Discovery of lipid enzymes and their modulators using metabolite profiling of yeast (saccharomyces cerevisiae) mutants

DISCOVERY OF LIPID HYDROLYSING ENZYMES AND THEIR MODULATORS USING METABOLITE PROFILING OF YEAST (SACCHAROMYCES CEREVISIAE) MUTANTS PRADEEP GOPALAKRISHNAN A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE DEPARTMENT OF BIOLOGICAL SCIENCES NATIONAL UNIVERSITY OF SINGAPORE 2007 ACKNOWLEDGEMENTS I would like to thank my supervisor Dr. Markus Wenk for his guidance and support. I would like to thank everybody at the lab for their advice and friendship. It’s the best lab I have been in and everybody has been great. They are past and present Guang Hou, Anne, Aaron, Asif, Con, Leroy, Gek Huey, Joyce, Wei Fun, Robin Chan, Xueli, Tommy, Hong Sang, Yoke Yin, Sravan, Wei Kiang, Kai Leng, Mee Kian, Ignascius, Huimin. I have received considerable help and advice from Guang Hou, to whom I am particularly grateful . Aaron, who has never refused my requests of help. Leroy and Con for helping me with the corrections. Gek Huey for her expertise with the computational work. Robin for being a good friend and helping me ever so often. Xue Li for her expert assistance and comments. Sravan for his advice and suggestions. I am also indebted to Dr .Robert Yang and all his lab members for his kind help with his lab space, resources and expertise. Dr.Yang’s lab has been my second home and I am very glad to have had you all as colleagues. Jaspal, Choon Pei, Li Phing, Kelly, Siva. I would also like to thank all the level 3 people especially Wei Hua who has helped me with many experiments. Without the friendly help of all the people at level 3 my experiments would have been very difficult to carry out. I would like to thank my friend Lee for his support and encouragement. The friendly office staff at DBS and Biochemistry and so many more people who have all gone out of their way to help me. Thank you all. Last but not the least; I thank my family and friends for their support. ii TABLE OF CONTENTS ACKNOWLEDGEMENTS i SUMMARY v LIST OF TABLES vii LIST OF FIGURES viii LIST OF ABBREVIATIONS x 1 INTRODUCTION 1 1.1 Lipids 2 1.2 Techniques used to study lipids 4 1.3 Mass spectrometry and lipidomics 5 1.4 Phospholipid profiling 7 1.5 Yeast as a model organism to study lipids 8 1.6 Objectives of the thesis 10 2 MATERIALS AND METHODS 2.1 Strains 11 2.2 Plasmids 16 2.3 Growth media and buffers 17 2.3.1 Yeast culture media 17 2.3.2 Bacterial culture media 18 2.3.3 Buffers 18 2.3.4 Growth conditions 19 2.4 Glycerophospholipid extraction 19 2.5 Analysis of lipids 20 iii 2.5.1 Mass spectrometry of lipid extracts 20 2.5.2 Tandem mass spectrometry 21 2.5.3 Precursor ion scan mass spectrometry 21 2.5.4 Triacylglyceride measurement using 21 Mass Spectrometry 2.5.5 2.6 2.7 3 Computational analysis of mass spectral data 22 Sub cloning YBR042C and expression in YBR042C null mutant 23 2.6.1 Genomic DNA isolation 23 2.6.2 24 2.6.3 Restriction digestion of PCR products and vector Ligation of vector and Insert 2.6.4 Transformation of bacterial cells 25 2.6.5 Analysis of isolated plasmid DNA 26 2.6.6 Preparation of competent yeast cells 26 2.6.7 Transformation of yeast cells 26 2.6.8 Fluorescent imaging of yeast cells 27 Generation of double knock out mutant of SLC1 and YBR042C 27 25 RESULTS 3.1 3.2 3.3 3.4 Validation of glycerophospholipid profiling-SLC1 deletion strain as a positive control 30 Tandem mass spectrometric identification of lipid species 32 Lipid profiling of single deletion mutant strains 33 3.3.1 Lipid profiling of strains in a random manner 33 3.3.2 Lipid profiling of strains in a domain based manner 37 Identification of a putative novel acyltransferase 42 iv 3.5 Rescue of a strain deleted of YBR042C 44 3.5.1 PCR amplification of YBR042C 44 3.5.2 Restriction analysis of selected plasmid 44 3.5.3 Fluorescent imaging of transformed YBR042C mutant cells Mass spectrometric profile of transformed YBR042C cells 46 3.5.4 3.6 Generation of double knockout mutants of YBR042C and SLC1 48 3.7 Quantitative measurement of lipid levels 51 3.8 Lipid droplet staining and triacylglyceride level Measurements 52 Phenotypic changes observed in mutant strains 53 3.9 4 47 DISCUSSION 4.1 Lipid profile of tester strain 54 4.2 Lipid profiles of single gene deletion mutant 54 4.3 Reasons for changes observed 54 4.4 YBR042C a putative acyl transferase 55 4.5 Future directions 57 4.6 Further characterization of ORF YBR042C 58 5 BIBLIOGRAPHY 6 APPENDIX Mass Spectra 59 65 v SUMMARY Discovery of Lipid hydrolysing enzymes and their modulators using metabolite profiling of Yeast (Saccharomyces cerevisiae) mutants An understanding of glycerophospholipid metabolism, especially with regard to regulation, is incomplete. A better understanding could be obtained if unannotated genes are functionally characterized with respect to glycerophospholipids. Glycerophospholipid profiling using mass spectrometry is one approach to discover genes involved. In essence, glycerophospholipid profiling as applied to functional annotation refers to obtaining a mass spectrum of a single gene deletion mutant and comparing it to the mass spectrum derived from the wild type. This reverse genetics approach is particularly suited for Saccharomyces cerevisiae as it has both its genome completely sequenced and the availability of a single gene deletion library. The screening of mutants in one such single gene deletion library was done in both a random and a targeted fashion. The presence of phospholipid related domains was used as the basis of targeted selection of ORFs. One hundred and twenty yeast strains were profiled. Based on this screening regime we have identified a putative acyltransferase YBR042C, which was found to be involved in maintaining the levels of Phosphoinositols. Further characterization of this ORF was carried out to better understand its molecular function. The localization of YBR042C to the lipid droplets was independently confirmed. The substrate specificity of YBR042C was investigated via deletion of vi YBR042C along with SLC1, which encodes another lipid droplet localizing acyltransferase. Preliminary data suggests that YBR042C transfers 18 carbon fatty acids to lysophosphatidic acid. Quantitative measurements of glycerophospholipid and Triacylglyceride levels were carried out. The decrease in Phosphoinositols was quantified. Deletion of these two genes resulted in a several fold decrease of the major phosphoinositol species. This study shows that mass spectrometry based lipid profiling is a useful tool for studying gene function. Strategies to scale up the profiling process are discussed. vii LIST OF TABLES Table Number 1 Title of the table Page Number Lipid binding domains 8 2 Yeast strains used in the random screen 11 3 13 4 Yeast strains used in the domain-based screen YPD media composition 5 Minimal media composition 17 6 LB media composition 18 7 LBA media composition 18 8 Lysis buffer composition 18 9 Tris-EDTA composition 19 10 Mass spectrometric parameters 20 11 Primer sequences 24 12 PCR reaction mix composition 24 13 Ligation reaction mix composition 25 14 Transformation mix composition 26 15 28 16 Primers used for amplification of His template DNA PCR reaction mix 29 17 PCR reaction conditions 29 18 Mass-to-charge ratios of characteristic fragment ions Lipid profiling results of ORFs selected 32 19 17 35 randomly 20 Lipid profiling results for ORFs selected in 38 a domain based manner viii LIST OF FIGURES S.No Title of the figure Page Number 1 Figure ID 1.1 Lipid classes and representatives 3 2 1.2 Phosphatidic acid and classes of phospholipids 4 3 1.3 A typical lipidomics experiment 6 4 2.1 Plasmid map of YCplac 111 16 5 2.2 Amplification of gene of interest YBR042C 24 6 2.3 PCR based gene targeting to knockout slc1 in a 28 YBR042C knockout 7 3.1 Phospholipid profile of a slc1 deletion mutant 31 8 3.2 Tandem mass spectrometric (MS-MS) identification 32 of lipid species with m/z value 835 9 3.3 Representative example of a comparative 34 phospholipid profiling strategy for single gene deletion mutants 10 3.4 The domain information of YBR042C shows that it 42 possesses an Acyltransferase domain 11 3.5 Phospholipid profile of a putative acyl transferase 43 mutant (YBR042C) 12 3.6 PCR amplification of YBR042C 44 13 3.7 Gel photograph showing the restriction digestion of 45 plasmid isolated from positive E.coli colonies 14 3.8 Localization of GFP-tagged YBR042C 46 15 3.9 Mass spectrometric profile of a YBR042C mutant 47 16 3.10 Quantitative measurement of lipid levels in the 48 rescued mutant 17 3.11 Gel Photograph showing PCR products to confirm 49 ix the replacement of SLC1 gene with his fragment 18 3.12 Phospholipid profile of a mutant deleted of both 50 ∆slc1 and YBR042C 19 3.13 Precursor ion scans of the major 51 glycerophospholipid species 20 3.14 Lipid droplets staining 52 21 3.15 Measurement of OD of Wildtype, YBR042C and a 53 double deletion mutant of YBR042C and SLC1 22 4.1 Possible mechanism by which alterations in PA 57 levels influence phosphoinositol levels x LIST OF ABBREVIATIONS AND SYMBOLS CDP-DAG Diacyl Glycerol COW Co-related Optimized Warping DNA Deoxyribo Nucleic Acid DMPA E. coli Escherichia coli EDTA Ethylene Diamine Tetra Acetate ESI Electro Spray Ionization EUROFAN European Functional Analysis Network EUROSCARF European Saccharomyces cerevisiae Archive for Functional Analysis GEF Guanine Nucleotide Exchange Factor GFP Green Fluorescent Protein GPIns Glycerophospho Inositols GPnEtn Glycerophosphono ethanolamines GPSer Glycerophospho Serines HCL Hydrochloric acid His Histidine HPLC High Performance Liquid Chromatography LB Luria-Bertani Media LBA Luria-Bertani Media with Ampicillin LiAc Lithium Acetate MALDI Matrix Assisted Laser Desorption and Ionization MATLAB Matrix Laboratory min Minutes MS Mass Spectrometry NMR Nuclear Magnetic Resonance OD Optical Density ORF Open Reading Frame xi PCR Polymerase Chain Reaction rpm Revolutions per minute SDS Sodium Dodecyl Sulphate ss-DNA Single stranded Deoxyribo Nucleic acid TAG Tri acyl Glyceride TE Tris-EDTA TLC Thin Layer Chromatography YPD Yeast Peptone Dextrose Media xii 1 INTRODUCTION Genome sequence information has revealed the presence of several ORFs (Open Reading Frames) whose function remains elusive. To annotate the functions of such ORFs and to characterize their cellular roles remains a major task in this post genome sequencing era (Kanehisa et al., 2003, Oliver 1997). Several genes with a role in lipid metabolism or regulation have been functionally characterized, but our understanding of lipid metabolism especially regulation remains incomplete. The relative lack of information on lipids is possibly due to an incomplete understanding of these molecules and has led to an under appreciation of the cellular roles of lipids (Chong, 2001). Absence of powerful analytical techniques has further hampered the study of lipids. The techniques used to study these molecules in the past include Thin layer chromatography (TLC), Gas chromatography (GC) and biochemical assays. These techniques often require large amounts of sample and are unable to resolve individual lipid species. The adaptation of mass spectrometry to study lipids and an increasing interest in these molecules has dramatically changed the field of lipid science (Kerwin et al., 1994, Kim et al., 1994). Mass spectrometry allows for the profiling of lipids, and helps in obtaining a relative ratio of the various species present in a sample. The lipid profile of a sample, such as that of a gene-deletion mutant can be compared to the control condition (the wild type) to yield insights into the effects of gene disruption, and provides information on the metabolic pathways involved (Welti and Wang, 2004). This reverse genetics approach can help identify genes involved in lipid metabolism and regulation. The major requirements for this approach include a completely sequenced genome and genetic libraries, which are present for the baker’s yeast Saccharomyces cerevisiae (Wallis and Browse, 2002; Guan and Wenk, 2006). These factors along with a 1 similarity in lipid pathways make the baker’s yeast Saccharomyces cerevisiae an ideal organism for identifying genes involved in lipid metabolism. 