atherosclerosis. Annu. Rev. Biochem. 52, 223-261. Brown, M.S., and Goldstein, J.L. A proteolytic pathway that controls the cholesterol content of membranes, cells, and blood. (1999) Proc. Natl. Acad. Sci. U.S.A. 96,11041-11048 Carstea, E., D. et al. (1997) Niemann-Pick C1 disease gene: homology to mediators of choleterol homeostasis. Science 277, 228-231. Cereghino, J.L., Marcusson, E.G., and Emr, S.D. (1995) The cytoplasmic tail domain of the vacuolar protein sorting receptor Vps10p and a subset of VPS gene products regulate receptor stability, function, and localization. Mol. Biol. Cell 6,10891102. Chen, L. and Davis N.G. (2000). Recycling of yeast a-factor receptor. J Cell Biol 151, 731-738. 88 Choudhury, A., Dominguez, M., Puri, V., Sharma, D.K., Narita, K., Wheatley, C.L., Marks, DL. and Pagano, R.E. (2002). Rab proteins mediate Golgi transport of caveola-internalized glycosphingolipids and correct lipid trafficking in Niemann-Pick C cells. J Clin Invest 109, 1541-1550. Davies, J. P. and Joannou, Y. A. (2000) Topological analysis of NPC1 reveals that the orientation of putative sterol sensing domain is identical to that of HMG CoA and SCAP. J Biol Chem 275, 24367-24374. Davies, J. P., Chen, F. W., Joannou, Y. A. (2000) Transmembrane molecular pump activity of Niemann-Pick C1 protein. Sience 290, 2295-2288. Davis, N.G., Horecka, J.L., and Sprague, G.F. Jr. (1993) Cis- and trans-acting functions required for endocytosis of the yeast pheromone receptors. J. Cell Biol. 122,53-65. Denzer, K., Kleijeer, M. J., Heijnen, H. F. G., Stoorvogel, W. and Geuze, H. J. (2000) Exosome: from internal vesicle of multivesicular body to intercellular signaling device. J.Cell Sci. 113, 3365-3374. Dujon, B. (1996) The yeast genome project: what did we learn? Trends Genet 12, 26370. Dulic, V., Egerton, M., Elguindi, I., Raths, S., Singer, B. and Riezman, H. (1991). Yeast endocytosis assays. Methods Enzymol. 194, 697-710. 89 Felder, S., Miller, K., Moehren, G., Ullrich, A., Schlessinger, J. and Hopkins, C.R. (1990). Kinase activity controls the sorting of the epidermal growth factor receptor within the multivesicular body. Cell. 61, 623-634. Forgac, M. (1989) Structure and function of ATP-driven protein pumps. PHysiol Rev 69, 765-796. Fuller, R. S., Sterne, R. E. and Thorner, J. (1998) Enzymes required for yeast prohormone processing. Annu. Rev. PHysiol. 50, 345-362. Goffeau, A., Barrell, B. G., Bussey, H., Davis, R.W., Dujon, B., Feldmann, H., Galibert, F., Hoheisel, J.D., Jacq, C., Johnston, M., Louis E. J., Mewes, H. W., Murakami, Y., PHilippsen, P., Tettelin, H., Oliver, S.G. (1996) Life with 6000 genes. Science 274, 546,563-7. Griffiths, G., Back, R., and Marsh, M. (1989) A quantitative analysis of the endocytic pathway in baby hamster kidney cells. J. Cell Biol. 109, 2703-2720. Gruenberg, J. and Maxifiel, F. (1995). Membrane transport in the endocytic pathway. Curr. Opin. Cell Biol. 7, 552-563. 90 Julius, D. A., Brake, L., Blair, R., Kunisawa, and Thorner, J. (1984) Isolation of putative structural gene for the lysine-arginine-cleavinf endopeptidase required for processing of yeast prepro-alpha-factor. Cell. 37,1075-1089. Higgins, E. M., Davies, P. J., Chen, W. F. and Ioannou, A. Y. (1999) NiemmanPick C1 is a late endosome-resident protein that transiently associates withlysosomes and trans-Golgi network. Mol Gene and Mota 68,1-13 Holtta-Vuori M, Tanhuanpaa K, Mobius W, Somerharju, P and Ikonen E. (2002) Modification of cellular cholesterol transport and homeostasis by Rab11. Mol Biol Cell.13, 3107-22. Hostager, B. S., Catlett, I. M. and Bishop, G.A. (2000) Recruitment of CD40 and tumor necrosis factor receptor-associated factors 2 and 3 to membrane microdomains during CD40 signaling. J. Biol. Chem. 275, 15392-15398. Katzmann, D. J., Babst, M., Emr, S. D. (2001). Ubiquitin-dependent sorting into the multivesicular body pathway requires the function of a conserved endosomal protein sorting complex, ESCRT-1. Cell. 106, 145-55. 