CHARACTERIZATION OF MYCOBACTERIAL ESTRASES LIPASES USING COMBINED BIOCHEMICAL AND COMPUTATIONAL ENZYMOLOGY

CHARACTERIZATION OF MYCOBACTERIAL ESTERASES/LIPASES USING COMBINED BIOCHEMICAL AND COMPUTATIONAL ENZYMOLOGY ANKIT SHUKLA (Bachelor of Technology, Bioinformatics) SRM University, India A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE IN INFECTIOUS DISEASES, VACCINOLOGY AND DRUG DISCOVERY DEPARTMENT OF MICROBIOLOGY NATIONAL UNIVERSITY OF SINGAPORE AND SWISS TROPICAL AND PUBLIC HEALTH INSTITUTE, BIOZENTRUM, UNIVERSITÄT BASEL, SWITZERLAND 2013 DECLARATION I hereby declare that the thesis is my original work and it has been written by me in its entirety. I have duly acknowledged all the sources of information which have been used in the thesis. This thesis has also not been submitted for any degree in any university previously. ______________ Ankit Shukla 28 December 2012 i ACKNOWLEDGMENTS I would like to take this opportunity to specially thank my supervisor Prof. Markus Wenk for giving me the opportunity to pursue my masters project in his lab in the highly interesting field of lipidomics, his exceptional scientific support and understanding has been instrumental throughout my project and has made my stay at NUS a good learning and memorable experience which is bound to have positive implications for my future career. I’m highly grateful to my mentor Madhu Sudhan Ravindran who has always been willing to teach me all experimental techniques right from scratch his valuable suggestions throughout helped shape my project. I would like to thank all the members of the Journal club for their honest comments on the project and also giving me the opportunity to present my work in the scientific arena. I’m really thankful to all the members of Markus’s lab who made my stay at NUS a scientific as well as an unforgettable personal experience. In particular I express my gratitude to Husna, Federico, Khanh Nagyuen, Jacklyn, Sudar, Pradeeep, Shentong, Shareef, Phylis and Chrisitna who provided me with unending support and friendship. I’m almost certain without their motivation and friendship it would have been possible to achieve my goals three cheers for you guys! I’m highly grateful to my parents whose love and support has always been with me in all my endeavours. A special thanks goes out to my close friend Menorca who has been always been with me and kept me up and going at all times. Lastly, I would like to thank all my colleagues and everyone who has helped me in this project in some way or the other from professional to personal space. ii Table of Contents Declaration………………………………………………………….…………i Acknowledgments…………………………………………………………….ii Table of contents……………………………………………………….…….iii Summary…………………………………………………………………….vii List of Tables……………………………………………………………….viii List of Figures………………………………………………………………………1 List of Abbreviations……………………………………………………………….3 1. INTRODUCTION………………………………………………………...........4 1.1. Esterases/Lipases……………………………………………………….....4 1.1.1 Esterases/Lipases in Infectious Diseases…………………………..5 1.1.2 Biology of Mycobacteria……………………………………………8 1.1.3 Mycobacterial Esterases/Lipases………….…………..…..…….9 1.1.4 Role of Esterases/Lipases in Mycobacterial Infection Cycle..…10 1.2. Esterases/Lipases in Physiopathology and Disease Progression….14 1.3. Esterases/Lipases Enzyme Classification System………………….16 1.3.1 Hydrolases (EC 3.)…………………………...…………………16 1.3.2 Carboxyl ester hydrolases (EC 3.1.1)………...………………....17 1.3.3 Carboxyl esterases (EC3.1.1.1)………………………...……….18 iii 1.3.4 Triacylglycerol (TAG) Lipases (EC 3.1.1.3) …………………....18 1.4. Alpha/Beta (α/β) Hydrolase Fold Family …………………...............18 1.4.1 Alpha/Beta (α/β) Hydrolase fold family in Mycobacteria…..........20 1.4.2 Mycobacterial lipase gene family…………………………...........28 1.4.2.1 Hormone-sensitive lipase sub-family ………………………….29 1.5. Issues and Problems with functional characterization of Mycobacterial putative Esterases/Lipases. ……………………………...29 1.6. Tetrahydrolipstatin (Orlistat)………..………………………..…......29 1.6.1 An FDA approved anti-obesity drug………..……………………30 1.6.2 An anti-cancer agent…………………………..….....….....….......31 1.6.3 An anti-mycobacterial agent..…………………..….....….....….....31 1.7. Aims and Objectives………………………………..….....….....…......31 2. MATERIALS AND METHODS….……….................................................33 2.1. Molecular Modelling.…… ….………..................................................33 2.1.1 Sequence Analysis.……….………......................................................33 2.1.2 Comparative Modelling.……… ………........................................33 2.2. Molecular Dynamics Simulations……….............................................35 2.3. Virtual Ligand Screening.……… ………............................................35 iv 2.4. Bacterial Strains and Cultures……….…………………...................38 2.4.1 Bacterial Strains………………………………………….............38 2.4.2 Bacterial Culture Media……………………………………….....38 2.4.3 Glycerol Stock of Bacteria……………………………….…........39 2.5. Cloning Procedures...............................................................................39 2.5.1 Genomic DNA Isolation (Mycobacteria)………………………...39 2.5.2 Preparation of Over-expression Plasmids…………………….......40 2.5. Mycobacterium bovis BCG Competent cell preparation, Transformation and Selection of transformants………………........41 2.6. Preparation of Whole Cell Lysate (WCL)……………………..........41 2.7. Fluorescent Click Chemistry……………………………………........42 2.8. Gel Electrophoresis………………...…………………………...….....42 2.9. Enzymatic Assays…………………………………...……………........43 2.10. Inhibitor Assays…………………………...…………………...…….44 3. RESULTS………………………………………………………...………….46 3.1. Molecular Modelling of Protein 3D Structures………………............46 3.2. Molecular Structure Based Ligand Screening……………..…...........52 3.2.1. Evaluation of Ligand Screening Results……………..…..……….53 v 3.3. Over Expressing Mycobacterial putative Esterases/Lipases………....57 3.4. Biochemical Characterization………………..…………………….......58 3.4.1 Enzymatic Assays………….………………………….……..................58 3.4.2 BCG_1460c (lipH probable lipase) shows short-chain esterase activity…………………………….………………………..…..…........59 3.5. Tetrahydrolipstatin (THL) strongly inhibits short-chain esterase activity of BCG_1460c (lipH)………………………………....…..........60 3.6. Predicted binding mode model of THL inhibition in BCG_1460c (lipH) 3D Structure…………………………………………..................62 4. DISCUSSION...................................................................................................65 4.1. In silico Studies.........................................................................................65 4.1.1 Role of Virtual Screening in Antibacterial Drug Discovery....................65 4.1.2 Concepts, Feasibility and Drawbacks of Virtual screening.....................68 4.1.3 Molecular 3D structure Modelling and Virtual Ligand Screening…………………………………………………......................68 4.1.4 Predicted binding mode model of THL inhibition in BCG_1460c (lipH) 3D Structure………………………………………….…………............70 4.2. In vitro Studies..........................................................................................70 4.2.1 BCG_1460c (lipH probable lipase) is a short-chain Carboxyl esterase…………………………...