1.1 Lipids Lipids as a class of biomolecules represent several subgroups which are chemically diverse with one common feature being their insolubility in water, though lipids such as phosphoinositols exhibit solubility in water. The various subclasses of lipids include fatty acids, glycerophospholipids, Sphingolipids and sterols (Figure 1.1). The number of carbon atoms in fatty acids, the presence and position of double bonds and head groups result in structural diversity amongst lipids. Specific classes of lipids such as the Glycerophospholipids have a common backbone but the presence of different functional groups results in new subclasses of lipids (Fig 1.2). The functional implications of this structural diversity are only beginning to be understood. The discovery that lipids can give rise to signaling molecules such as diacylglycerol (DG, inositol 1, 4, 5-trisphosphate is one such example (Berridge, 2003). lipids are also involved in numerous lipid-lipid and lipid-protein interactions. The discovery of an increasing number of domains on proteins that can bind to lipids underscores the importance of protein lipid interactions (Lemmon, 2003). 2 Figure 1.1 lipid classes and representatives a Fatty Acyls b Glycerolipids c Glycerophospholipids d Sterol lipids e Sphingolipids 3 Figure 1.2 Phosphatidic acid and classes of Phospholipids Phosphatidic acid Phosphatidylcholine Phosphatidylethanolamine Phosphatidylserine Phosphatidylglycerol Phosphatidylinositol 1.2 Techniques used to study lipids Several experimental approaches to study lipids exist. Thin Layer Chromatography (TLC) is the most established chromatographic method using various solvent systems to separate out lipids. The advantage of this technique is that it is well established and relatively easy to carry out. The major disadvantages are that it requires a lot of sample and it cannot separate out lipids belonging to the same class. High Performance Liquid Chromatography (HPLC) is another chromatographic technique that is well established to study lipids. This technique is amenable to automation and is more sensitive than TLC. A third major chromatographic technique is Gas chromatography (GC) which is particularly suitable for the determination of Fatty acid composition. GC requires the derivatization of lipids, which needs additional sample processing prior to analysis (Pulfer and Murphy, 2003). 4 Another possible method is Nuclear Magnetic Resonance (NMR), which is employed using radioactive Phosphorous and Hydrogen. NMR allows for direct measurement of lipids in a non destructive manner. Disadvantages include low sensitivity and the spectra being dominated by abundant ions (Gawriach et al., 2002). Various biochemical approaches such as the use of lipid assays, lipid antibodies are employed to study these molecules. In addition imaging using fluorescent lipids allows for the study of some phospholipids and sterols. The adaptation of mass spectrometry to the study of lipids has helped overcome some of the difficulties encountered in above mentioned techniques used in lipids. 1.3 Mass spectrometry and lipidomics Mass spectrometry involves the ionization of molecules followed by the determination of their mass to charge (m/z) ratio. The representation of the mass to charge ratio (m/z) on the X-axis and the relative intensities of the various ions on the Y axis is termed a mass spectrum. Mass spectrometry of lipids was revolutionized with the development of soft ionization methods of Electro Spray Ionization (ESI) and Matrix Assisted Laser Desorption and Ionization (MALDI). These techniques allow for the direct, quantitative and sensitive analysis of lipids (Kim HY et al., 1994; Kerwin JL et al., 1994; Brugger B et al., 1997). The major disadvantage of mass spectrometry is the suppression of ionization, which affects ions that are present in lower abundance. Even this disadvantage can be offset by the use of LC/MS which separates out different classes of lipids prior to mass spectrometry. The use of mass spectrometry and other techniques to study these molecules at systems levels has led to the development of a new field called lipidomics. 5 Techniques such as mass spectrometry, chromatography, NMR and biochemical approaches such as lipid antibodies are used in lipidomics experiments. The resolution and sensitivity of a mass spectrometer make it particularly suitable for lipidomics (Kitano, 2002; Wenk, 2005). The general experimental approach in lipidomics is to extract lipids from the system under study and obtain a lipid profile (Figure 1.3). A lipid profile refers to the composition and relative amounts of the various lipids. The lipid profile for a test condition is then compared to a reference condition, which could yield valuable clues about the system under study. Crude lipid extracts can be directly used, which allows for a higher throughput. Addition of internal standards can provide for semi quantitative data (Welti et al., 2004). The amount of sample required to obtain a lipid profile using Mass spectrometry is also minimal. For example the profiling of Phospholipids in Erythrocyte membranes required as little as 1µL of blood (Han et al., 1994). Figure 1.3 A typical lipidomics Experiment Biological material (cells, tissues) Homogenization + Organic solvent extraction lipid extracts Mass spectrometry Positive-ion mode ESI/MS Acylcarnitine species Negative-ion mode ESI/MS Anionic lipid species 6 1.4 Glycerophospholipids profiling Glycerophospholipids perform a wide array of biological functions in the cell. They constitute a significant portion of the plasma membrane, are involved in proteinlipid interactions, function as signaling molecules regulating many cellular processes such as membrane trafficking, cell growth and cytoskeletal rearrangements (Carman and Henry, 1999; Dowhan, 1997; Odorizzi et al., 2000). Considering their multi functional roles in the cells, a deeper understanding of glycerophospholipids would enable a better understanding of cellular mechanisms. Glycerophospholipid profiling involves the extraction of these molecules preferentially. This can be carried out using acid phase extraction. glycerophospholipid Comparison profiles can of provide mutant clues profiles on to genes wild involved type in glycerophospholipid metabolism and regulation. 1.4.1 Selection of candidate ORFs for glycerophospholipid profiling The yeast genome has 6604 ORFs broadly categorized as verified, uncharacterized and hypothetical. For the functionally verified ORFs, in addition to their annotated functions other function may exist. The yeast genome has 6604 ORFs, of which 4538 have been annotated. The remainder falls under the category of uncharacterized as well as dubious. A comprehensive lipid profiling of the yeast would require profiling of all viable gene deletion mutants for all lipid classes. Such a comprehensive effort would require a large scale initiative. A representative lipid profiling of the yeast would require the selection of candidate ORFs to be profiled. In order to account for the possibility that annotated genes may have unknown functions, a random selection of ORFs is required. An additional set of genes or gene functions to be screened may be selected based on the 7 presence of domains known to be involved in lipid metabolism. The domains that can be chosen include those that are involved in lipid binding and domains involved in lipid metabolism (Table 1) Table 1. Lipid binding domains DOMAIN FUNCTION C1 ZINC FINGER DOMAINS Bind to diacylglycerol. C2 DOMAINS Calcium dependent phospholipid binding domains Pleckstrin Homology(PH) domain Bind to phosphoinositols PX Phosphoinositide binding FERM Phospholipid binding FYVE PI(3)P BAR Bind non-specifically to the membrane ENTH/ANTH Phosphoinositide binding 1.5 Yeast as a model organism to study lipids Yeast is a powerful model organism to study lipids. Advantages of working with yeast include the fast growth rate, ease of manipulation and high degree of similarity to eukaryotic cellular structure (Botstein D et al., 1988). In addition, the sequencing of the complete yeast genome is a valuable resource (Goffeau A et al., 1996; Oliver, 1997). The complete sequencing of the yeast genome has also shown that a significant homology exists between mammalian and yeast genomes (Botstein D et al., 1996). The synthesis of yeast lipids in distinct intracellular components, as in higher eukaryotes allows for the study of intracellular lipid regulation and transport. The lipid classes present in yeast are as same as those present in other eukaryotes, 8 however there are certain differences. For example, the synthesis of phosphatidyl Serine involves an alternate pathway with a CDP-DAG intermediate which is not found in other eukaryotes. Yeast has Ergosterol whereas other eukaryotes have Cholesterol. Yeast sphingolipids have an inositol moiety, not found in the spingolipids of mammals (Daum et al., 1999). A systematic profiling of selected yeast strains with suspected defects in lipid metabolism has been carried out using TLC as a primary analytical technique (Daum et al., 1999; Oliver, 1996). The suitability of yeast for mass spectrometry based profiling approach has been established by the development of methods to study Phospholipids and Sphingolipids in yeast (Guan et al., 2006). The presence of a completely sequenced genome and well characterized methods allow for the phospholipid analysis offering an opportunity to discover genes involved in their metabolism and/or regulation. One primary requirement for such a study is a collection of gene deletion mutants. Several functional analyses initiatives have created yeast single deletion libraries, providing a valuable resource for gene function discovery. One such gene deletion library collection in Saccharomyces has been created by EUROFAN (European Functional Analysis Network) (Oliver, 1997; Oliver et al., 1998). The presence of these resources allows for a reverse genetics approach to identify gene function. 9 1.6 Objectives of the study The objective of this study was to use glycerophospholipid profiling to discover gene functions involved in Phospholipid metabolism or regulation. ORFs were profiled in both a random and domain based manner to identify candidate genes involved in metabolism or regulation of glycerophospholipids. Additionally the project aims to serve as a pilot scale profiling project that can be scaled up for the subsequent analysis of the entire genome. Towards this goal, strategies to reduce the time consuming process of lipid profiling were explored. 