91 Kranz, A., Kinner, A., and Kolling, R. (2001) A family of small coiled-coil-forming proteins functioning at the late endosome in yeast. Mol. Biol. Cell 12,711-723. Kobayashi T, Beuchat MH, Lindsay M, Frias S, Palmiter RD, Sakuraba H, Parton RG, Gruenberg J. (1999) Late endosomal membranes rich in lysobisphosphatidic acid regulate cholesterol transport. Nat Cell Biol, 1(2):113-8 Kutateladze, T. G., Ogburn, K. D., Watson, W. T., de Beer, T., Emr, S. D., Burd, C. G. and Overduin, M. (1999) PHosphatidylinositol 3-phosphate recognition by the FYVE domain. Mol. Cell 3, 805-811. Kuwabara PE and Labouesse M. (2002) The sterol-sensing domain: multiple families, a unique role? Trends Genet. 18 (4), 193-201 Lange, Y., Ye, J., Rigney, M. and Steck, T. (2000) Cholesterol movement in Niemann-Pick type C cells and in cells treated with amphiphiles .J. Biol. Chem.275, 17468-17475. Liscum,L. and Faust J.R.(1987) Low density lipoprotein (LDL)-mediated suppression of cholesterol synthesis and LDL uptake is defective in Niemann-Pick type C fibroblasts. J. Biol. Chem. 262, 17002-17008. Liscum,L. and Faust J.R.(1989) The intracellular transport of low density lipoprotein-derived cholesterol is inhibited in Chinese hamster ovary cells cultured 92 with 3-beta-[2-(diethylamino)ethoxy]androst-5-en-17-one. J. Biol. Chem. 264, 1179611806. Liscum,L. (2000) Niemann- Pick type C mutations cause lipid traffic jam. Traffic 1, 218-225. Loland, C. J., Norregaard, L. and Gether, U. (1999) Defining proximity relationships in the tertiary structure of the dopamine transporter. Identification of a conserved glutamic acid as a third coordinate in the endogenous Zn(2+)-binding siteJ. Biol. Chem. 274, 36928-36934. Lotus, S. K., et al. (1997) Murine model of Niemann-Pick C disease: mutation in a choleterol homeostasis gene. Science 277, 232-235. Lusa, S., Blom, T. S., Eskelinen E-L., kuismanen, E., Mansson, J-E., Simons, K. and Ikonen, E. (2001) Depletion of rafts in late endocytic membranes is controlled by NPC1-dependent recycling of cholesterol to the plasma membrane. J Cell Sci 114, 1893-1900. Marsh, M., and Helenius, A. (1980) Adsorptive endocytosis of Semliki Forest virus. j. Mol. Biol. 142, 439-454 93 Mellman, I., Fuchs, R., and Helenius, A. (1986) Acidification of endocytic and expcytic pathway. Annu. Rev. Biochem. 55, 663-700 Millard, E. E., Srivastava, K., Traub, L., Schaffer, J. E. and Ory, D. S. (2000) Niemann-Pick type C1 (NPC1) overexpression alters cellular cholesterol homeostasis. J. Biol.Chem. 275,38445-38451. Miwako I, Yamamoto A, Kitamura T, Nagayama K, Ohashi M. (2001) Cholesterol requirement for cation-independent mannose-60phophate receptor exits from multivesicular late endosomes to the Golgi. J Cell Sci, 114: 1765-76 Munn, A.L., and Riezman, H. (1994) Endocytosis is required for the growth of + vacuolar H -ATPase-defective yeast: identification of six new END genes. J. Cell Biol. 127,373-386. Munn AL, Heese-Peck A, Stevenson BJ, Pichler H, Riezman H. (1999) Specific sterols required for the internalization step of endocytosis in yeast. Mol Biol Cell, 10: 3943-57. Neufeld, E.B., Cooney, A.M., Pitha, J., Dawidowicz, E. A., Dwyer, N.K., Pentchev, P.G. and Blanchette-Mackie, E.J. (1996) Intracellular trafficking of cholesterol monitored with a cyclodextrin. J. Biol. Chem. 271, 21604-21613. 