…………………………..……........70 vi 4.2.2 Tetrahydrolipstatin (THL) strongly inhibits short-chain Carboxyl esterase activity of BCG_1460c (lipH probable lipase)……………....................72 4.2.3 Possible Functions of BCG_1460c (lipH probable lipase)….……..........73 5. CONCLUSIONS AND FUTURE DIRECTIONS.……................................73 REFERENCES…….……....................................................................................79 Summary Esterases/Lipases are evolutionarily related enzymes mostly belonging to hydrolases superfamily sharing a common α/β-hydrolase protein fold. Recent studies have suggested that they play a pivotal role in disease manifestation due to disruption of lipid metabolizing enzymes and their pathways, yet only very few have been functionally annotated. This study focuses on Mycobacterial lipolytic/non-lipolytic enzymes comprising of 31 putative lipases and/or esterases belonging to α/β-hydrolase fold family. In silico molecular modeling, sequence analysis and ligand docking experiments provide insights into molecular structure of these classes of enzymes. We performed a unique structure based virtual ligand screening to predict natural substrates of 4 putative Mycobacterial esterases/lipases namely BCG_1460c (lipH probable lipase), BCG_2991c (lipN probable lipase/esterase), BCG_2950 (tesA probable thioesterase) and BCG_3229 (lipV possible lipase). vii The information obtained from molecular docking and molecular dynamics (MD) simulations was preceded with an in vitro study, where we performed enzymatic assays with whole cell lysates of Mycobacterium bovis BCG over-expressing lipases and/or esterases using synthetic substrates. We provide evidence at structural and biochemical level that the short-chain esterase activity of BCG_1460c (lipH probable lipase) is inhibited by tetrahydrolipstatin (THL) an FDA approved drug. Overall, the in silico and in vitro analysis show high correlation and provide an effective approach to characterize and distinguish mycobacterial lipolytic/non-lipolytic enzymes. List of Tables Table 1.1 Effects of infectious pathogens on host lipid metabolism Table 1.2 Probable functions and identities of Mycobacterial lip gene family enzymes Table 2.1 Click reaction Table 2.2 Concentrations of reagents used Table 3.1 Summary of potential substrates ligand screening results Table 3.2 Summary of potential inhibitors ligand screening results Table 4.1 BCG_1460c (lipH) homologs in bacterial species viii List of Figures Figure 1.1 (a)Hydrolysis of carboxylic ester catalysed by carboxyl esterase (b)Hydrolysis of a triacylglycerol substrate catalysed by TAG lipase enzyme Figure 1.2 Functional classifcation of Mycobacterium tuberculosis genome Figure 1.3 Mycobacterium tuberculosis infection cycle Figure 1.4 (a) Typical foamy macrophage having lipid bodies (LBs) (b) LB surrounded by several M. tuberculosis bacilli intracytoplasmic lipid (ILIs) (c) Intracytoplasmic lipid within M. tuberculosis bacilli Figure 1.5 Esterases enzyme classification system Figure 1.6 Topology diagram of α/β hydrolase fold enzymes Figure 1.7 (a) 3D structure of Pseudomonas fluorescens carboxyl esterase (b) Superposition of conserved α/β hydrolase core of 9 representative α/β hydrolase fold enzymes Figure 1.8 (a) Total M. tuberculosis functionally annotated genes (b) 94 α/β hydrolase fold distribution in lipid enzymes Figure 1.9 Chemical Structure of Tetrahydrolipstatin (Orlistat) Figure 2.1 Steps involved in Molecular modelling Figure 2.2 Computational Docking Figure 2.3 para-nitrophenol (pNP) assay Figure 2.4 Template design of a 96 well plate used for Inhibitor assays Figure 3.1 3D structure and Cα – backbone overlay of FAS-TE modelled over know FAS-TE structure 1 Figure 3.2 3D structure models Figure 3.3 Structure validation report Figure 3.4 Ramachandran plot statistics of backbone dihedral angle distribution Figure 3.5 Protein structure analysis Figure 3.6 Molecular dynamic simulations Figure 3.7 Short (C2) to long (>C12) acyl chain ester ligands screening results Figure 3.8 SDS-PAGE fluorescent gel image showing M. bovis BCG over expressing BCG_1460c (lipH) and BCG_2950 (tesA) Figure 3.9 Enzymatic assay with whole cell lysate of overexpressed BCG_1460c (lipH) and BCG_2950 (tesA) Figure 3.10 Enzymatic assay of over expressed BCG_1460c (lipH) with varying acyl chain length substrates Figure 3.11 THL (Tetrahydrolipstatin) inhibitor assay (IC50) Figure 3.12 E600 (diethylparanitrophenyl phosphate) inhibitor assay (IC50) Figure 3.13 THL (Tetrahydrolipstatin) binding mode model in BCG_1460c (lipH) 3D structure Figure 4.1 Pincipal antibacterial drug discovery strategies Figure 4.2 State of the art in Virtual Screening Figure 4.3 Detailed workflow of a high throughput virtual screening (VHTS) Figure 4.4 SDS-PAGE fluorescent gel image showing M. smegmatis over expressing lipH (BCG_1460c) Figure 4.5 Enzymatic assay with M. smegmatis over expressed lipH (BCG_1460c) 2 Lists of Abbreviations THL: Tetrahydrolipstatin pNP: para-nitrophenol PDB: Protein Data Bank PMSF: phenylmethanesulfonylfluoride E600: diethyl-p-nitrophenylphosphate EC : Enzyme classifier TAGs: Triacylglycerol MTB: Mycobacterium tuberculosis LB: Lipid bodies ILI: Intracytoplasmic lipid OD: Optical Density SBDD: Structure Based Drug Design VHTS: Virtual High Throughput Screening FBDD: Fragment Based Drug Design 3DQSAR: Three Dimensional Quantitative Structure Activity Relationship 3 1. Introduction 1.1. Esterases/Lipases The biological relevance and coexisting variability of lipids has led to the development of wide range of lipid metabolizing enzymes. Esterases (EC 3.1) are widely distributed amongst bacteria, fungi, plants and animals defined by their ability to catalyse the formation and cleavage of ester bonds. They are classified based on the nature of the ester bonds (carboxyl ester, thio ester, phosphomonoester, etc.) they catalyse. Among them, carboxyl ester hydrolases (EC 3.1.1) are enzymes that catalyses ester bond hydrolysis of carboxylic esters (Figure 1.1a). Lipases/TAG lipases (EC 3.1.1.3) are lipolytic enzymes which constitute a special sub-class of carboxyl ester hydrolases (EC 3.1.1) (Ali, Verger et al. 2012) capable of releasing long-chain fatty acids from natural water-insoluble esters such as lipids (Figure 1.1b). (a) Carboxyl ester hydrolase Carboxylic ester (b) Water Carboxylic acid Alcohol TAG Lipase Triacylglycerol Water Glycerol Fatty Acid Figure 1.1: (a) Hydrolysis of a carboxylic ester catalysed by carboxyl esterase enzyme. (b) Hydrolysis of a triacylglycerol substrate catalysed by TAG 4 lipase enzyme (Source: Thomson, Delaquis et al. 1999) 1.1.1 Esterases/Lipases in Infectious Diseases Several studies on lipid metabolism have been undertaken and the outcome of these studies has opened up new ways and avenues to analyse and characterize a host of diseases as well as providing newer insights and approaches into the mechanisms involved when cells start functioning abnormally and hence enable establishing of an important link between lipid metabolism and the disease. The concept and hypothesis was further extended to infectious diseases which are known to be accompanied by an altered host lipid metabolism via a unique