10 2 MATERIALS AND METHODS 2.1 Strains Saccharomyces cerevisiae The haploid wild-type strain BY4741 (MATa; his3∆1; leu2∆0; met15∆0; ura3∆0) was used as the reference wild-type strain. All single ORF deletion strains derived from the wild-type strain were obtained from the EUROSCARF collection and were generated by PCR based gene targeting (Wach, 1997). The ORFs for analysis were chosen both randomly as well as on the basis of presence of domains involved in Phospholipid metabolism and recognition. The list of strains used is displayed in Table 2. Table 2: Yeast gene-deletion strains used in the random screen ORF DESCRIPTION YOR303W Small subunit of carbamoyl phosphate synthetase YPL004C Primary component of eisosomes YMR169C Cytoplasmic aldehyde dehydrogenase YDR444W Hypothetical protein YML009C Mitochondrial ribosomal protein of the large subunit YML010C-B Hypothetical protein YMR174C Cytoplasmic proteinase A inhibitor YDR417C Hypothetical protein YPL078C Subunit b of the stator stalk of mitochondrial F1F0 ATP synthase YML021C Uracil-DNA glycosylase YML081C-A Subunit of the mitochondrial F1F0 ATP synthase Y05581 Wild type strain YBR299W Maltase (alpha-glucosidase) YDR242W Putative amidase YDR326C Protein involved in programmed cell death YDR461W Mating pheromone a-factor 11 ORF DESCRIPTION YDR512C Protein of unknown function, involved in transcriptional induction and sporulation YDR515W RNA binding protein YER089C Type 2C protein phosphatase YJR055W Protein of unknown function, required for growth at high temperature YKR106W Protein of unconfirmed function YMR322C Possible chaperone and cysteine protease YDR500C Protein component of the large (60S) ribosomal subunit YDR502C S-adenosylmethionine synthetase YFL001W Non-essential Trna : pseudouridine synthase YKR106W Protein of unconfirmed function YKL053C-A Mitochondrial intermembrane space cysteine motif protein YDR461W Mating pheromone a-factor Y05581 Wild type strain Y05606 Wild type strain YDR506C Hypothetical protein YLL013C Protein of the mitochondrial outer surface, links the Arp2/3 complex with the mitochore YLL014W Putative protein of unknown function YLL015W ABC type transmembrane transporter of MRP/CFTR family YLL016W Non-essential Ras guanine nucleotide exchange factor (GEF) YNR060W Ferric reductase YNR066C Hypothetical protein YNR061C Hypothetical protein YNR067C Daughter cell-specific secreted protein with similarity to glucanases YER063W Unknown function YIL059C ORF unlikely to code for protein YNL334C Protein of unknown function YNL332W Involved in synthesis of thiamine precusors 12 ORF DESCRIPTION YBR073W DNA dependent ATPase YER031C GTPase of the Ypt/Rab family YER046W Meiosis-specific protein of unknown function YER063W Protein of unknown function YER066W Hypothetical protein YER161C Protein involved in negative regulation of transcription; YER149C protein required for polarized morphogenesis, cell fusion, and low affinity Ca2+ influx YER150W GPI-anchored, serine/threonine rich cell wall protein of unknown function YER151C Ubiquitin-specific protease YER153C Specific translational activator for the COX3 YER154W Mitochondrial inner membrane insertase, YNR059W Putative alpha-1,3-mannosyltransferase YPR093C Protein involved in a putative alcohol-responsive signaling pathway YDL113C Protein required for transport of amino peptidase Table 3. Yeast gene-deletion strains used in a domain based screen ORF DESCRIPTION DOMAIN Histone demethylase FYVE YJR119C Protein containing an Epsin like domain involved ENTH/VHS YJR125C in Clathrin recruitment and traffic FYVE-PHD TYPE YKR023W ORF uncharacterized YDR150W YFR019W YBL085W Protein required for nuclear migration, localizes to the mother cell cortex and the bud tip 1 phosphatidylinositol-3-phosphate 5-kinase Protein implicated in polar growth YHR105W Endosomal protein of unknown function PH DOMAIN LIKE FYVE-PHD Kinase PH domain like PH pleckstrin homology type SH3 PX 13 ORF DESCRIPTION Golgi-localized protein interacts with and YHR108W regulates Arf1p and Arf2p in a GTP-dependent manner in order to facilitate traffic through the late Golgi YHR155W Mitochondrial protein with a potential role in promoting mitochondrial fragmentation during programmed cell death YHR161C Protein involved in clathrin cage assembly YJR073C Phospholipid methyl transferase YNL335W YJR130C DNA Damage Inducible Cystathionine gamma-synthase YJL134W Long chain base 1-phosphate phosphatase YGR157W Phosphatidylethanolamine Methyltransferase YGR157W Phosphatidylethanolamine methyltransferases Mitochondrial glycerol-3-phosphate YIL155C dehydrogenase YHL003C Ceramide synthase component DOMAIN ENTH PH domain like PH pleckstrin like Phosphoinositide binding clathrin adaptor Phospholipid methyl transferase Phosphohydrolase PLP dependant transferase Phosphatase Phosphatidyl ethanolamine Methyltransferase PEMT PTHR11985 Involved in lipid metabolism Diacyl glycerol kinase Sphingosine Kinase Diacyl glycerol kinase Sphingosine Kinase Short chain dehydrogenase Ceramide synthase component Phospholipase PH domain like Sterol desaturase YOR171C Sphingoid long chain base kinase YLR260W Minor Sphingoid long chain kinase YIL124W YKL008C NADPH-dependent 1-acyl dihydroxyacetone phosphate reductase Ceramide synthase component YKR031C Phospholipase D YDR297W Sphinganine C4 hydroxylase YPL057C Probable catalytic subunit of a mannosylinositol phosphorylceramide (MIPC) synthase YDL022W YLR260W NAD-dependent glycerol-3-phosphate dehydrogenase, Minor sphingoid long-chain base kinase YOR171C Sphingoid long-chain base kinase Sphingosine kinase YBR177C acyltransferase that plays a minor role in Hydrolase mannosylinositol phosphorylceramide (MIPC) synthase Dehydrogenase Sphingosine kinase 14 ORF medium-chain fatty acid ethyl ester biosynthesis DESCRIPTION YBR041W Fatty acid transporter Phosphatidylinositol 4,5-bisphosphate 5phosphatase YOR109W Phosphatidylinositol 4,5-bisphosphate 5phosphatase YDL113C Protein required for transport of amino peptidase YBR042C Hypothetical protein YIL002C YDR018C Probable membrane protein YKR046C Protein of unknown function, co purifies with lipid particles Cardiolipin synthase YDL142C DOMAIN Solute carrier family 27 Inositol-5phosphatase Inositol-5phosphatase PX domain Acyltransferase domain Acyltransferase domain Associated with lipid particles CDP-DAG-G-3-Pphosphatidyl transferase Choline kinase SH3 domains YNL169C Choline kinase Involved in establishing cell polarity and morphogenesis Phosphatidyl serine decarboxylase YJR073C Phospholipid methyltransferases Methyl transferase YBR129C Protein of unknown function, overproduction blocks cell cycle arrest in the presence of mating pheromone PH domain like Pleckstrin like YCL034W Protein of unknown function; binds Las17p ENTH/VHS YDR313C RING-type ubiquitin ligase of the endosomal and vacuolar membranes FYVE YDR104C Meiosis-specific protein of unknown function PH YLR133W YBR200W YGR170W Phosphatidylserine decarboxylase YDR284C YBR200W YNL106C YBR177C Diacylglycerol pyrophosphate (DGPP) phosphatase Phosphatidylinositol 4,5-bisphosphate 5phosphatase Acyl-coenzymeA:ethanol O-acyltransferase Phosphatidyl serine decarboxylase Phosphatidyl serine decayboxylase C2 Phosphatase related Inositol 5 Phosphatase Hydrolase 15 YDL161W YDR326C Epsin-like protein involved in endocytosis Protein involved in programmed cell death YKR106W Protein of unconfirmed function. 2.2 ENTH/VHS domain Shares domains with many proteins having a PH domain Shares domains with many proteins involved in Phosphate group transfer Plasmids The plasmid vector used in this study was a E. coli / Saccharomyces cerevisiae shuttle vector YCplac111. This vector has a Leucine prototrophy and an Ampicillin resistance as selection markers (Figure 2.1). Fig 2.1 Plasmid map of YCplac111 16 2.3 Growth media and buffers All media were heat sterilized at 121° C for 20 min under pressure of 120 Pa. For solid media 20g/L of agarose was used. In the case of heat sensitive compounds, filter sterilization was employed. The media used and their composition are as listed below. 2.3.1 Y e a s t c u l t u r e m e d i a YPD (yeast extract, peptone, dextrose). All media components were obtained - from Becton Dickinson and company. Composition of YPD is shown in Table 4. Table 4 : YPD composition - 1% Yeast extract 10g/L 2% Peptone 20g/L 2% Dextrose 20g/L Composition of the minimal media was as follows: Table 5 : Minimal Media Composition Yeast Nitrogen base Glucose Threonine 7 g/L 10g/L 0.2g/L Isoleucine Lysine Arginine Valine 0.03g/L 0.03g/L 0.02g/L 0.015g/L Methionine Phenylalanine Adenine Uracil 0.02g/L 0.05g/L 0.02g/L 0.02g/L Leucine Tryptophan 0.1g/L 0.02g/L 17 2.3.2 Bacterial culture media - Luria-Bertani (LB) media. Table 6 : LB Composition - 1% Bacto Tryptone 10g/L 0.5%Yeast extract 5g/L 1% NaCl 10g/L LB media with Ampicillin (LBA) Table 7 : LBA composition 1% Bacto Tryptone 10g/L 0.5%Yeast extract 5g/L 1% NaCl 10g/L 0.01% Ampicilin 100mg/L 2.3.3 Buffers - LYSIS BUFFER Table 8 : Lysis Buffer Composition Triton X-100 2% Sodium Dodecyl Sulphate(SDS) 1% Sodium Chloride 100mM Tris-cloride (pH 8) 10mM EDTA 1mM 18 - Tris-EDTA (pH 8.0) Table 9 : Tris-EDTA composition Tris-Chloride 10mM EDTA 1mM 2.3.4 Growth conditions All strains were grown from frozen glycerol stock maintained at -70 o C. The frozen stock was plated onto YPD-agar plates and incubated at 30 o C. Individual colonies were inoculated into 5ml cultures and incubated at 300rpm overnight. This culture was used as the starting innoculum for subsequent culture. All strains for analysis were grown in a total volume of 12 ml using 50 ml falcon tubes. The cells were grown to an O.D of 0.8-0.9 and harvested at 3500 rpm for 5 min. The cells were washed in 1ml of Milli-Q water and transferred to a 2ml eppendorf tube. The cells were then spun down at 13000rpm and the supernatant discarded. The yeast pellets were stored at - 80º C. 2.4 Glycerophospholipid extraction To achieve complete cell lysis, two successive approaches were adopted. First the cells were digested with the enzyme Lyticase (Sigma). The cell pellet was suspended in 100 µL of Lyticase. This was followed by incubation for 30 min at 37o C and refreezing at -80o C for 30 min. Again the cells were incubated at 37o C for 30 min. This method of thawing and freezing helps to break the yeast cell wall. This was followed by the addition of 100 microlitre equivalents of glass beads and vortexed several times in 30 sec bursts followed by incubation in ice for 30 sec. At this stage, 2 micro gram equivalents of the internal standard DMPA was added. The internal standard helps to ensure consistency in lipid extraction and also allows for semi quantitative data to be obtained. To extract lipids organic solvents were 19 employed; 500 µL of Chlorofom : Methanol (1:1) mix was added and vortexed for 30 sec followed by incubation for 30 sec. This step was followed by the addition of 400 µL of Chloroform and 300 µL of 1M HCL and vortexed for 30 sec. The extraction of lipids at acid phase helps in the enhanced extraction of acidic Phospholipids. The eppendorf tube was then spun at 8500 rpm for 5 min. This results in the separation of aqueous and organic phases. A volume of 300 µL of organic phase was removed and transferred to a new tube. The organic phase was then dried using a Speedvac. The dried lipid film was reconstituted in 400 µL of Chloroform : Methanol (1:1). A five fold dilution using Chloroform : Methanol (1:1) was carried out prior to mass spectrometric analysis. 