94 Neufeld, E. B., et al. (1999) The Niemman-Pick C1 protein resides in a vesicular compartment linked to retrograde transport of multiple lysosome cargo. J Boil Chem 274, 9627-9635 Odorizzi, G., Babst, M., and Emr, S.D. (1998) Fab1p PtdIns(3)P 5-kinase function essential for protein sorting in the multivesicular body. Cell 95,847-858. Ory, D.S. (2000) Niemann-pick type C: A disorder of cellular cholesterol trafficking. Biochim Biophys Actal 1529,331-339. Pagano, R.E., Puri, V., Dominguez, M. and Marks, D.L. (2000) Membrane Traffic in sphingolipid storage disease. Taffic 1, 807-815. Parks, L. W., Smith, S. J. and Crowley, J. H. (1995) Biochemical and physiological effects of sterol alterations in yeast--a review. Lipids 30,227-230. Patterson, M. C., Vanier, M. T., Suzuli, K., Morris, J. A.,Carstea, E. D., Neufeld, E. B., Blanchette-Mackie, E. J., Pentchev, P., G. (2001) Niemann-Pick disease type C: a lipid trafficking disorder. In: Scriver, C. R., Beaudet, A. L., Sly, W. S., Vale D., editors. the metabolic and molecular bases of inherited disease. 8thed. new York: McGraw Hill. p3611-3633. 95 Pentchev, P. G., Comly, M.E., Kruth, H.S.,Vanier, M.T., Wenger, D.A., Patel, S., and Brady, R.O. (1985) A defect in cholesterol esterification in Niemann-Pick disease (type C) patients. Proc. Natl. Acad. Sci. 82, 8247-8251. Pentchev, P. G., Comly, M. E., Kruth, H. S., Patel, S., Proestel M., Weintroub H. (1986) The cholesterol storage disorder of the mutant BALB/c mouse. A primary genetic lesion closely linked to defective esterification of exogenously derived cholesterol and its rela tionship to human type C Niemann-Pick disease. J Biol Chem. 261, 2772-2777 Pentchev, P. G. et al. (1987) Group C Niemann-Pick disease: faulty regulation of low-density lipoprotein uptake and cholesterol storage in cultured fibroblasts. FASEB J 1,40-45 Piper, R.C., Cooper, A.A., Yang, H., and Stevens, T.H. (1995) VPS27 controls vacuolar and endocytic traffic through a prevacuolar compartment in Saccharomyces cerevisiae. J. Cell Biol. 131,603-617. Prinze W. (2002) Cholesterol trafficking in the secretory and endocytic systems. Semin Cell Dev Biol.13(3),197-203. Raymond, C. K., Howald, S. I., Vater, C. A. and Stevens, T. H. (1992) Morphological classification of yeast vacuole protein sorting mutants: evidence for a prevacuole compartment in class E vps mutant. Mol. Biol. Cell. 3, 1389-1402. 96 Redding, K., Holcomb, C. and Fuller, R. S. (1991) Immunolocalization of Kex2p protease identifies a putative late Golgi compartment in the yeast Saccharomyces cerevisiae. J. Cell. Biol. 113, 527-538. Rieder, S.E., Banta, L.M., Kohrer, K., McCaffery, J.M., and Emr, S.D. (1996) Multilamellar endosome-like compartment accumulates in the yeast vps28 vacuolar protein sorting mutant. Mol. Biol. Cell 7,985-999. Roberts, C. J., Raymond, C. K., Yamashiro, C. T., and Stevens, T. H. (1991) Methods for studying the yeast vacuole. Methods Enzymol. 194, 644-661 Robinson, J.S., Klionsky, D.J., Banta, L.M., and Emr, S.D. (1988) Protein sorting in Saccharomyces cerevisiae: isolation of mutants defective in the delivery and processing of multiple vacuolar hydrolases. Mol. Cell. Biol. 8,4936-4948. Rothman, J.H., and Stevens, T.H. (1986) Protein sorting in yeast: mutants defective in vacuole biogenesis mislocalize vacuolar proteins into the late secretory pathway. Cell 47,1041-1051. Rothman, J.H., Howald, I., and Stevens, T.H. (1989) Characterization of genes required for protein sorting and vacuolar function in the yeast Saccharomyces cerevisiae. EMBO J. 8,2057-2065. 