sequence i.e. the disruption of lipid metabolizing enzymes (esterases/lipases) and their pathways and there also exists a close and significant inter-relationship between lipid metabolism and host responses to infection. It is indeed important to explain the mechanism and the factors by which the lipid metabolism is regulated. The frontline and exclusive studies have shown that the lipid metabolism is regulated by lipid metabolizing enzymes (esterases/lipases) which are considered to be one of the known virulence factors in many bacteria such as Pseudomonas cepacia, Staphylococcus aureus (Lonon, Woods et al. 1988 and Rollof, Braconier et al. 1988) and fungal species like Candida albicans, Fusarium gramearium. Further insight reveals that the lipid metabolizing enzymes of Propionibacterium acnes and Staphylococcus epidermis are probably involved in incidence of commonly prevalent human skin infections where they help triggering colonization and subsequent persistence of bacteria on the human skin. 5 EFFECTS OF INFECTION ON LIPID METABOLISM OF HOST Presence of invading microorganism 1. Direct Effects Secondary effects due to infection  Decreased dietary intake of fats.  Utilization of host lipids required by replicating microorganisms.  Disruption of host cell metabolism by intracellular microorganisms.  Minimal interference with intestinal absorption of fats.  Localized destruction of fat cells at sites of an infectious process.  Altered lipid metabolism within host cells.  Altered rates of hormonemediated lipolysis within fat depots to supply increased metabolic demands.  Altered rates of lipid synthesis within the liver  Altered rates of fat utilization by peripheral tissues. 2. Indirect Effects  Alterations in host lipid metabolism caused by bacterial exotoxins, endotoxins or enzymes.  Activation of lipase and other lysosomal enzymes within host phagocytes.  Release of mediator substances from host cells, that is, endogenous pyrogen, interferon. Table 1.1: Effects of infectious pathogens on host lipid metabolism (Source: (Beisel and Fiser 1970)) According to some hypothesis it has been suggested that these enzymes may also be responsible in contributing to the invasiveness and proliferation by inducing the destruction of the host tissues thereby supplying hydrolysed material as nutrient to the microorganisms. Lipid precursors needed for the replication of the invading pathogens (bacteria, viruses and protozoans) are derived and supplied from the source metabolic pools within the host by lipid 6 metabolizing enzymes thereby altering the host lipid metabolism. In the subsequent process of progression and infection may allow for the redistribution of nutrients to cells which are considered extremely important in ensuring host defence or tissue repair. It has now been well established and recognized that certain pathogens have the inherent capabilities to co-opt the lipid metabolism and some illustrative examples can be listed as: a.) The ability of Mycobacterium tuberculosis to catabolize cholesterol as an energy source which might as a result facilitate and regulate its ability to survive within the macrophages. b.) Utilization of host cholesterol by Toxoplasma gondii for its persistence, growth and proliferation. c.) Heliobacter pylori being unable to synthesize cholesterol and hence requires exogenous cholesterol from the host. d.) Ebola virus (EBOV) in lysosomal compartments binds to cholesterol transporter protein Niemann-Pick C1 (NPC1). Fatty metamorphosis of cells particularly from liver, kidney and heart is a common histologic finding during a host of bacterial infectious diseases. An increase in esterified fatty acids has been observed in viral hepatitis whereas free fatty acids and triacylglycerol (TAGs) have been reported to be elevated in gram-negative bacillus infections in humans. Since the action of hormonesensitive lipase in adipose tissue is a major event contributing to free fatty acids to blood, such infection-related hormonal responses may have a pivotal role to play in altering/affecting the rates of lipolysis or fatty acid utilization. 7 1.1.2 Biology of Mycobacteria It has now been reported that the genus Mycobacterium is known to comprise of more than 100 species (Tortoli 2006). The cultivable (grown in lab) members of Mycobacterium are clinically grouped either as the Mtb complex or the non-tuberculous mycobacteria. The M. leprae, which is responsible for causing leprosy is an obligate parasite and therefore not cultivable in vitro (van Beers, de Wit et al. 1996). On the other hand, diseases caused by members of Mtb complex include M. tuberculosis, M. bovis, M. microti, M. africanum and M. Canettii subspecies they are known to possess and demonstrate very similar clinical features. Pulmonary diseases caused by M. tuberculosis and M. bovis are clinically, radiologically and pathologically indistinguishable. However, M. bovis appears to have a diminished propensity and potentiality to reactivate and spread from person to person (O'Reilly and Daborn 1995) through human chain. Calmette and Guérin (BCG) attenuated a strain of M. bovis to generate BCG which is used as a vaccine by continuous passaging through culture media. Mycobacteria are aerobic and non-motile rod (bacillus) shaped that are identified to be weakly Gram-positive and acid-fast by Ziehl-Neelsen staining. The bacilli belong to the actinobacterium family and all Mycobacterium species are known to share a characteristic cell wall architecture which is relatively much thicker than other bacteria and are known to be hydrophobic, rich in mycolic acids. In the laboratory, Mtb can be grown, in vitro, on the agar-based Middlebrook medium or the egg based Lowenstein-Jensen medium (Parrish, Dick et al. 1998). Considering that it is a relatively slow growing bacteria, it takes a time period of around 4-6 weeks to 8 have visual bacterial colonies formed on these solid media (Parrish, Dick et al. 1998). 1.1.3 Mycobacterial Esterases/Lipases In Mycobacterium such as Mycobacterium tuberculosis lipids play a vital role wherein it is stated that a large fraction of the genome encodes putative enzymes said to be involved in lipid metabolism (Cole, Brosch et al. 1998). Indeed, Mycobacterium tuberculosis genome contains 250 genes encoding putative enzymes involved in the synthesis or degradation of lipids compared to 50 genes in Escherichia coli, which is known to have a similar genome size. This feature, combined with the extremely large quantum of lipids representing 30–40% of the dry weight of M. tuberculosis tends to suggest that lipids and lipid metabolizing enzymes play an important role in the mycobacterial life cycle and perhaps also in virulence. In the study conducted by (Deb, Daniel et al. 2006) group reported the expression status of all the twenty-four putative lipase/esterase genes of lipase gene family of M. tuberculosis H37Rv in Escherichia coli BL21. In silico analysis has identified the presence of around 31 putative genes encoding lipid metabolizing enzymes (enzymes involved in lipids degradation) including 24 lipid/ester hydrolases belonging to the so called “Lip family” (LipC to LipZ). These have been annotated as putative esterases or lipases