2.5 Analysis of lipids 2.5.1 Mass Spectrometry of lipid extracts The samples were ionized using ESI in a Q-Tof micro (Waters Corp., Milford, MA) in the negative ion mode. The parameters of the Mass spectrometer are shown in Table 10. The HPLC (High Performance Liquid Chromatography) system comprised of Waters CapLC autosampler and a Waters CapLC pump. The mobile phase was Chloroform : Methanol (1:1) at a flow rate of 15 µL. A total volume of 2 µL of sample was introduced into the mass spectrometer for lipid profiling. Table 10 : Mass Spectrometer Parameters Capillary Voltage 3000V Sample cone voltage Source Temperature Desolvation temperature Desolvation gas flow rate 50V 80°C 250°C 400 L/hr Sample cone gas flow rate Mass acquisition range Acquisition time 50 L/hr 400-1200m/z 3 minutes 20 2.5.2 Tandem mass spectrometry Tandem mass spectrometry was performed on a Waters Micro mass Q-Tof micro (Waters Corp., Milford, MA). The sample was infused using an inbuilt syringe pump at a flow rate of 10 µl per minute. A collision voltage of between 25 – 80 eV was employed to fragment the parent ions. The fragment ions were used for structure elucidation. 2.5.3 Precursor ion scan mass spectrometry Precursor ion scan mass spectrometry can be used to quantitatively measure ions when used with requisite internal standards (Ekroos et al., 2002). For analysis of phospholipids, precursor scans of ions at m/z 241 (negative mode), 196 (negative mode), 184 (positive mode) were used for phosphoinositols, phosphoethanolamines and phosphocholines respectively. The mass spectrometer used was an Agilent 1100 high-performance liquid chromatography (HPLC) system and a 4000 Q-Trap mass spectrometer (Applied Biosystems, Foster City, CA). An injection volume of 15-30 µL of samples was introduced into the mass spectrometer for precursor scan. HPLC auto sampler was used to pick up the samples and to carry samples directly into mass spectrometer without via a column. Mobile phase was chloroform: methanol (1:1) at a flow rate of 0.25 mL min-1. 2.5.4 TAG measu rement using mass sp ectrometry Measurement of TAG was performed using an Agilent 1100 high-performance liquid chromatography (HPLC) system and a 4000 Q-Trap mass spectrometer (Applied Biosystems, Foster City, CA). The HPLC system is made up of an Agilent 21 1100 binary pump, an Agilent 1100 thermo sampler and an Agilent 1100 column oven. A sensitive in-house method was developed using an Agilent Zorbax Eclipse XDB-C18 column (Shui G. et al., in preparation). The HPLC conditions are (1) chloroform: methanol: 0.1M Ammonium Acetate (100:100:4) as mobile phase at a flow rate of 0.25 mL. min-1; (2) column temperature: 25°C; (3) injection volume: 20 µL. Mass spectrometry was recorded under both positive and negative ESI modes with EMS scan type, and ESI conditions are: Turbo Spray source voltage, 5000 and 4500 volts for positive and negative, respectively; source temperature, 250 °C; scan rate:1000 amu/s; GS1: 30.00, GS2: 30.00, curtain gas: 25; DP 30.00 volts; scan range, 300-1100 da. Dried extracts were resuspended in HPLC mobile phase. A total run time of 30 min was utilized to elute both polar lipids and non-polar TAGs from the column, and the elution period of TAGs were averaged for comparison of TAG profiles 2.5.5 Computational Analyses of Mass Spectral Data Mass spectrometric data was acquired using MasLynx 4.0 software (Waters Corp., Milford, MA). The text files were processed using a program developed within the lab (Huey et al., manuscript in preparation). The first step is to align the spectra to each other and this is done using a method called Co-relation optimized warping (COW) (Nielsen et al., 1998). COW uses the principle of warping (piecewise linear stretching and compression) the time axis of one of the profiles using the other profile as the reference. One of the replicate spectra from the control condition is chosen as the reference to which the other spectra are warped. The same is done for the test condition. A comparison of the warped average replicates is then carried out. The difference in the profiles is expressed as a logarithmic ratio. The statistical relevance 22 of the data was taken into account by using three replicates per sample and accounting for inter replicate differences. 2.6 Subcloning YBR042C and transformation into ybr042c deletion mutant 2.6.1 Genomic DNA Isolation A 5 mL culture was centrifuged at 4000 rpm for 5 min. The supernatant was discarded and resuspended in 1 mL of sterile water and transferred to a microfuge tube. The tube was centrifuged at 6000 rpm and the supernatant discarded. Two hundred µL of Lysis buffer was added to the pellet followed by 200 µL of Phenol : Chloroform (1:1) mix. The mixture was vortexed in the presence of Glass beads for 3 – 4 min. Then, 200 µL of TE buffer was added and spun for 5 min at 13,000 rpm. The aqueous layer was transferred to a new tube and 1 mL of 100% Ethanol was added and mixed by inversion. The tubes were incubated at – 80o C for an hour. The incubated tubes were then centrifuged at full speed for 5 min. The supernatant was removed and the pellet resuspended in 70% Ethanol. After incubation at - 80oC and centrifugation, the supernatant was discarded. The residual after drying, was resuspended in 50 µL of sterile water. The plasmid YCplac111-scGFP was used in the construction of a GFP tagged YBR042C. The plasmid was amplified using primers carrying requisite restriction enzyme sites for BamH1 and HindIII. Two different restriction sites were set up to ensure directional cloning. 23 PCR amplification of the YBR042C gene was done using primers with an overhang containing recognition sites for BamH1 and HindIII (Fig 2.2) 5` Hind III YBR042C Bam H1 PCR Hind III 3` YBR042C Bam H1 Figure 2.2 The gene of interest YBR042C is amplified with primers carrying restriction enzyme sites HindIII and BamH1 The primers used are shown in Table 11 Table 11 : Oligo nucleotide primer sequences Primer Sequence Source YBRGFP5 5’ GCGAAGCTTGCCCTCTTTGGATATGCAG PROLIGO YBRGFP3 5’GCGGGATCCAAAAATAAAACAATAAAGTT PROLIGO 2.6.2 Restriction digestion of PCR product and vector The PCR product and the vector YCplac111 were double digested with Hind III and BamH I (Promega, USA). The reaction mix composition was as described in Table 12. The reaction mix employed was the same for the plasmid and insert. Table 12 : Reaction mix composition Components DNA Buffer 10X Bovine Serum Albumin BamH I (10u /1 µL) Hind III(10u/1 µL) Autoclaved milli-Q water Volume 18 µL 3 µL 3 µL 1 µL 1 µL 4 µL 24 2.6.3. Ligation of vector and insert A vector : insert ratio of 7:1 was used in ligation reaction as shown in Table 13. The reaction mixture was incubated at 16°C overnight. Table 13. Ligation reaction mix composition 2.6.4. Component Final concentration Vector 14 µL Insert 7 µL 10X Buffer 2 µL T4 DNA ligase ( Promega , USA) (10u/1 µL) Autoclaved milli-Q water 1 µL 1 µL Transformation of Bacterial Cells Ligated products were transformed into E. coli. For each transformation, 10 µL of ligated product was added to DH5α competent cells (Invitrogen, USA). The cells were mixed gently and incubated on ice for 30 min. Following which the cells were heat shocked at 37° C for 20 sec and incubated on ice for 2 min. About 200 µL of LB media was added and the transformation mix was incubated at 37°C for 1 hour. A volume of 200 µL of transformation mix was plated on LBA plates and incubated at 37° C overnight to select for ampicillin resistant colonies. 2.6.5 Analysis of isolated plasmids Plasmid DNA was isolated from 5ml overnight cultures using the QIA miniprep kit (Qiagen, USA). The isolated plasmids were analysed by restriction mapping to determine whether the correct insert was present. The restriction digestion product was run on a 1% agarose gel along with a molecular marker to determine the correct plasmid. 25 2.6.6 Preparation of competent yeast cells The yeast strain of interest was incubated overnight in 5 ml of YPD medium. From the overnight culture, 400 µL was inoculated into 100 mL YPD broth and incubated at 30o C/ 200 rpm. The culture was incubated till an OD of ~0.4 was reached. The culture was harvested in a sterile 50 mL centrifuge tubes at 5000 rpm for 5 minutes. The cell pellet was resuspended in 25 mL of sterile water. The tubes were centrifuged again at 5000 rpm for 5 minutes and the supernatant poured off. The pellet was resuspended in 1 mL of 100 mM Lithium acetate and transferred to a 1.5 mL microfuge tube. The cells were pelleted down at 8000 rpm for 15 sec and supernatant discarded. The cells were resuspended in 400 µL of 100 mM LiAc and vortexed gently. The cells were kept on ice, in preparation for transformation. 2.6.7 Transformation of yeast cells A Transformation mix was prepared as follows. Table 14: Transformation mix composition Competent cells 50 ml Lithium Acetate 36 µL Polyethylene Glycol 240 µL ss-DNA 50 µL (heat shock 95o C/5 min) Sterile water 32 µL Plasmid DNA 2 µL The transformation mix was vortexed until it was homogenized and incubated in ice for 30 min. The cells were then heat shocked at 42o C for 30 min. The cells were then spun down and supernatant removed. A volume of 100 µL of sterile water was added and resuspended gently. This mixture was then plated onto medium lacking Histidine and kept for incubation at 30o C. 26 2.6.8 Fluorescent imaging of yeast cells Fluorescence imaging was performed on a Leica DMLB microscope (Wetzlar, Germany) with a Curtis 100 fluorescent lamp. GFP signal was visualized with a 470/40-nm bandpass excitation filter, a 500-nm dichromatic mirror, and a 525/50-nm bandpass emission filter (Leica filter cube GFP). As for the observation of Nile red fluorescence, the same UV-filter set was used. Images were processed with a Leica FW4000 software. 2.7. Generation of double knockouts of SLC1 and YBR042C The generation of a double knockout was based on the replacement of the gene of interest with a selectable marker gene. The single knockout mutant, ybr042c was chosen as the reference strain to delete SLC1. The marker gene chosen was HIS3 (Fig 2.3) (a) Chromosomal segment slc1 (c) Gene disruption cassette his (a) Disrupted chromosomal segment his (b) Figure 2.3 : PCR based gene targeting to knockout slc1 in a YBR042C deletion background 27 The his3 fragment was amplified along with slc1 flanking sequences, using the following primers (Table 15) and PCR reaction mix (Table 16) and conditions (Table 17). Table 15 Primers used for amplification of his3 template DNA Primers Sequence Source SLCK5 5’ ATAGAGAAGTTTAGTGGTTTCCCTCCGTCAGT PROLIGO GAATTCGAGCAAAAAAATACGTACGCTGCAG GTCGAC SLCK3 5’ GATAAATTACAGTTTTTGGGTCTATATACTAC PROLIGO TCTAAAAATGCGGTGGCATGAATTCGAGCTC G Table 16 : PCR Reaction mix Components Volume His3 –template DNA 1 µL SLCK5 1 µL SLCK3 1 µL dNTP (2mM) 1 µL Buffer (10X) 5 µL Taq-DNA polymerase ( Promega , USA) 5 µL Milli-Q water 36 µL 28 Table 17: PCR reaction conditions Temperature(oC) Time (Mins) Cycles Initial Denaturation 95 5 1 Denaturation 95 2 30 Annealing 60 0.5 30 Extension 72 5 30 Final extension 72 5 1 Step The PCR product was fractionalised on a 1% Agarose gel and visualized using Ethidium bromide. The requisite PCR fragments were purified using a Gel Purification kit (Amersham Biosciences kit). The purified PCR product was transformed into competent ∆ybr042c cells and plated out onto media lacking Histidine. Positive colonies where checked to ensure correct integration. Double knockout was confirmed by PCR analysis and sequencing. 