97 Singer, B. and Riezman, H. (1990) Detection of an intermediate compartment involved in transport of α-factor from the plasma membrane to the vacuole in yeast. J Cell Biol 110, 1911-1922. Singer-Krüger B., Frank, R., Crausaz, F. and Riezman, H. (1993) Partial purification and characterization of early and late endosomes from yeast. Identification of four novel proteins. J Biol Chem 268, 14376-14386. Steinberg, S. J., Ward, C. P. and Fensom A. H. (1994) Complementation studies in Niemann-Pick disease type C indicate the existence of a second group. J Med Gnet 31, 317-320. Strauss JF, Liu P, Christenson LK, WatariH. (2002) Sterols and intracellular vesicular trafficking: lessons from the study of NPC1. Steroids 67:947-51. Sturley, S., L. (2000) Conservation of eukaryotic sterol homeostasis: new insights from studies in budding yeast. Biochim Biophys Acta 1529, 155-163. Tabas, I., Weiland, D. A. and Tall, A. R. (1986) Inhibition of acyl coenzyme A:cholesterol acyl transferase in J774 macrophages enhances down-regulation of the low density lipoprotein receptor and 3-hydroxy-3-methylglutaryl-coenzyme A reductase and prevents low density lipoprotein-induced cholesterol accumulation. J. Biol. Chem. 261, 3147-3155. 98 Tinkelenberg, A. H., Liu, Y., Alcantara, F., Khan, S., Guo, Z., Bard, M. and Sturley, S. L. (2000) Mutation in yeast ARV1 alter intracellular sterol distribution and are complemented by human ARV1. J. Biol. Chem. 275, 40667-40670. Vanier, M. T., Rodriguez-Lafrasse, C., Rousson, R., Duthel, S., Harzer, K., Pentchev P. G., Revol, A., Louistot P. (1991) Type C Niemann-Pick disease: biochemical aspects and phenotypic heterogeneity. Dev Neurosci 13,307-314. Vanier, M. T., Rodriguez-Lafrasse, C., Rousson, R., Mandon, G., Boue, J., Choiset, A., Peyrat M., F., Dumontel, C., Juge, M., C., and Pentchev, P., G. (1992) Prenatal diagnosis of Niemann-Pick type C disease: current strategy from an experience of 37 pregnancies at risk. Am J Hum Genet 51, 111-122. Vanier, M. T. and Suzuki, K. (1996) Niemannn-Pick C disease. In: Moser HW (ed) Handbook of clinical neurology (neurodystrophies and neurolipidoses), vol 66/revised ser vol 22. Elsevier Science, Amsterdam, pp 133-162 Vanier, M. T., Duthel, S., Rodriguez-Lafrasse, C., Pentchev, P., G., Carstea, E.,D. (1996) Genetic heterogeneity in Niemann-Pick C disease: a study using somatic cell hybridization and linkage analysis. Am J Hum Genet 51: 111-122. Vanier, M. T. and Suzuki, K. (1998) Recent advances in elucidating Niemann-Pick C disease. Brain Pathol 8: 163-174. 99 Vida, T. A., Huyer, G. and Emr, S. D. (1993) Yeast vacuolar proenzymes are sorted in the late Golgi complex and transported to the vacuole via a prevacuolar endosomelike compartment. J Cell Biol 121, 1245-1256. Watari, H., Blanchette-Mackie, E. J., Dwyer, N. K., Watari, M., Neufeld, E. B., Patel, Pentchev, P. G., Strauss, J. F., (1999a) Mutations in the leucine zipper motif and sterol-sensing domain inactivate the Niemman-Pick C glycoprotein. J Biol Chem 274,21861-21866. Wilcox, C. A., Redding, K., Wright, and Fuller, R. S. (1992) Mutation of a tyrosine localization signal in the cytosolic tail of yeast Kex2 protease disrupts Golgi retention and results in default transport to the vacuole. Mol. Biol. Cell. 3,1353-1371. Yang, H., Bard, M., Bruner, D. A., Gleeson, A., Deckelbaum, R. J., Aljinovic, G., Pohl, T., Rothstein, R. and Sturley, S. L. (1996) Sterol esterification in yeast: a twogene process. Science 272,1353-1356. Yu, C., Kennedy, N. J., Chang, C.C. Y. and Rothblatt, J.A. (1996) Molecular cloning and characterization of two isoforms of Saccharomyces cerevisiae acylCoA:sterol acyltransferase. J. Biol. Chem. 271,24157-14163. Zahn, R., Stevenson, B.J., Schröder-Köhne, S., Zanolari, B., Riezman, H., and Munn, A.L. (2001). End13p/Vps4p is required for efficient transport from early to late endosomes in Saccharomyces cerevisiae. J. Cell Sci. 114,1935-1947. 