based on the presence of the consensus sequence GXSXG which is considered to be the characteristic feature of the α/β hydrolase-fold family members (Ollis, Cheah et al. 1992). The functional classification of Mycobacterium tuberculosis genes has been depicted in fig.1.2 9 Figure1.2: Functional classifcation of Mycobacterium tuberculosis genome (Source: data from (Camus, Pryor et al. 2002)) 1.1.4 Role of Esterases/Lipases in Mycobacterial Infection Cycle There are a large number of mycobacterial species such as M. tuberculosis (Garton, Christensen et al. 2002), (Schue, Maurin et al. 2010), (Peyron, Vaubourgeix et al. 2008), (Daniel, Deb et al. 2004), (Deb, Daniel et al. 2006), (McKinney, Bentrup et al. 2000), Mycobacterium bovis BCG (Low, Rao et al. 2009 and Low, Shui et al. 2010), Mycobacterium leprae (Mattos, D'Avila et al. 2010) and Mycobacterium smegmatis (Garton, Christensen et al. 2002 and Dhouib, Ducret et al. 2011) which predominantly demonstrate the accumulation of lipids derived from host cells. In addition, the consumption pathways involving lipid metabolizing enzymes (esterases/lipases) have also 10 been identified and expressed. In particular, the tubercule bacilli enter the body by inhalation of aerosol route and reach the lungs where they are phagocytosed by the frontline pulmonary alveolar macrophages. Subsequently, host response ensues which consists of recruitment of lymphocytes, macrophages and dendritic cells leading to the formation of a highly organised structure termed as ‘granuloma’ a major histopathological hallmark of tuberculosis (Singh, et al. 2010). In these granuloma macrophages containing bacilli accumulates intra-cytoplasmic lipid inclusion bodies (LB) which are predominantly composed of neutral lipids surrounded by a phospholipid layer that reveals and assigns the macrophage their foamy appearance within the foamy macrophage, phagocytised bacteria preferentially metabolize lipids rather than carbohydrates (Wheeler and Ratledge 1988), a view point that is supported by an evidence showing up-regulation of several mycobacteria genes involved in lipid metabolism (McKinney, Honer zu Bentrup et al. 2000). At this stage of progression, the intra phagosomal bacteria acquire and accumulate intra cytoplasmic lipid inclusion (ILIs) in their cytoplasm (Figure 1.4(B) and 1.4(C)) and persist in a non-replicating state ultimately and eventually leading to dormancy i.e. latent infection. It has been demonstrated in an in vitro model of human granulomas (Peyron, Vaubourgeix et al. 2008) that these lipid bodies (LB and ILIs) serve as sources of carbon and energy for dormant bacilli. The infection cycle of Mycobacterium tuberculosis has been shown in fig.1.3 11 Figure 1.3: Mycobacterium tuberculosis infection cycle (Russell 2007) within granulomas and as a consequence aiding in reactivation that can ultimately lead to an active tuberculosis infection (Parrish, Dick et al. 1998). The typical foamy macrophages having lipid bodies, LB surrounded by Mtb 12 bacilli and intracytoplasmic lipid within M. tuberculosis bacilli have been shown in fig 1.4 Figure 1.4: (A) Typical foamy macrophage having lipid bodies (LBs) and M. tuberculosis containing phagosomes: arrows depict phagosomal membrane around bacterium. (B) LB surrounded by several M. tuberculosis bacilli intracytoplasmic lipid (ILIs) (C) Enlarged view of (B) showing large intracytoplasmic lipid within M. tuberculosis bacilli [Adapted from (Peyron, Vaubourgeix et al. 2008)] In addition to attention drawn on the foamy macrophages, ILI accumulation has also been reported in M. tuberculosis infected adipocytes as well as in Mycobacterium leprae infected macrophages and Schwann cells (Mattos, Lara et al. 2011). Further biochemical analysis and associated experimentation has revealed that M. tuberculosis lipid inclusion bodies mainly comprise of triacylglycerol (TAGs). These TAGs are derived from free fatty acids that may 13 be imported from host or result from denovo synthesis (Daniel, Maamar et al. 2011). The pattern indicated that Triacylglycerol (TAGs) accumulate during mycobacterial growth and the amount of intracellular TAGs peak in the late exponential growth phase (Kremer, de Chastellier et al. 2005) and nonreplicating phase (Daniel, Deb et al. 2004). Further it has also been shown that the expression of M. tuberculosis specific lipase gene family is significantly elevated during dormancy (Deb, Daniel et al. 2006) and that in the re-activated bacilli, a reduction in triacylglycerol (TAG) levels coincides with an increase triacylglycerol (TAG) lipase activity (Low, Rao et al. 2009). Thus lipid metabolizing enzymes (esterases/lipases) appear to play an important central role and associate with important physiological functions and also contribute to the extraordinary capacity of survival of M. tuberculosis within the infected host. These enzymes are peculiar molecules that provide a metabolic turnover of lipids and can be defined as essential biocatalysts for the hydrolysis of esters containing long chainfattyacids. 1.2. Esterases/Lipases in physiopathology and disease progression Pathogenic bacteria have been known to follow a number of mechanisms and pathways to cause and allow subsequent persistence of diseases in human hosts. The molecular strategies used by the bacteria to interact with the host can be unique and characteristic to specific pathogens, and follow conserved pattern across several different species. Hydrolytic enzymes like esterases/lipases contribute to invasiveness and proliferation by causing 14 destruction of the host tissue thereby supplying hydrolysed material to the organisms as nutrients. These esterases/lipases are one of the known and critical virulence factors in a host of bacterial species such as Pseudomonas cepacia, Staphylococcus aureus (Lonon, Woods et al. 1988, Rollof, Braconier et al. 1988) and also in fungal species like Alternaria brassicicola, Candida albicans and Fusarium graminearum (Berto, Commenil et al. 1999). M. tuberculosis is a bacterial pathogen that can persist in for decades in an infected patient in dormant state without causing symptoms or disease with clinically evident features. In fact, prior to entering into dormancy, it has been hypothesized that the bacteria accumulate lipids originating from the host cell membrane degradation as precursors and re-synthesize complex lipid molecules. Fluorescence studies (Garton, Christensen et al. 2002) have shown that large amounts of intracellular lipids forming inclusion bodies can be detected in the cytoplasm (Anuchin, Mulyukin et al. 2009) supporting the view that bacteria tends to accumulate lipids. The presence of lipid inclusions confers and indirectly correlates the existence of lipid metabolizing esterases/lipases. During the re-activation phase of the bacteria, these stored lipids are hydrolysed and the infection process acquires further impetus to demonstrate its detectable occurrence (Cotes, Bakala et al. 2008). What is interesting to mention here is that a critical link between storage-lipid accumulation and development of phenotypic drug resistance in M. tuberculosis has also been established and the findings of several studies on non-mycobacterial pathogens suggested the involvement of lipid metabolizing enzymes in pathogenicity. 