29 3 RESULTS 3.1 Validation of glycerophospholipid profiling - SLC1 deletion strain as a positive control The validation of glycerophospholipid profiling was done using yeast strains deleted for ORFs known to play a role in phospholipid metabolism. An slc1 deletion strain was used to demonstrate the applicability of glycerophospholipid profiling to identify gene functions. SLC1 encodes a 1-acyl-sn-glycerol-3-phosphate acyl transferase (AGAT), which catalyzes the formation of phosphatidic acid from the intermediate lysophosphatidic acid (Athenstaedt and Daum, 1997). Phosphatidic acid is a key intermediate precursor for all glycerophospholipids (Minskoff et al., 1994). Deletion of this slc1 resulted in an altered lipid profile. An alteration was considered significant when the difference in profile expressed in logarithmic ration was greater than 0.4. The lipid profile of ∆slc1 when compared to that of the wild-type strain revealed changes in the level of several Phospholipids. Tandem mass spectrometry analysis identified these peaks as Phosphoinositols. The changes observed include a relative inversion in the ratio of the m/z peaks 807 (GPIns (32:1)) and 835 (GPIns (34:1)). In addition there was a decrease in peaks with m/z values of 725 (GPIns (26:0)), 753 (GPIns (28:0)) and 781 (GPIns (30:1)). The largest change seen in the m/z peak was about 10 fold change. The results are represented in Figure 3.1. 30 x 10-3 4.5 807 835 4 A 3.5 Intensity 3 714 2.5 2 1.5 686 753 1 427 479 0.5 0 400 500 600 863 780 571 598 952 700 800 900 1000 1100 1200 m/z x 10-3 7 807 6 B 5 Intensity 4 835 3 714 686 2 1 780 571 427 479 753 863 598 952 0 400 500 600 700 800 m/z 900 1000 1100 1200 900 1000 1100 1200 1.5 C 1.0 0.5 0 -0.5 427 781 545 -1 725 -1.5 400 753 500 600 700 800 m/z Figure 3.1. Phospholipid profile of a slc1 deletion mutant. Panels A and B show the normalized lipid profile for the wild type and ∆slc1. A normalized lipid profile is obtained as the mean of three single stage mass spectrums. The comparative profile expressed as a logarithmic ratio (C), shows the differences in ∆slc1. ∆slc1 codes for an acyl transferase gene involved in lipid metabolism. 31 3.2 TANDEM MASS SPECTROMETRIC IDENTIFICATION OF LIPID SPECIES The identification of lipid species as carried out through Tandem mass spectrometry (MS-MS). After fragmentation, the presence of ions of specific m/z value provides a clue as to the composition of the parent ion. The list of fragment ions and their representations are shown in Table 18. A representative example of an ion with m/z value is shown in Fig. 3.2. Table 18. Mass-to-charge ratios of some characteristic fragment ions ION (m/z value) 97 153 241 253 255 259 281 IDENTIFICATION Phosphate group Glycerophosphate head group Inositol phosphate water Fatty acid (16:1) Fatty acid (16:0) Inositol phosphate Fatty acid (18:1) O O 0.014 16:0 281 0.012 O O 241 18:1 H2 C O Relative Intensity 835 O 0.010 O P CH O CH 2 O O 0.008 HO OH OH 34:1 PI OH 0.006 153 223 0.004 391 553 297 0.002 0 100 200 300 400 m/z 500 600 700 800 900 Figure 3.2 Tandem Mass Spectrometric (MS-MS) identification of lipid species with m/z value 835. On the basis of theoretically calculated values and the presence of characteristic ions such as 153 and 241, the species is identified. The two fatty acids present are C 16:0 and C18:1. The presence of an ion of m/z value 153 allows its identification as a glycerophosphate head group. 32 3.3 LIPID PROFILING OF GENE DELETION MUTANTS IN YEAST The lipid profiles were obtained for a set of yeast gene-deletion strains selected in a random and domain based manner. Figure 3.4 represents an example of lipid profiling. The mass spectra of all other strains are included in the appendix. The profile for both wild type and mutant strain are the normalized average values of three replicates each. The logarithmic ratio represents the difference in the two profiles expressed in log 10 scales. A two fold change would be expressed as 0.3 on the logarithmic scale. Changes observed are also manually curated so as to ensure the change observed is not due to an instrumentation or program error. Differences observed due to either of the above error sources were not taken into account. 3.3.1 lipid profiling of Yeast strains The results of the differential lipid profiles of ORFs selected randomly are shown in Table 19. The major changes observed are shown. From this Table it can be seen that considerable changes in lipid profiles were observed in strains deleted for ORFs not related to lipids metabolism. 33 8 A x 10-3 835 7 Intensity 6 804 5 4 714 3 2 1 569 596 686 479 0 400 500 8 x 10-3 600 700 864 800 900 1000 1100 1200 m/z 835 7 B 6 804 Intensity 5 4 714 3 2 569 596 686 1 863 479 0 400 C 500 600 700 800 900 m/z 1000 1100 1200 0.4 0.3 0.2 0.1 0 -0.1 -0.2 -0.3 596 -0.4 -0.5 400 569 500 600 700 800 900 1000 1100 1200 m/z Figure 3.3 Representative example of a comparative Phospholipid profiling strategy for single gene deletion mutants. The normalized profile, obtained by averaging three independent normalized mass spectra is shown for both wild type (A) and the mutant YDR444W (B). The differences in profile expressed as a logarithmic ratio is shown in panel C. A change above 0.3 in the logarithmic scale is considered significant. 34 Table 19. Lipid profiling results for Gene-deletion strains selected randomly Deleted ORF Description Major Differences Observed In Logarithmic Ratio YOR303W Small subunit of carbamoyl phosphate synthetase None YPL004C Primary component of eisosomes None YMR169C Cytoplasmic aldehyde dehydrogenase None YDR444W Hypothetical protein None YML009C Mitochondrial ribosomal protein of the large None subunit YML010C-B Hypothetical protein None YMR174C Cytoplasmic proteinase A inhibitor None YDR417C Hypothetical protein None YPL078C Subunit b of the stator stalk of mitochondrial None F1F0 ATP synthase YML021C Uracil-DNA glycosylase None YML081C-A Subunit of the mitochondrial F1F0 ATP synthase None None Y05581 YBR299W Maltase (alpha-glucosidase) YDR242W Putative amidase A change of 0.46 for m/z value 686 A change of 0.44 for m/z value 714 None YDR326C Protein involved in programmed cell death None YDR461W Mating pheromone a-factor YDR512C YDR515W Protein of unknown function, involved in transcriptional induction and sporulation RNA binding protein A change 0.6 for m/z value 646 None YER089C Type 2C protein phosphatase None YJR055W None YKR106W Protein of unknown function, required for growth at high temperature Protein of unconfirmed function YMR322C Possible chaperone and cysteine protease A 0.55 change for m/z value 805 A 0.49 change for m/z value 659 A 0.44 change for m/z value 631 None None 35 Description ORF YDR500C Protein component of the large (60S) ribosomal Significant Differences Observed In Logarithmic Ratio None subunit YDR502C S-adenosylmethionine synthetase None YFL001W Non-essential tRNA:pseudouridine synthase None YKR106W Protein of unconfirmed function None YKL053C-A Mitochondrial intermembrane space cysteine None motif protein YDR461W Mating pheromone a-factor None Y05581 None Y05606 None YDR506C Hypothetical protein None YLL013C None YLL014W Protein of the mitochondrial outer surface, links the Arp2/3 complex with the mitochore Putative protein of unknown function YLL015W ABC type transmembrane transporter of None None MRP/CFTR family YLL016W Non-essential Ras guanine nucleotide exchange None factor (GEF) YNR060W Ferric reductase None YNR066C Hypothetical protein None YNR061C Hypothetical protein None YNR067C Daughter cell-specific secreted protein with None similarity to glucanases YER063W Unknown function None YIL059C ORF unlikely to code for protein None YNL334C Protein of unknown function YNL332W Involved in synthesis of thiamine precusors None YBR073W DNA dependent ATPase None YER031C GTPase of the Ypt/Rab family A change of 0.8 for m/z value 671 36 ORF Description YER046W Meiosis-specific protein of unknown function Significant Differences Observed In Logarithmic Ratio None YER063W Protein of unknown function None YER066W Hypothetical protein None YER161C Protein involved in negative regulation of None transcription; YER149C YER150W YER151C protein required for polarized morphogenesis, cell A change of 0.8 fusion, and low affinity Ca2+ influx for m/z value 720 GPI-anchored, serine/threonine rich cell wall A change of 0.75 protein of unknown function for m/z value 746 Ubiquitin-specific protease A change of 0.75 for m/z value 643.5 YER153C Specific translational activator for the COX3 None YER154W Mitochondrial inner membrane insertase None YNR059W Putative alpha-1,3-mannosyltransferase None YPR093C Protein involved in a putative alcohol-responsive None signaling pathway YDL113C Protein required for transport of amino peptidase None 3.3.2 Lipid profiling of strains selected in a domain based manner The results of strains screened on the basis of specific protein domains are presented in Table 20. The largest change was observed for an acyltransferase domain containing protein encoded by the ORF, YBR042C. 37 Table 20. Lipid profiling results for ORFs selected in a domain based manner ORF YJR119C YJR125C YKR023W YDR150W YFR019W YBL085W YHR105W YHR108W YHR155W YHR161C YNL335W YJR130C YJL134W YGR157W YGR157W Description Domain Significant Differences Observed In Logarithmic Ratio Histone demethylase Protein containing an Epsin like domain involved in Clathrin recruitment and traffic ORF uncharacterized FYVE ENTH/VHS None None FYVE-PHD TYPE None Protein required for nuclear migration, localizes to the mother cell cortex and the bud tip 1phosphatidylinositol-3phosphate 5-kinase Protein implicated in polar growth PH DOMAIN LIKE None FYVE-PHD Kinase PH domain like PH pleckstrin homology type SH3 PX None ENTH None PH domain like PH pleckstrin like None Phosphoinositide binding clathrin adaptor Phosphohydrolase PLP dependant transferase Phosphatase None Phosphatidyl ethanolamine Methyltransferase PEMT None Endosomal protein of unknown function Golgi-localized protein interacts with and regulates Arf1p and Arf2p in a GTPdependent manner in order to facilitate traffic through the late Golgi Mitochondrial protein with a potential role in promoting mitochondrial fragmentation during programmed cell death Protein involved in clathrin cage assembly DNA Damage Inducible Cystathionine gammasynthase Long chain base 1-phosphate phosphatase Phosphatidylethanolamine Methyltransferase Phosphatidylethanolamine methyltransferases None None None None None None 38 ORF Description Domain Significant Differences Observed In Logarithmic Ratio Phospholipid methyl transferase 0.84 change for m/z value 729 0.8 change for m/z value 701 None YJR073C Phospholipid methyl transferase