100 Zhang, M. et al. (2001) Sterol-modulated glycolipid sorting occurs in Niemann-Pick C1 late endosomes. J.Biol.Chem 276, 3417-3425. Zhang M, Dwyer NK, Love DC, Cooney A, Comly M, Neufeld E, Pentchev PG, Blanchette-Mackie EJ, Hanover JA. (2001) Cessation of rapid late endosomal tubulovesicular trafficking in Niemann-Pick type C1 disease. Proc Natl Acad Sci USA 98:4466-71. 101 PAPER SUBMITTED Ren, J., Yeo, S., Wagle, M., Liu, C., Zahn, R., Yang, H. and Munn, A. L. (2002) Vps20p and Vta1p interact with Vps4p and function in multivesicular body sorting and endosomal transport in Saccharomyces Cerevisia. 102 Appendix A. Genotypes of yeast strains used in this study Strain RH123 RH449 RH1800 RH2906 RH2947 RH2948 Y10000 Y12822 Y04130 AMY158 AMY165 AMY149 AMY162 AMY172 AMY174 Genotype MATα his4 leu2 ura3 lys2 bar1 MATa his4 leu2 ura3 bar1 MATa end13-∆::URA3 his4 leu2 ura3 lys2 bar1 MATa his1 MATα his1 MATα his3 leu2 ura3 lys2 MATa ncr1-∆::KanMx his3 leu2 ura3 lys2 MATa vta1-∆::KanMx his3 leu2 ura3 met15 MATa his3 leu2 ura3 lys2 MATa bar1-∆::LYS2 his3 leu2 ura3 lys2 MATa vta1-∆:: KanMx his3 leu2 ura3 lys2 MATa vta1-∆:: KanMx bar1-∆::LYS2 his3 leu2 ura3 lys2 MATa ncr1-∆:: KanMx bar1-∆::LYS2 his3 leu2 ura3 lys2 MATa vps20-∆::KanMx his4 leu2 ura3 bar1 Source Riezman strain Riezman strain Riezman strain Zahn et al. (2001) Riezman strain Riezman strain EUROSCARF EUROSCARF EUROSCARF This study This study This study This study This study This study 103 Appendix B. Plasmids used in this study Plasmid PEK3 Description For disruption of BAR1 with LYS2 pGO45 pAM397 CPS with GFP tag in high copy plasmid YCplac111-sc-GFP with a 700bp HindIII, BamH1 fragment carrying full length SNA3 YCplac111-sc-GFP with full length NCR1 YEplac181-sc-GFP with full length NCR1 YCplac111-sc-GFP with full length ARV1 YEplac181-sc-GFP with full length ARV1 pNG1 pNG8 pAG1 pAG8 Source Kubler and Riezman (1991) S.D.Emr This study This study This study This study This study 104 [...]... homeostasis and trafficking In this thesis we will study the NPC1 homologue in yeast, NCR1 Specially, we will examine the role of Ncr1p in membrane trafficking 1.2 Use yeast as a model to study membrane trafficking Yeast is a simple eukaryote Many traits make yeast a suitable model for study of various cellular processes It is called “ E.coli of eukaryotic cells” due to its easiness of handling in research It... Comparing with its mammalian homologue, NPC1 , little is known about this gene’s role in sterol trafficking 1.4 Exploration of membrane traffic defect in ncr1∆ Saccharomyces Cerevisuae My thesis is about testing the membrane trafficking pathways (endocytosis, biosynthesis and MVB sorting) in ncr1-deleted yeast strain as well as in two vacuole protein sorting mutants vps20- and vta1- delete strains in order... primarily in late endosome, which is the sorting site for various cellular proteins In support of these observations tracking of the movement of NPC1 -GFP fusion protein in living cells showed that NPC1 containing vesicles undergo fast movements along microtubules between different compartments in the cell (Zhang M, etc.2001) This