15 In pathogenic bacteria, for example it has been shown that Mycobacterium tuberculosis Rv3097c (lipY) is able to hydrolyse long-chain triacylglycerol (TAG). The role of esterase Rv3487c (lipF) has been implicated in pathogenesis (Zhang, Wang et al. 2005). In addition, Rv0220 (lipC) has been reported to be an immunogenic cell-surface esterase actively involved in modulation of the host immune response (Shen, Singh et al. 2012). This entity Rv0220 (lipC) is also known to be capable of stimulating pro-inflammatory cytokines and chemokines in macrophages as well as to pulmonary epithelium cells (Shen, Singh et al. 2012). It is also important to mention that the lipase Rv0183 has been identified as a monoglyceride lipase involved in degradation of host cell lipids and may strongly induce immune responses of the host (Xu, Jia et al. 2010). Based on these facts, it can therefore be categorically stated that lipid metabolizing enzymes (esterases/lipases) are involved throughout the life-cycle of the pathogen and they assume important physiological role during dormancy and reactivation i.e. during the course of entire infection process. The released fatty acids by these enzymes are then taken up by intracellular mycobacteria and stored in the form of triacylglycerol (TAGs) to be subsequently used as sources of carbon during the persistence stage. Conversely, intracellular triacylglycerol hydrolases maybe required for assimilation of intra-cytoplasmic lipid inclusions to exit dormancy. 1.3 Esterases/Lipases Enzyme Classification System 1.3.1 Hydrolases (EC 3.) Are group of enzymes which catalyse the hydrolysis of a chemical bond. In general an enzyme capable of catalysing the following reaction is a hydrolase: 16 X–Y + H2O → X–OH + Y–H In the enzyme classification (EC) number system, they have been classified as EC 3. Hydrolases can be further classified into several subclasses based upon the bonds they act upon, for example, ester hydrolases, peptidases, amidases etc. 1.3.2 Carboxyl ester hydrolases (EC 3.1.1) This group of enzymes act on ester substrates mainly derived from the condensation reaction of a carboxylic acid and an alcohol. Members of this group have been classified chronologically based on their known substrate specificity (fig.1.5) into two major classes: carboxyl esterases (EC 3.1.1.1) and triacylglycerol (TAG) lipases (EC 3.1.1.3). 17 (from previous page) Figure 1.5: Esterases’ classification based on 1 : Physico-chemical; 2 : chemical criteria (L means lipolytic those enzymes capable of acting on lipid while NL: non-lipolytic those enzymes which do not act on lipids ) (EC is the enzyme classifier ) [Source: adapted from (Ali, Verger et al. 2012)] 1.3.3 Carboxyl esterases (EC 3.1.1.1) This group of enzymes shows diverse substrate specificity and catalyse the hydrolysis of ester bond of acyl chain esters forming a carboxylic acid and an alcohol. RCOOR + H2O → Carboxylic ester Water R–COOH Carboxylic Acid + R–OH Alcohol Most members of this group are hydrolases especially those involved in the hydrolytic cleavage of carboxylic ester bonds are found to share a common alpha/beta (α/β) hydrolase folding pattern. Enzymatic assays using chromogenic substrates such as acyl esters of p-nitrophenol (pNP) allow for the spectroscopic and calorimetric determination of esterase activity. 1.3.4 Triacylglycerol (TAG) Lipases (EC 3.1.1.3) They constitute a special class of carboxyl esterases (Ali, Verger et al. 2012) capable of releasing long-chain fatty acids from natural water-insoluble esters (lipids) as depicted below: TAG Lipase Triacylglycerol Water Glycerol Fatty Acid 18 In bacterial species such as Mycobacteria, Pseudomonas, Burkholderia TAG lipases have been shown to completely hydrolyse triacylglycerol substrates although ester bonds are more preferable (Jaeger et al., 1994) and they possess both lipolytic as well as esterolytic activity. Bacterial TAG lipases have also been found to share a common alpha/beta (α/β) hydrolase folding pattern. A large number of enzymatic assay methods using fluorescent substrates allow for the fluorimetric and spectroscopic detection of lipase activity. 1.4 Alpha/Beta (α/β) Hydrolase fold family The alpha/beta (α/β) hydrolase fold is considered to be a common characteristic to a number of hydrolase enzymes of largely different phylogenetic origin and catalytic function (Ollis, Cheah et al. 1992). Each enzyme has a conserved alpha/beta (α/β) hydrolase core (fig.7b) consisting of alpha/beta sheet having 8 strands connected by helices. They all have a similar arrangement of a catalytic triad composed of nucleophilic serine charge relay network aspartate and proton carrier histidine (shown in fig.1. 6) which are the best-conserved structural features in the fold. The canonical α/β hydrolase fold is an eight-stranded and mostly parallel α/β structure (figure 1.6), (1.7a&b) (Ollis, Cheah et al. 1992). Ser His Asp β 1 β 2 β 4 β 3 β 5 β 6 β 7 β 8 COOH H2 N Figure 1.6: Topology diagram of α/β hydrolase fold enzymes α Helices and β strands are represented by black spheres and arrows, respectively while catalytic triad members are highlighted by black star and triangles. 19 Figure 1.7: (a) 3D structure of Pseudomonas fluorescens carboxyl esterase (PfCES) belonging to α/β hydrolase fold family revealing mostly-parallel β sheets. (b) Superposition of the conserved α/β hydrolase core of 9 representative α/β hydrolase fold enzymes (Source: Heikinheimo et. al, 1999) The enzymes adopting alpha/beta hydrolase fold share no significant sequence similarity suggestive of a divergent evolution from a common ancestor. The members of alpha/beta (α/β) hydrolase fold family include: hydrolases, esterases, lipases, proteases, peroxidases, dehalogenases. 1.4.1 Alpha/Beta (α/β) Hydrolase fold family in Mycobacteria Most members of the alpha/beta (α/β) hydrolase fold family are esterase/lipase enzymes that catalyse ester hydrolysis reactions (Schrag et al., 1997, Nardini et al., 1999). In Mycobacterium tuberculosis, out of the 250 genes encoding putative enzymes involved in lipid metabolism, 94 gene products would have the characteristic alpha/beta (α/β) hydrolase fold (Hotelier, Renault et al. 2004), ESTHER database http://bioweb.ensam.inra.fr/esther) of which 47 are 20 annotated as esterases (ester hydrolases) and also including 24 lipid/ester hydrolase belonging to lip family (lipC to lipZ) (Cole, Brosch et al. 1998). The total M. tuberculosis functionally annotated genes and α/β hydrolase fold distribution in M. tuberculosis are shown in fig.1.8 (a&b). (a) (b) M. tuberculosis α/β hydrolase fold (94 annotated genes) M. tuberculosis annotated genes Figure 1.8: (a) Total M. tuberculosis functionally annotated genes. (b) 94 α/β hydrolase fold distribution in enzymes involved in mycobacterial lipid metabolism having 250 lipid encoding genes [http://bioweb.ensam.inra.fr/esther]. Overall alpha/beta (α/β) hydrolase fold family members in Mycobacteria are mainly esterases/lipases suggesting an important structural link of this family of enzymes in mycobacterial lipid metabolism. 