YIL155C Mitochondrial glycerol-3PTHR11985 phosphate dehydrogenase Ceramide synthase component Involved in lipid metabolism Sphingoid long chain base Diacyl glycerol kinase kinase Sphingosine Kinase Minor Sphingoid long chain Diacyl glycerol kinase kinase Sphingosine Kinase NADPH-dependent 1-acyl Short chain dihydroxyacetone phosphate dehydrogenase reductase Ceramide synthase component Ceramide synthase component Phospholipase D Phospholipase PH domain like Sphinganine C4 hydroxylase Sterol desaturase YHL003C YOR171C YLR260W YIL124W YKL008C YKR031C YDR297W YPL057C YDL022W YOR171C YBR177C YBR041W YIL002C YOR109W None None None None None None None Probable catalytic subunit of a mannosylinositol phosphorylceramide (MIPC) synthase NAD-dependent glycerol-3phosphate dehydrogenase mannosylinositol phosphorylceramide (MIPC) synthase None Dehydrogenase None Sphingoid long-chain base kinase, acyltransferase that plays a minor role in medium-chain fatty acid ethyl ester biosynthesis Fatty acid transporter Sphingosine kinase None Hydrolase None Solute carrier family 27 Phosphatidylinositol 4,5bisphosphate 5-phosphatase Phosphatidylinositol 4,5bisphosphate 5-phosphatase Inositol-5phosphatase Inositol-5phosphatase 0.62 change for m/z value 564 None None 39 ORF Description Domain Significant Differences Observed In Logarithmic Ratio PX domain None YBR042C Protein required for transport of amino peptidase Hypothetical protein Acyltransferase domain YDR018C Probable membrane protein Acyltransferase domain Change in ratio of m/z values 805 and 835 0.8 change for m/z value 863 None YKR046C Protein of unknown function, co purifies with lipid particles Cardiolipin synthase YDL113C YDL142C YLR133W YBR200W YNL169C YJR073C YBR129C YCL034W YDR313C YDR104C YGR170W YDR284C Choline kinase involved in establishing cell polarity and morphogenesis Phosphatidyl serine decarboxylase Phospholipid methyltransferase Protein of unknown function, overproduction blocks cell cycle arrest in the presence of mating pheromone; Protein of unknown function; binds Las17p RING-type ubiquitin ligase of the endosomal and vacuolar membranes Meiosis-specific protein of unknown function Phosphatidylserine decarboxylase Diacylglycerol pyrophosphate (DGPP) phosphatase, None CDP-DAG-G-3-Pphosphatidyl transferase Choline kinase SH3 domains None Phosphatidyl serine decarboxylase Methyl transferase None PH domain like Pleckstrin like None ENTH/VHS None FYVE None PH None Phosphatidyl serine decayboxylase C2 Phosphatase related None None None None 0.7 change for m/z value 746 0.45 change for m/z value 805 0.45 change for m/z value 835 40 ORF YNL106C YBR177C YDL161W YDR326C YKR106W Description Domain Phosphatidylinositol 4,5bisphosphate 5-phosphatase, Acyl-coenzymeA:ethanol Oacyltransferase Inositol 5 Phosphatase Hydrolase Epsin-like protein involved in endocytosis ENTH/VHS domain Protein involved in programmed cell death Protein of unconfirmed function Shares domains with many proteins having a PH domain Shares domains with many proteins involved in Phosphate group transfer Significant Differences Observed In Logarithmic Ratio None 0.52 change for m/z value 564 None None None 41 3.4 Identification of a putative novel acyltransferase The change in lipid profile observed in ∆YBR042C was considered to be very significant as it resulted in over five-fold reduction in the lipid species with an m/z value 863 (PI 36:1). In addition the relative ratios of the lipid species with an m/z value 805 (32:1) and 835(34:1) showed significant changes. Domain analysis of YBR042c is shown in Figure 3.4. The lipid profile of the mutant strain for YBR042C is shown in Figure 3.5. Figure 3.4. The domain organisation of ybr042c protein shows that it possesses an Acyltransferase domain (Hong L et al., 2007). 42 4.5 x 10-3 807 4 A 835 Intensity 3.5 3 714 2.5 2 1.5 686 753 1 0.5 427 479 0 4 400 500 600 863 780 571 598 952 700 800 900 1000 1100 1200 1000 1100 1200 1000 1100 1200 m/z -3 x 10 807 3.5 B 3 835 Intensity 2.5 714 2 1.5 686 753 1 780 0.5 427 479 571 598 863 ▼ 0 400 500 600 700 800 m/z 900 952 1 C 0.8 0.6 0.4 0.2 0 -0.2 427 545 835 -0.4 -0.6 -0.8 -1 400 864 500 600 700 800 m/z 900 Figure 3.5 Phospholipid profile of a putative acyl transferase mutant (YBR042C). The normalized lipid profile of wild type as compared to the deletion mutant, shows significant changes in the profile (A and B). The representation of this change as a log ratio (C) shows an almost complete absence of a higher molecular weight Phosphatidylinositol (36:1). The red arrow indicates the ion species with change. 43 In order to conclusively show that the changes observed are due to loss of YBR042C function, the gene was sub cloned and reintroduced into an YBR042C mutant strain to verify whether the phenotypic defect was rescued. 3.5 Genetic complementation of YBR042C deletion strain 3.5.1. PCR amplification of YBR042C The ORF YBR042C was sub cloned as described in the methods section 2.10. Figure 3.6 represents the PCR amplification of the ORF YBR042C. 1 2 3 4 5 6 1.4 kb Fig. 3.6 PCR amplification of YBR042C. Lane 1 shows the molecular marker; Lanes 3-6 shows the PCR amplification of YBR042C. 3.5.2 Restriction analysis of selected plasmid The PCR product as well as the plasmid was digested with the restriction enzymes BamH1 and HindIII. Following ligation the product was transformed into E. coli and selected using an Ampicillin marker. Plasmid isolation was carried out from the selected plasmids; restriction digestion was carried out to select the correct colony. Figure 3.7 shows the restriction analysis of the selected plasmid from E. coli colonies. 44 1 2 3 4 5 6 7 8 9 1.4 kb Fig. 3.7 Gel photograph showing the restriction digestion of plasmid isolated from E.coli colonies. Lane 3 represents the correct plasmid as identified by restriction digestion. The other lanes represent the plasmids with incorrect inserts. 45 3.5.3 Fluorescent imaging of transformed YBR042C mutant cells The plasmid carrying GFP tagged YBR042C was transformed into mutant ∆ybr042c yeast cells and selected using Leucine prototrophy. The transformed cells were then viewed using Epifluorescence microscopy. The results show that YBR042C localizes to the lipid droplets (Figure 3.8). A B C D Figure 3.8. Localization of GFP-tagged YBR042C. Panels A and B show YBR042C cells transformed with the empty vector. Panels C and D show the YBR042C mutant cells transformed with GFP-tagged YBR042C. The lipid profile of GFP-YBR042C cells shows a pattern similar to that of the wild-type profile (Figure 3.10). Measurement of lipid levels quantitatively using precursor ion scans showed the levels of the phosphoinositols to increase as compared to the mutant cells (Figure 3.11). 46 3.5.3 Mass spectrometric profile of transformed YBR042C The mass spectrometric profiling of transformed cells was carried out by comparing the raw mass spectrums as well as quantitative measurement of lipid levels using precursor ion scans (Fig 3.9 and Fig 3.10). The profiles show a reversion to the lipid levels found in wild type cells. A ▼ 807 714 Intensity 686 ▼ 835 ▼ m/z 714 835 807 B Intensity 686 863 m/z Figure 3.9. Panel A shows the mass spectrometric profile of a YBR042C mutant. Panel B shows the mass spectrometric profile of a YBR042C mutant transformed with GFP tagged YBR042C. The profile in the transformed cells is seen to return to the wild type profile indicated in the relative ratios of m/z values 807 and 835. The levels of m/z value 863 are also restored. 47 3.5 Relative abundance 3 2.5 2 YBR042C Rescued YBR042C 1.5 1 0.5 0 863 GPIns (36:1) 835 GPIns (34:1) 807 GPIns (32:1) 805 GPIns (32:2) 779 GPIns (30:1) 725 GPIns (26:0) 585 IS LysoPI 16:0 571 Figure 3.10. Quantitative measurement of lipid levels in the rescued mutant. The restoration of lipid profile is verified quantitatively by the increase in the levels of m/z values 805, 807, 835 and 863.IS-Internal standard, PA –Phosphatidic acid. 3.6 Generation of double knockout of YBR042C and SLC1 The ybr042c and SLC1 double mutant was used to determine the functional roles of these two ORFs. Both the proteins localize to the lipid droplets and are predicted to perform the same molecular function. To determine whether the gene products of the two ORFs perform identical or distinct functions a double knockout was generated. The double knockout strain was constructed by deleting SLC1 in a YBR042C background. The gene was deleted by replacement with a his fragment. The double deletion mutant genotype was confirmed by requisite PCR analysis. The results from confirmatory PCR analysis are shown in Figure 3.11. The lipid profile of the double knockout is shown in Figure 3.12. The figure shows that several of the Phosphoinositols are selectively reduced and the overall effect of deleting both the ORFs is additive in nature. The changes in lipid levels observed in individual ∆YBR042C and ∆slc1, are present together in the double knockout. 48 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 ~1KB Fig. 3.11. Gel Photograph showing PCR products to confirm the replacement of SLC1 gene with his fragment. Lanes 6, 9, 13 and 17 represent clones with the his fragment integrated in the correct position. 49 4.5 x 10-3 807 4 A 835 Intensity 3.5 3 714 2.5 2 686 1.5 753 1 0.5 427 479 0 400 500 600 863 780 571 598 952 700 800 900 m/z 1000 1100 1200 1000 1100 1200 1000 1100 1200 -3 4.5 x 10 807 4 3.5 Intensity B 3 2.5 714 686 2 ▼ 835 1.5 ▼ 1 753 571 0.5 0 400 ▼ 500 600 700 800 900 m/z 1.5 C 1.0 0.5 0 -0.5 549 782 835 863 -1 725 -1.5 400 500 600 753 700 m/z 800 900 Figure 3.12 Phospholipid profile of a mutant deleted of both ∆slc1 and YBR042C. The normalized lipid profile of a mutants deleted of both slc1 and YBR042C (B) shows significant differences in lipid profile as compared to the reference wild type (A). The change as represented in a logarithmic ratio (C) reveals that levels of the Phosphoinositols are significantly reduced. 50 3.7 Quantitative measurement of glycerophospholipid levels In order to obtain quantitative data on the lipid levels, precursor ion scanning was carried out for the major lipid species. The most significant changes were seen for the GPIns (36:1) GPIns (34:1) GPIns (32:1) GPIns (30:0) GPIns (28:0) GPIns GPIns GPIns GPIns PA IS PA IS PA PA Relative abundance phosphoinositols (Fig. 3.13). Fig 3.13. Precursor ion scans of the major glycerophospholipid species 51 3.8 Lipid droplet staining and triacylglyceride level measurements The lipid droplets were stained using Nile red and observed using fluorescence microscopy. The lipid droplets showed no characteristic changes when observed for cells grown into the late stationary phase (Figure 3.14). Quantitative measurement of Triacylglyceride levels also showed no significant differences. The synthesis of lipid droplets is completed in the late stationary phase and showed no difference. However, the rate of synthesis of lipid droplets was not measured. Wild type ∆slc1 ∆YBR042C Double Knockout Figure 3.14. Lipid droplets staining. The figure shows the lipid droplets stained by Nile red. Panels A, B, C, D represent the lipid droplets of wild type, SLC1, YBR042C and a double knockout of SLC1 and YBR042C respectively. 