supports the hypothesis that NPC1 is involved in the vesicular transport of. .. controls membrane trafficking VPS20 and VTA1 are two VPS4 interacting proteins isolated in a screen by yeast twohybrid system vps20 and vta1 are both characterized to be class E vps mutants and VTA1 is a novel class E vps gene first discovered in this study In my project I also characterized their role in membrane trafficking and vesicular trafficking along with Ncr1, which with the same possible role in. .. accumulation of cholesterol in late endosome/lysosome system perturb the sterol homeostasis in the whole cell, it is reasonable to expect some membrane trafficking defects caused by sterol accumulation in endocytic compartment Our hypothesis is that NPC1 is involved the general membrane trafficking in addition to its role in cholesterol transport Many studies have shown that proteins directly involved in vesicular... released into the compartment or integrated with the organelle membrane The vesicle transportation is controlled by many steps and related with many proteins Coat protein are responsible for vesicle budding, v-SNARES and t-SNARES are involved in vesicle fusion, motor protein such as dynein and kinesin are involved in vesicle transporting along cytoskeleton and there are also many proteins involved in cargo-sorting,... without yeast extract, resuspended in SD containing 2mg/ml bovine serum albumin, and labeled by addition 31 of 50 µl of EasyTag TM 35 EXPRE S protein labeling mix (NEN Life Science Products, Inc., Boston, MA, USA) at 24°C for 5 min The cells were then chased at 24°C by addition of 50 µl of 50X chase mix (1 mg/ml each methionine and cysteine, and 100 mM sodium sulphate) At various time points of chase,... cell line sequesters cholesterol in an NPC- like compartment, yet harbors a defect in a gene distinct from the NPC1 and HE1 /NPC2 disease genes The M87 cell line has no demonstrable sterol trafficking defects which means that the cholesterol trafficking problem in NPC disease is due to the NPC1 gene but not the secondary effect of cholesterol accumulation Although there are some models about how NPC1 ... proteins functioning in uptake of endocytosised ligand and transferring of internalized materials to the vacuole (Munn AL and Riezmen H, 1994) 1.3 NCR1, homologue of NPC1 in Saccharomyces Cerevisuae NCR1 (Niemann-Pick C related 1) is identified as a yeast homologue to NPC1 gene (42% identity, 75% similarity (Sturley,2000)) NCR1 encodes an uncharacterized open reading frame with multiple predicted membrane. .. membrane spanning domains, including a classical 20-residue signal peptide, suggesting its entry into the secretion pathway In addition to marked transmembrane nature, the yeast NCR1 and human NPC1 gene products exhibit conservation to the morphogen receptor PATCHED (23% overall identity), the sterol sensing domains of SREBP clevage activating protein (SCAP: 29% identity in a 182 residue domain) and HMG-CoA ... we will study the NPC1 homologue in yeast, NCR1 Specially, we will examine the role of Ncr1p in membrane trafficking 1.2 Use yeast as a model to study membrane trafficking Yeast is a simple eukaryote... sorting) in ncr1-deleted yeast strain as well as in two vacuole protein sorting mutants vps20- and vta1- delete strains in order to test if the primordial role of NPC1 is involved in general membrane. .. proteins Coat protein are responsible for vesicle budding, v-SNARES and t-SNARES are involved in vesicle fusion, motor protein such as dynein and kinesin are involved in vesicle transporting along