21 1.4.2 Mycobacterial Lipase gene family This sub-family of alpha/beta (α/β) hydrolase fold family comprises of 24 genes annotated as putative esterases/lipases (lipC to LipZ) genes (Cole, Brosch et al. 1998) and all pose a catalytic triad with active site as nucleophilic serine showing a characteristic G-X-S-X-G sequence motif and are typically involved in various biological processes. Their probable function has been represented and listed in: Table 1.2 Probable functions and identities of Mycobacterial lipase gene family enzymes Protein Gene Mol wt. Activity type Active site Biological function References lipC BCG 0257 (Rv02 20) 44.3 Probable esterase (77% αβhydrolase) GCSAG Low TG lipase activity, induced under hypoxic resuscitation (Deb, Daniel et al. 2006) Carboxyl esterase type B, Upregulated in starvation (Singh, Singh et al. 2010) Located in cell wall and capsule, elicit strong immune response, expresses only during active tuberculosis, hydrolyze short chain esters lipD BCG 1962 (Rv19 23) 47.2 Probable esterase/βlactamase (69% βlactamase) A hydrolase lipase similar to esterases and betalactamases Role in defence 22 lipE lipF BCG 3837 (Rv37 75) 45.3 BCG 3551c (Rv34 87c) 29.4 Caboxyl esterase (79% βlactamase) Caboxyl esterase (75% αβhydrolase) Lipolytic enzyme involved in cellular metabolism (Deb, Daniel et al. 2006) Defense mechanism, Induced under hypoxic resuscitation GDSAG Member of Hormone sensitive lipase family. (Zhang, Wang et al. 2005) Non-lipolytic hydrolase, hydrolyze short chain esters (Richter and Saviola 2009) Induced at low pH, related to virulence No TG lipase activity, intermediary metabolism and respiration (Camacho, Ensergueix et al. 1999) Important for bacilli persistence lipG BCG 0695c (Rv06 46c) 32.9 Probable hydrolase (80% αβhydrolase) GASMG Membrane protein, hydrolyzes short chain esters /phosphatidylcholi ne (Deb, Daniel et al. 2006) Lipolytic enzyme, involved in cellular metabolism, highly similar to various hydrolases, especially lipases from Acinetobacter calcoaceti (Deb, Daniel et al. 2006) 23 lipH BCG 1460c (Rv13 99c) 33.9 Possible lipase (70% αβhydrolase) GWSLG Member of Hormone sensitive lipase family. lipid transport and metabolism Non-lipolytic esterase lipI BCG 1461c (Rv14 00c) 34.0 Probable lipase (69% carboxyles terase family) GDSAG (Deb, Daniel et al. 2006) (Canaan, Maurin et al. 2004) A probable lipase invloved intermediary metabolism and respiration, Member of Hormone sensitive lipase family. Intermediary metabolism and respiration lipJ BCG 1939c (Rv19 00c) 49.7 Putative lignin peroxidase (75% αβhydrolase) Alkaloid biosynthesis II lipK mbtJ, BCG 2399 (Rv23 85) 32.9 Probable acetyl hydrolase (71% αβhydrolase) Intermediary metabolism, Low TG lipase activity (Deb, Daniel et al. 2006) lipL BCG 1560 (Rv14 97) 45.8 Probable esterase (70% βlactamase) Transpeptidase, Beta-lactamase class C (Deb, Daniel et al. 2006) Intermediary metabolism and respiration, Low TG lipase activity 24 lipM BCG 2299 (Rv22 84) 46.7 Probable esterase (78% αβhydrolase) GGSAG Involved in intermediary metabolism and respiration, predicted transmembrane protein (Gu, Chen et al. 2003) Lipid transport and metabolism BCG 2991c (Rv29 70c) 40.1 Lipase like GDSAG enzyme (77% αβhydrolase) Member of Hormone sensitive lipase family. lipO BCG 1487c (Rv14 26c) 46.1 Probable esterase (79% αβhydrolase) Lipid transport and metabolism lipP BCG 2483 (Rv24 63) 42.8 Probable esterase (76% βlactamase) lipQ BCG 2503c (Rv24 85c) 45.2 Carboxyle sterase (74% αβhydrolase) GGSAG Intermediary metabolism and respiration lipR BCG 3109 (Rv30 84) 32.6 Probable acetylhydrolase/ esterase (68% αβhydrolase) GDSAG Member of Hormone sensitive lipase family. lipN GGSAG Lipid transport and metabolism Involved in defense mechanism (Fisher, Plikaytis et al. 2002) Based on sequence analysis belongs to 'GDXG' family of lipolytic enzymes, Domain search reveals it contains a partial Thioesterase 25 lipS mesT 35.2 a, BCG3 201c (Rv31 76c) Probable epoxide hydrolase (99% amidase) lipT BCG 2064c (Rv20 45c) Probable carboxyles terase (71% carboxyles terase) 56.1 Virulence, detoxification and adaptation GESAG Converts unknown esters to correspondinf free acid and alcohol, a probable carboxyesterase, Contains Carboxylesterases type-B serine active site. (Betts, Lukey et al. 2002) (Deb, Daniel et al. 2006) Member of Hormone sensitive lipase family. Lipid transport and metabolism, Upregulated in starvation Induced under hypoxic resuscitation lipU BCG 1134 (Rv10 76) 31.7 Probable lipase (76% αβhydrolase) GDSAG Member of Hormone sensitive lipase family. (Betts, Lukey et al. 2002) αβ-hydrolase, Upregulated in starvation 26 lipV BCG 3229 (Rv32 03) 23.6 Probable lipase (71% αβhydrolase) GHSFG Presumed to be a lipolytic enzyme, Contains serine active site signature of lipases. Contains TAG lipase signature as well. Intermediary metabolism and respiration lipW BCG 0254c (Rv02 17c) 32.2 Esterase (75% αβhydrolase) GASAG Lipolytic enzyme involved in cellular metabolism, Possible esterase, showing similarity with others esterases Alkaloid biosynthesis II lipX PE11, BCG 1232c (Rv11 69c) 10.8 PE family protein, Esterase/li pase (73% αβhydrolase) lipY PE30, BCG 3122c (Rv30 97c) 45.0 PE-PGRS family, Membrane associated TG lipase (99% PEPGRS family) GDSAG Hydrolase or acyltransferase, Upregulated in starvation (Betts, Lukey et al. 2002) Member of Hormone sensitive lipase family. (Mishra, de Chastellier et al. 2008) TG lipase activity, mutant has less TG degradation, Lipid transport and metabolism, induced under hypoxic resuscitation 27 lipZ BCG 1869 (Rv18 34) 31.6 Probable hydrolase (76% αβhydrolase Unknown function (Deb, Daniel et al. 2006) 1.4.2.1 Hormone-sensitive lipase sub-family (HSL) The hormone sensitive lipases are also known as triacylglycerol (TAG) lipases wherein their main function is to hydrolyse first fatty acid of triacylglycerol thereby yielding a diacylglycerol and a free fatty acid. They are, in turn, highly regulated enzymes catalysing the hydrolysis of lipids in adipocytes. In silico sequence analysis of mycobacterial lipase gene family members show significant sequence homology with hormone-sensitive lipase family having a characteristic HGG motif and a conserved active-site motif GDSAG. There are also 12 mycobacterial lipolytic enzymes which belong to the hormonesensitive lipase family of which 8 are derived from lip gene family namely lipF (Rv3487c), lipH (Rv1399c), lipI (Rv1400), lipN (Rv2970), lipR (Rv3084), lipT (Rv2045c), lipU (Rv1076), lipY (Rv3097c) and are of high functional importance. 1.5 Issues and Problems with functional Mycobacterial putative Esterases/Lipases characterization of A literature survey of the studies conducted in the past revealed that they were aimed at the functional characterization of mycobacterial esterases/lipases and reflects that the following issues and problems need to be addressed: 28  Expression of mycobacterial esterase/lipase enzymes in their nonnatural (non-mycobacterial) expression systems such as E. coli.(Deb, Daniel et al. 2006)  Active conformation of enzymes lost after the purification step and consequently re-folding in E. coli (Canaan, Maurin et al. 2004).  Mycobacterial esterase/lipase enzymes such as Rv1399c (lipH) and Rv1400c (lipI) are insoluble and reported to form inclusion bodies (Canaan, Maurin et al. 2004).  