52 3.9 Phenotypic changes observed in mutant strains The mutant strain ybr042c and the double knockout mutant of YBR042C and SLC1 are compared to wild type showed a reduction in cell size (Fig 3.14). The reduction in the growth rate of the double knock out mutant was deemed not to be significant. 9 8 7 6 OD 5 4 wt-1 YBR042C Double Knock out Of YBR042C andSLC1 3 2 1 0 1 2 3 4 5 6 7 Time 8 9 10 11 12 13 Fig 3.15. Measurement of OD of wild type, YBR042C and a double deletion mutant of YBR042C and SLC1 53 4 Discussion 4.1. Lipid profile of tester strain The differential profile of SLC1 shows the levels of specific phosphoinositols are altered. SLC1 is involved in the biosynthesis of phosphatidic acid, a key intermediate of glycerophospholipid biosynthesis. SLC1 is an acyltransferase for 16 carbon fatty acids. Deletion of this gene results in the reduction of phosphoinositol species containing 16 carbon fatty acids. Differential profiles of ORFs such as CHO, a gene known to be involved in glycerophospholipid metabolism shows no significant difference, the possible reasons are discussed in section 4.3. 4.2. lipid profile of single gen e deletion mutants Approximately 180 genes or a total of ~4% of all annotated genes are known to be involved in lipid metabolism in Yeast (Hong et al 2007). If a similar proportion of genes is present in the uncharacterized genome, it would account for about 50 genes. Additionally several characterized genes may possess multiple functions. Lipid profiling of mutants in an unbiased manner showed changes in seven mutants. Lipid profiling of strains in a domain based manner showed changes in five ORFs. A domain based profiling can be used in the validation of ORFs suspected to be involved in lipid metabolism, as shown by the identification of YBR042C. However the differences observed in a random and domain based screen are similar, the possibilities for this are explained in section 4.3. 4.3 Reasons for changes observed There are several possible reasons to explain the observations. The absence of change in mutants likely defective in lipid metabolism can be due to genetic redundancy observed in the yeast (De Risi et al., 1997). The choice of media 54 can influence the metabolic pathways that are operational. A nutrient rich media such as YPD may result in certain metabolic pathways being non operational (Harrison et al., 2007). Additionally the method of lipid profiling employed may be unable to measure all changes across all classes. The sensitivity of the method may also be inadequate. Changes in ORFs not suspected to be involved in lipid metabolism may point to a new function or the change may be a secondary effect of gene mutation (Daum et al., 1999). 4.4 YBR042C a putative acyl transferase YBR042C has been annotated as a hypothetical protein of 397 amino acids long. Bioinformatic analysis has predicted that the ORF encodes a protein containing an acyltransferase domain and is expected to be involved in Phosphatidic acid biosynthesis. The biosynthesis of Phosphatidic acid is known to occur through two pathways. In the first pathway Glycerol-3-Phosphate (G-3-P) is acylated to 1-acylGlycerol 3 phosphate by transfer of a Fatty acid Acyl-CoA. The product lysophosphatidic acid is further acylated to form Phosphatidic acid. An alternative pathway uses Dihydroxy acetone, which is acylated to 1-acyl-Dihydroxyacetone phosphate and finally converted to lysophosphatidic acid (Dircks and Sul, 1999). In yeast there is a redundancy in the biosynthesis of phosphatidic acid as both these pathways are present (Athenstaedt and Daum 1997; Athenstaedt et al., 1999, Racenis et al., 1992). The acyltransferase encoded by YBR042C as per domain analysis is believed to be specifically involved in the conversion of Lysophosphatidic acid to phosphatidic acid. The specific large changes in one lipid species suggested that the YBR042C acyltransferase was probably involved in the transfer of 18C fatty acids. 55 The SLC1 as well as the YBR042C protein localizes to the lipid droplets. As both these proteins possess an acyltransferase domain, it is unclear as to whether these two proteins perform identical or distinct functions. In order to answer the question, a double deletion mutant of SLC1 and YBR042C was analysed. The lipid profile of the double mutant showed all the changes observed in ∆SLC1 and ∆YBR042C profiles. This data implies that SLC1 and YBR042C are involved in the transfer of different fatty acyl-CoA molecules. The deletion of these two ORFs results in several fold decrease for several of the major phosphoinositol species. Quantitative analysis via precursor scans showed overall decreased levels of phospholipids in the double. Deletion of both these genes shows a significant reduction in several of the phosphoinositols. In order to explain a specific decrease in phosphoinositol levels the following hypothesis is proposed. It is known that besides being a key intermediate in glycerophospholipid biosynthesis, phosphatidic acid also functions as a signaling molecule (Athenstaedt and Daum, 1999; Loewen et al., 2004). Phosphatidic acid binds to the transcription factor OPI1 and SCS2 in the ER which prevents OPI1 from translocating into the nucleus and repressing genes such as INO1. INO1 performs a primary function in the biosynthesis of yeast Phosphoinositols (Loewen et al., 2004). It is hypothesized that reduction in Phosphatidic acid levels, results in the free OPI1 causing a repression of INO1 genes; hence a specific reduction in Phosphoinositide levels (Figure 4.1). 56 Opi1 PA Scs2 Lowered PA levels Normal PA levels Opi1 Opi1 Endoplasmic Reticulum Scs2 Scs2 PA + PI PA Inositol + PI Opi1 Inositol Opi1 Nucleus Opi1 INO1 P A – phosphatidic acid P I – phosphatidylinositol Figure 4.1 Possible mechanism by which alterations in PA levels influence phophatidylinositol levels . Opi1 and Scs2 are transcription factors known to regulate the gene INO1. It is hypothesized that a reduction in the levels of PA can result in an increase in free OPI1 cause a repression in phosphoinositol synthesis. 4.5 Future directions The identification of all ORFs that play a role in lipid metabolism is an important future objective. In order to achieve this objective, several improvements to the current profiling approach would need to be implemented. The profiling of crude extracts must be complemented by more quantitative lipid analysis such as by Multiple Reaction Monitoring or Precursor ion scanning approaches (Guan, 2006). Separation into classes by liquid chromatography prior to analysis will lead to greater efficiency and prevent ion suppression effects (Kim, 1994). The profiling of organelle 57 extracts can lead to the identification of ORFs involved in lipid regulation and metabolism at the organelle level. There exist merits for screening through the entire genome as well as a more targeted screening of ORFs suspected to be involved in lipid metabolism. To maximize the use of resources a targeted screening would be more beneficial. The major bottle neck in profiling through the entire yeast deletion library is the preparation of lipid extracts which was a time consuming process. The scaling down of the culture volume has been more efficient and could lead to greater automation of the whole process. The growth of yeast cells in minimal volumes in an automated fashion, plus automation of lipid extraction are possibilities for the rapid analysis of the yeast genome for different lipid classes. 4.6 Further characterization of the ORF YBR042C Functional validation of the role of YBR042C as an acyltransferase would require the purification of the protein and establishment of the enzymatic function is needed. The levels of phosphoinositols could be estimated in GFP tagged OPI3 strain. Measurement of phosphatidic acid levels could also be used to test the hypothesis put forth to explain the decreased levels of phosphoinositols. Functional identification of genes involved in lipid metabolism through a profiling approach can greatly aid our understanding of lipid molecules and help screen the entire yeast mutant collection which is an important goal ahead. 58 5 BIBLIOGRAPHY Agnes, B.B., et al (1997) Construction of a yeast strain deleted for the TRP1 promoter and coding region that enhances the efficiency of the Polymerase Chain ReactionDisruption method, Yeast 13 : 353-356. Athenstaedt, K., Daum, G., (1997) Biosynthesis of Phosphatidic acid in lipid particles and endoplasmic reticulum of Saccharomyces cerevisiae, Journal of Bacteriology, 179 : 7611-7616. Athenstaedt, K., Daum, G., (1999) Phosphatidic acid, a key intermediate in lipid metabolism, European Journal of Biochemistry, 266 : 1-16. Athenstaedt, K., Weys, S., Paltauf, F., Daum, G., (1999) Redundant systems of Phosphatidic acid biosynthesis via Acylation of Glycerol-3-Phosphate or Dihydroxy Acetone Phosphate in the Yeast Saccharomyces cerevisiae, Journal of Bacteriology, 181 (5) : 1458 – 1463. Baudin, A., Ozier-Kalogeropoulus., Denouel A., Lacroute F. and Cullin C., (1993) A simple and efficient method for direct gene deletion in Saccharomyces cerevisiae, Nucleic Acids Research, 21 (14) : 3329-3330. Botstein, D., Chervitz, S.A., Cherry, J.M., (1997) Yeast as a model organism, Science 277 (5330) : 1259 – 1260. Botstein, D., Fink, G. R., (1988) Yeast: An experimental organism for Modern Biology, Science 240 (4858) : 1439 – 1443. Boumann, H.A., Chin, P.T., Heck, A.J., De Kruijff, B., De Kroon, A.I., (2004) The Yeast phospholipid N-methyl transferases catalyzing the synthesis of phosphatidylcholine preferentially convert di-C16:1 substrates both in vivo and in vitro, Journal of Biological Chemistry 279 (39) : 40314 – 40319. 59 Brugger, B., Erben, G., Sandhoff, R., Wieland, F. T., Lehmann, W. D., (1997) Quantitative analysis of biological membrane lipids at the low picomole level by nano-electrospray ionization tandem mass spectrometry, Proceedings of the National Academy of Sciences, USA, 94 : 2339-2344. Carman, G.M., Henry, S.A., (1989) Phospholipid biosynthesis in the Yeast, Annual review of Biochemistry, 58 : 635-669. Carman, G.M., Henry, S.A., (1999) Phospholipid biosynthesis in the Yeast Saccharomyces cerevisiae and inter relationships with other metabolic processes, Progress in lipid Research, 38 : 361 – 399. Chong , L , Marx , J. (2001) lipids in the lime light. Science, 294, 1861. Daum G., et al (1998) Biochemistry, Cell Biology and Molecular Biology of the lipids of Saccharomyces cerevisiae, Yeast 14 : 1471-1510. Daum, G., Tuller, G., Nemec, T., Hrastnik, C., Balliano, G., Cattel, L., Milla, P., Rocco, F., Conzelmann, A., Vionnet, C., Kelly, D. E., Schweizer, E., Schuller, HJ., Hojard , U., Greiner, E., Finger, K., (1999) Systematic analysis of yeast strains with possible defects in lipid metabolism, Yeast, 15 : 601-614. Delneri, D., Tomlin, G.C., Wixon, J.L., Hutter, A., Sefton, M., Louis, E.J., Oliver, S.G., (2000) Exploring redundancy in the Yeast Genome: an improved strategy for the use of the cre-loxP system, Gene 252: 127 – 135. Derisi , J L, Iyer ,V.R ,Brown, P,O (1997) . Exploring the metabolic and genetic control of gene expression on a genomic scale , Science 94: 680-6 Dircks, L., Sul, H.S., (1999) Acyltransferases of de novo glycerophospholipid biosynthesis, Progress in lipid research 38 : 461-479. Ekroos, K., Chernusevich, I.V., Simons, K., Shevchenko, (2002) Quantitative Profiling of Phospholipids by Multiple Precursor Ion Scanning on a Hybrid 60 Quadrupole Time-of-flight Mass Spectrometer, Analytical Chemistry 74 : 941 – 949. Esjing, C.S., Duchoslav, E., Sampaio, J., Simons, K., Bonner, R., Thiele, C., Ekroos, K., Shevchenko, A., (2006) Automated Identification and Quantification of Glycerophospholipid Molecular Species by Multiple Precursor Ion Scanning, Analytical Chemistry 78 : 6202 – 6214. Gao, F., Tian, X., Wen, D., Liao, J., Wang, T., Liu, H., (2006) Analysis of phospholipid species in rat peritoneal surface layer by liquid chromatography / electrospray ionization ion-trap mass spectrometry, Biochemica et Biophysica Acta, 1761 : 667 – 676. Gawriach K ,Eldho , N.V , Polozov , I .V.