Poor solubility of mycobacterial esterase/lipase makes it difficult to obtain an X-ray crystal structure. By far, only one 3D structure has been solved of mycobacterial esterase (lipW) (PDB ID: 3QH4) belonging to the lipase gene family. 1.6 Tetrahydrolipstatin (Orlistat) Commonly called Orlistat and marketed by Roche pharmaceutical company under the name of Xenical is a semisynthetic hydrogenated derivative of naturally occurring lipase inhibitor lipstatin produced from Streptomyces toxytricini (Hochuli, Kupfer et al. 1987). It has been well characterized as an irreversible inhibitor of serine esterases (Hadvary, Lengsfeld et al. 1988) covalently modifying its biological target. It was identified originally as a specific inhibitor of pancreatic lipases and later developed as an anti-obesity drug. The inhibitor has a reactive β- lactone ring (Fig.1.9) leading to an ester 29 N-formylleucine Hexyl-malonic acid 3-hydroxytetradeca-5,8-dienoic acid Figure 1.9: Chemical Structure of Tetrahydrolipstatin (Orlistat): arrow depicting the β lactone ring in the chemical structure Serine hydroxyl group of the catalytic triad of esterase/ lipase (Hadvary et al., 1988). 1.6.1 An FDA approved anti-obesity drug Orlistat was introduced in the pharmaceutical market by Roche under the name of ‘Xenical’ launched in the year 1998, was approved by the Food and Drug Administration (FAD), USA in 1999; it was represented as a ‘magic medicine’ for control of obesity for the sole reason that it inhibits potently and specifically breakdown of dietary triglycerides into absorbable fatty acids and monoglycerides (Cudrey, van Tilbeurgh et al. 1993) thereby resulting into 30% fat absorption and hence consequential weight loss. 1.6.2 An anti-cancer agent Recent studies have demonstrated that tetrahydrolipstatin (Orlistat) possess antitumor properties to prostate cancer cells due to its ability to induce inhibition of thioesterase domain of human fatty acid synthase (FAS) lipogenic activity which is found to be significantly up-regulated in many tumors and is an indicator of poor prognosis (Menendez, Vellon et al. 2005) 30 (Menendez et al., 2005). For example, 50% of breast cancers exhibit high expression levels of FAS. THL eliminates tumour cells by inducing apoptosis. 1.6.3 An anti-mycobacterial agent In mycobacteria it has been shown that tetrahydrolipstatin (Orlistat) interferes with the cell wall formation of mycobacteria by decreasing mycolic acid synthesis (Kremer, de Chastellier et al. 2005), leading to a defective mycobacterial cell wall. Tetrahydrolipstatin is shown to inhibit Rv3802c an essential cell wall lipase enzyme which is probably involved in the mycolic acid biosynthetic pathway. Therefore tetrahydrolipstatin (THL) eliminates both mycobacterial and tumor cells by interfering with the lipid metabolism. 1.7 Aims and Objectives of the present study: Carboxyl ester hydrolases (EC 3.1.1) comprising of evolutionarily related enzymes mostly belonging to hydrolases superfamily sharing a common α/βhydrolase protein fold and even though recent studies have revealed the findings suggestive of their pivotal role in disease manifestation by way of disruption of lipid metabolizing enzymes esterases/lipases and their pathways, yet only very few have been functionally annotated. This study therefore focuses attention on 4 putative mycobacterial lipases/esterase namely BCG_1460c (lipH probable lipase), BCG_2991c (lipN probable lipase/esterase), BCG_2950 (tesA probable thioesterase) and BCG_3229 (lipV possible lipase) with the following objectives: 31 1. To explore computational enzymology as an effective tool for In silico characterization of mycobacterial putative esterases/lipases and identifying potential inhibitors. 2. To investigate structural features of mycobacterial putative esterases/lipases and distinguishing lipolytic and non-lipolytic enzymes at the structural level itself. 3. In vitro biochemical characterization of Mycobacterial esterases/lipases and experimental validation of in silico predictions. 32 2. Materials and Methods 2.1 Molecular modelling 2.1.1 Sequence analysis: The sequences of BCG_1460c (lipH probable lipase) (Uniprot Id: A1KII8), BCG_2991c (lipN probable lipase/esterase) (Uniprot Id: A1KMW4), BCG_2950 (tesA probable thioesterase) (Uniprot Id: A1KMS3) and BCG_3229 (lipV possible lipase) (Uniprot Id: A1KNK2) and their representative homologs were collected from the Uniprot database and multiple sequence alignments were performed using ClustalW (Larkin, Blackshields et al. 2007). This was found on the website [http://www.ebi.ac.uk/Tools/msa/clustalw2/] to identify the catalytic triad position, motifs and amino acid conservation. 2.1.2 Comparative modelling: Structural homologs were identified using protein BLAST (Basic Local Alignment Search Tool) [ http://blast.ncbi.nlm.nih.gov/] against Protein Data Bank (PDB) database and were selected as templates based on the highest sequence identity presented. Swiss PDB viewer was used to thread the protein sequence on its structural homologs using MUSCLE package of Swiss PDB viewer (Guex and Peitsch 1997) and thereafter initial structural alignments were generated. Most favourable rotamers were added to the structure using the rotamer library embedded in Swiss PDB viewer and a modelling request was submitted to Swiss model server [http://swissmodel.expasy.org/]. There were top ten models generated for each protein and validated using 4 different 33 validation soft wares on NIH MBI Laboratory for Structural Genomics and Proteomics [http://nihserver.mbi.ucla.edu/SAVES/]. The evaluation of native protein fold on validated 3D structure models was performed using ProSA program (Wiederstein and Sippl 2007) and were further refined by fragmentguided molecular dynamic simulations FG-MD program (Zhang, Liang et al. 2011) located at [http://zhanglab.ccmb.med.umich.edu/FG-MD/]. The refined model was energy minimized with GROMACS 4.0.7 package [http://www.gromacs.org/]. The resulting models were found to be energetically stable. The schematic representation of the steps involved in comparative modelling has been shown in figure 2.1 Figure 2.1: Schematic diagram of steps involved in Molecular modelling (Source: adapted from http://swift.cmbi.ru.nl/teach/EMHOMX/EMBMOD_1.html) 34 2.2 Molecular Dynamics Simulations: Protein stability of the energy minimized models in a solvent system was assessed using molecular dynamics simulations and periodic boundary conditions were applied to the structures in three dimension. By adding the sodium ions and replacing the water molecules that are 3.5 Å from the protein surface, the net charge of the system was neutralized. Simulations were run for 100 pico seconds with the solvent being equilibrated by a harmonic force constant 100 KJ nm-2 and the solute atoms were restrained. A production run of 10 nano second was used to check for the stability of protein models which is a plot of root mean square deviation of the backbone structure versus time. All simulations were performed at 300K temperature with velocity rescaling thermostat using Parrinello-Rahman barostat. The pressure was maintained at 1 atmosphere and the long-range electrostatic interaction with cut-off 12 Å was calculated using Ewald (PME) summation method while the hydrogen bonds in the atoms were constrained with the linear constraint solver (LINCS) algorithm (Hess, Bekker et al. 1997) and (Hess 2007). 