(2002) Novel NMR tools to study structure and dynamics of biomembranes. Chem. Phys. lipids 116 ,135-151. Goffeau, A., et al. (1996) Life with 6000 genes, Science 274 : 546-567. Han, X .Gross, R. W., (1994) Electrospray ionization mass spectrometric analysis of human erythrocyte plasma membrane phospholipids, Proceedings of the National Academy of Sciences , USA, 91 : 10635-10639. Han, X., Gross, R. W., (2003) Global analyses of cellular lipidomes directly from crude extracts of biological samples by ESI mass spectrometry: a bridge to lipidomics, Journal of lipid research, 44 : 1071-1079. Harrison , R, Papp B, Pal C , Oliver SG , Delneri D .(2007) . Plasticity in genetic interactions in the metabolic networks of yeast. Proceedings of the National Academy of Science.104(7) : 110-116. Hilgemann (2003) Getting ready for the decade of the lipids, Annual review of Physiology 65 : 695-700. Hong et al ,(2007), Yeast genome database. 61 Kerwin, J.L., Tuininga, A.R., Ericsson, L.H. (1994) Identification of molecular species of Glycerophospholipids and Sphingomyelin using electrospray mass spectrometry, Journal of lipid research 35 :1102-1114. Kim , H.Y., Wang, T. C. L., (1994) Liquid chromatography / Mass spectrometry of Phospholipids using electrospray ionization, Analytical Chemistry, 66 : 39773982. Kohlwein, S.D et al., (1996) Phospholipids : Synthesis, sorting, sub cellular traffic – the yeast approach, Trends in Cell Biology 6 : 260-266. Loewen, C. J. R., Gaspar, M. L., Jesch, S. A., Delon, C., Ktistakis, N. T., Henry, S. A., Levine, T. P., (2004) Phospholipid Metabolism regulated by a transcription factor sensing Phospatidic Acid, Science, 304 : 1644 – 1647. Natter, K. et al. (2005) The spatial organization of lipid synthesis in the Yeast Saccharomyces cerevisiae derived from large scale green fluorescent protein tagging and high resolution microscopy, Molecular and Cellular Proteomics 4 : 662-672. Nielsen, N. V., Carstensen, J.M., Semdsgaard, J., (1998) Alignment of single and multiple wavelength chromatographic profiles for chemometric data analysis using correlation optimized warping, Journal of Chromatography A 805 : 17-35. Odorizzi, G. et al., (2000) Phosphoinositide signaling and the regulation of membrane trafficking in the yeast, Trends in Biochemical Sciences 25 : 229-235. Oliver, S. G., (1996) A network approach to the systematic analysis of yeast gene function, Trends in Genetics 7: 241-242. Oliver, S., (1996) A network approach to the systematic analysis of yeast gene function, Trends in Genomics 12 (7) : 241 – 242. 62 Oliver, S.G et al., (1998) Systematic functional analysis of the yeast genome, Trends in Biotechnology 16: 373-378. Oltvai, Z. N., and Barabasi, A. L., (2002) Life’s complexity pyramid, Science 298: 763-764. Pulfer , M and Murphy , R.C.(2003) Electrospray mass spectrometry of glycerophospholipids. Mass spectrometry reviews, 22 : 322-364. Racenis, P.V., Lai, J.L., Das, A.K., Mullick, P.C., Hajra, A.K., Greenberg, M. L., (1992) The Acyl Dihydroxyacetone Phosphate pathway enzymes for Glycerolipid Biosynthesis are present in the Yeast Saccharomyces cerevisiae, Journal of Bacteriology, 174 : 5702-5710. Rest, M. E., (1995) The plasma membrane of Saccharomyces cerevisiae: Structure, Function and Biogenesis, Microbiological Reviews, 304-322. Rieger, K-J., El-Alama, M., Stein, G., Bradshaw, G.,Slonimski, P. P., Maundrell, K., (1999) Chemotyping of Yeast Mutants using Robotics, Yeast, 15 : 973 – 986. Wach, A., (1996) PCR-Synthesis of Marker Cassettes with Long Flanking Homology Regions for gene disruptions in S. cerevisiae, Yeast, 12 : 259 – 265. Wallis, J.G., Browse, J., (2002) Mutants of Arabidopsis reveal many roles for membrane lipids, Progress in lipid Research, 41 : 254-278. Welti, R., Wang, X., (2004) lipid species profiling: a high-throughput approach to identify lipid compositional changes and determine the function of genes involved in lipid metabolism and signaling, Current opinion in Plant Biology 7: 337-344. Wenk, M.R., (2005) The emerging field of lipidomics, Nature Reviews Drug discovery, 7 : 594-610. Wenk, M.R., (2006) Mass spectrometry-based profiling of Phospholipids and Sphingolipids in extracts from Saccharomyces cerevisiae, Yeast, 23 : 465 – 477. 63 Xialin, H. and Gross, R.W., (1994) Electrospray ionization mass spectrometric analysis of human erythrocyte plasma membrane phospholipids, Proceedings of National Academy of Sciences, USA, 91 : 10635-10638. Xu, C., Fan, J., Riekhof, W., Froehlich, J. E., Benning, C., (2003) A permease-like protein involved in ER to thylakoid lipid transfer in Arabidopsis, 22 (10) : 23702379. Zewail, A., Xie, M, W., Xing, Y., Lin, L., Xhang, P, F., Zou, W., Saxe, J, P., Huang, J., (2003) Novel functions of the Phosphatidylinositol metabolic pathway discovered by a chemical genomics screen with wortmannin, PNAS, 100 (6) : 3345 – 3350. 64 Appendix Mass Spectrometry Data Average normalized mutant profile Differences expressed in logarithmic ratio YJR125C YJR119C Average normalized wild type profile I II YFR019W YDR150W YKR023W III YHR108W YHR105W YBL085W IV YJR073C YHR161C YHR155W V YJL134W YJR130C YNL335W VI YHL003C YIL155C YGR157W VII YIL124W YLR260W YOR171C VIII YDR297W YKR031C YKL008C IX YLR260W YDL022W YPL057C X YBR041W YBR177C YOR171C XI YDL113C YOR109W YIL002C XII YKR046C YDR018C YBR042C XIII YBR200W YLR133W YDL142C XIV YBR129C YJR073C YNL169C XV YDR104C YDR313C YCL034W XVI YNL106C YDR284C YGR170W XVII YDR326C YDL161W YBR177C XVIII YOR303W Y05581 YKR106W XIX YDR444W YMR169C YPL004C XX YMR174C YML010C-B YML009C XXI YML021C YPL078C YDR417C XXII YDR242W YBR299W YML081C-A XXIII YDR512C YDR461W YDR326C XXIV YJR055W YER089C YDR515W XXV YDR500C YMR322C YKR106W XXVI YKR106W YFL001W YDR502C XXVII Y050606 YDR461W YKL053C-A XXVIII YLL014W YLL013C YDR506C XXIX YNR060W YLL016W YLL015W XXX YNR067C YNR061C YNR066C XXXI YNL334C YIL059C YER063W XXXII YER063W YBR073W YNL332W XXXIII YDL113C YPR093C YNR059W XXXIV [...]... comprehensive lipid profiling of the yeast would require profiling of all viable gene deletion mutants for all lipid classes Such a comprehensive effort would require a large scale initiative A representative lipid profiling of the yeast would require the selection of candidate ORFs to be profiled In order to account for the possibility that annotated genes may have unknown functions, a random selection of ORFs... numerous lipid- lipid and lipid- protein interactions The discovery of an increasing number of domains on proteins that can bind to lipids underscores the importance of protein lipid interactions (Lemmon, 2003) 2 Figure 1.1 lipid classes and representatives a Fatty Acyls b Glycerolipids c Glycerophospholipids d Sterol lipids e Sphingolipids 3 Figure 1.2 Phosphatidic acid and classes of Phospholipids Phosphatidic... deeper understanding of glycerophospholipids would enable a better understanding of cellular mechanisms Glycerophospholipid profiling involves the extraction of these molecules preferentially This can be carried out using acid phase extraction glycerophospholipid Comparison profiles can of provide mutant clues profiles on to genes wild involved type in glycerophospholipid metabolism and regulation... spingolipids of mammals (Daum et al., 1999) A systematic profiling of selected yeast strains with suspected defects in lipid metabolism has been carried out using TLC as a primary analytical technique (Daum et al., 1999; Oliver, 1996) The suitability of yeast for mass spectrometry based profiling approach has been established by the development of methods to study Phospholipids and Sphingolipids in yeast. .. These techniques often require large amounts of sample and are unable to resolve individual lipid species The adaptation of mass spectrometry to study lipids and an increasing interest in these molecules has dramatically changed the field of lipid science (Kerwin et al., 1994, Kim et al., 1994) Mass spectrometry allows for the profiling of lipids, and helps in obtaining a relative ratio of the various... separation of aqueous and organic phases A volume of 300 µL of organic phase was removed and transferred to a new tube The organic phase was then dried using a Speedvac The dried lipid film was reconstituted in 400 µL of Chloroform : Methanol (1:1) A five fold dilution using Chloroform : Methanol (1:1) was carried out prior to mass spectrometric analysis 2.5 Analysis of lipids 2.5.1 Mass Spectrometry of lipid. .. for the study of some phospholipids and sterols The adaptation of mass spectrometry to the study of lipids has helped overcome some of the difficulties encountered in above mentioned techniques used in lipids 1.3 Mass spectrometry and lipidomics Mass spectrometry involves the ionization of molecules followed by the determination of their mass to charge (m/z) ratio The representation of the mass to... NMR and biochemical approaches such as lipid antibodies are used in lipidomics experiments The resolution and sensitivity of a mass spectrometer make it particularly suitable for lipidomics (Kitano, 2002; Wenk, 2005) The general experimental approach in lipidomics is to extract lipids from the system under study and obtain a lipid profile (Figure 1.3) A lipid profile refers to the composition and relative... to be obtained To extract lipids organic solvents were 19 employed; 500 µL of Chlorofom : Methanol (1:1) mix was added and vortexed for 30 sec followed by incubation for 30 sec This step was followed by the addition of 400 µL of Chloroform and 300 µL of 1M HCL and vortexed for 30 sec The extraction of lipids at acid phase helps in the enhanced extraction of acidic Phospholipids The eppendorf tube was... feature being their insolubility in water, though lipids such as phosphoinositols exhibit solubility in water The various subclasses of lipids include fatty acids, glycerophospholipids, Sphingolipids and sterols (Figure 1.1) The number of carbon atoms in fatty acids, the presence and position of double bonds and head groups result in structural diversity amongst lipids Specific classes of lipids such ... 65 v SUMMARY Discovery of Lipid hydrolysing enzymes and their modulators using metabolite profiling of Yeast (Saccharomyces cerevisiae) mutants An understanding of glycerophospholipid metabolism,... Tandem mass spectrometric identification of lipid species 32 Lipid profiling of single deletion mutant strains 33 3.3.1 Lipid profiling of strains in a random manner 33 3.3.2 Lipid profiling of. .. LIST OF TABLES vii LIST OF FIGURES viii LIST OF ABBREVIATIONS x INTRODUCTION 1.1 Lipids 1.2 Techniques used to study lipids 1.3 Mass spectrometry and lipidomics 1.4 Phospholipid profiling 1.5 Yeast