2.3 Virtual Ligand Screening: Computational docking of ligands in protein 3D structure model was performed using Autodock Vina (Trott and Olson 2010). All essential hydrogen atoms, solvation parameters and the united atom charges were added using the help of AutoDock tools (Morris, Goodsell et al. 1998). Affinity grid maps were constructed via and with the aid of Autogrid program. The Vander Waals and electrostatic calculations were done using distance dependent 35 dielectric functions and parameters set functions of Autodock Vina. Computational docking simulations have been performed using the Lamarckian genetic algorithm and local search method (Solis and Wets, 1981). The initial orientations, position, torsion angles of ligands were set randomly and during docking all rotatable torsions were released. For every docking experiment, 500 independent docking runs were performed involving 30000 maximum energy evaluations and the population size was set to 200. The ligand 2D-structures were drawn in ChemDraw and the 3D structures of ligands were constructed with BUILDER module of molecular modelling program Insight-II assigning standard geometric parameters. The atomic charges were assigned to ligand using Amber potential. These ligands were then subjected to force field until the root mean square energy gradient became less than 0.005 Kcal/mol. All hydrogen atoms were added to the 3D structure models and Amber all-atom charges were assigned to the whole protein. The active site was then analysed using the CASTp program (Dundas, Ouyang et al. 2006) to recognize and characterize accessible pockets in the protein 3D model based on two parameters: the solvent accessible surface and the molecular surface. The active site was defined within a radius of 25 Å which covered 94% of the total residues in the protein ensuring that the size of the active site is sufficiently large enough to accommodate the whole ligand binding pocket and also allow for rotation and translation of ligands. The schematics of computational docking are shown in fig.2.2 36 Figure 2.2: Schematic diagram of Computational Docking (Source: (Jacob, Andersen et al. 2012)) 37 2.4 Bacterial strains and cultures 2.4.1 Bacterial Strains M. bovis BCG Pasteur strain (ATCC 35734) and M. smegmatis (mc2155) were used in the experiments. 2.4.2 Bacterial Culture Media Cultures of mycobacteria were grown under aerobic conditions. Inoculum was prepared from colony of growing cells and pre-culture was grown in 7H11 media. Aerobic M. bovis BCG were grown in roller bottles with initial OD (optical density) measured at 600nm (OD600) of 0.5. The roller culture bottles were rotated at 1rpm for three days. Middlebrook 7H11: The mycobacterial cultures were grown using this culture media. Middlebrook 7H11 (Biomed Diagnostics, BD Difco Mycobacteria 7H11 Agar, Catalogue No. 283810) supplemented with 10% oleic aciddextrose-albumin-catalase enrichment and 0.5% of glycerol (Biomed Diagnostics, BD Difco Middlebrook OADC Enrichment catalogue no.212351) at 37 °C. Whenever required, antibiotics were added to the M. bovis BCG culture media with the following concentrations: kanamycin (Sigma-Aldrich, USA) at 25 µg/ml and hygromycin (Roche,Germany) at 80 µg/ml . Middlebrook 7H9 broth: This liquid media was used for growing mycobacterial cultures. The Middlebrook 7H9 (Biomed Diagnostics, BD Difco Mycobacteria 7H9 Broth, Catalogue No. 2713100) supplemented with 0.2% glycerol, 0.05% Tween-80 and 10% (v/v) Albumin-Dextrose-Saline (ADS: 950ml dH20, 8.1g NaCl, 50g Bovine Serum Albumin Fraction V, 20g 38 D-dextrose). The whole medium was filter sterilized with o.22µM filter and stored at 4°C until further use. 2.4.3 Glycerol stock of bacteria M.bovis BCG and M. smegmatis: Glycerol stocks of cultures were prepared by re-suspending in Middlebrook 7H9 broth containing 25% glycerol (v/v) and stored as 0.5ml aliquots at -80ºC. 2.5 Cloning Procedures 2.5.1 Genomic DNA Isolation (Mycobacteria) The mycobacterial cells were grown to an OD of 0.8 (measured at 600nm), cells were then harvested by centrifuging at 3000g for 10mins at 4°C, washed with PBS-T (0.05% of Tween-80). The pellet obtained was re-suspended in 600µL buffer having 3% SDS, 1mM Tris-HCL with 100Mm sodium chloride. Cells were transferred to tubes having silica beads (0.1mm in diameter) and then displaced using bead beater at 50rpm for 5mins at 4°C. Mixture of phenol/isoamyl alcohol/chloroform in the ratio (49:2:49 v/v/v) was added and then final volume made up to 2 X. Upon centrifuging at 16,000g for 5mins at 4°C the aqueous phase was collected then washed using 500µl of 70% ethyl alcohol. Supernatant was then recovered pellet was dried at room temperature for 10mins. Precipitated DNA pellets were then re-suspended in 100µl of TE buffer and then storing it at 20°C until further use. 39 2.5.1 Preparation of Over-expression Plasmids The putative esterases and/or lipases genes namely, BCG_1460c (lipH probable lipase), BCG_2991c (lipN probable lipase/esterase), BCG_2950 (tesA probable thioesterase) and BCG_3229 (lipV possible lipase) were amplified by using PCR with genomic DNA isolated from M. tuberculosis H37Rv with primer details as given below: Primers used for gene cloning and amplification BCG_1460c Forward GCAGATCTATGACCAAGAGTCTGCCAGGT (lipH) Reverse GCAAGCTTTTATGCGTGCAACGCCCTCTT BCG_2991c Forward GCAGATCTATGACCAAGAGTCTGCCAGGT (lipN) Reverse GCAAGCTTTCAAACCCGGCTAAGGTGCGC BCG_2950 (tesA) Forward GCAGATCTATGCTGGCCCGTCACGGACCA Reverse BCG_3229 (lipV) GCAAGCTTCTAAGCTCGATCATGCCATTG Forward GCAGATCTTTGCCCGAAATCCCCATCGCC Reverse GCAAGCTTCTAGCGCGGACCCAGTCGACT Note: Restriction sites are underlined: forward BglII; reverse HindIII The BglII and HindIII sites of the E.coli-Mycobacterium shuttle vector pMV262 were inserted with PCR fragments under a constitutive HSP60 promoter. 40 2.6 Mycobacterium bovis BCG competent cell preparation, transformation (electroporation) and selection of transformants Inoculum from growing BCG cells was grown in 7H9 broth media (no antibiotics) the culture was grown to ~0.8 optical density (OD600). The culture was centrifuged at 3700rpm and cells were re-suspended in 1ml of 0.05% tween80. 200 µl aliquot was stored at -80ºC. M.bovis BCG cells grown up to an OD600. Cuvettes (Biorad ) with an electrode gap of 2mm were used for electroporation and 1µl of plasmids was added to each cuvette and mixed gently. Using Biorad gene pulser Xcell and pulsed at 2500V, 800 ohms, 25µF transformants carrying the plasmids were selected on 7H11 plates containing suitable antibiotic (hygromycin) the plates were left at 37 ºC to allow for colonies to appear and thereafter an incubation period was allowed for four weeks to have them grown until a visual turbidity was reached. 2.7 Preparation of Whole cell lysate (WCL) The mycobacterial cultures were grown on Middlebrook 7H11 (Biomed Diagnostics, BD Difco Mycobacteria 7H11 Agar, Catalogue No. 283810) supplemented with 10% oleic acid-dextrose-albumin-catalase enrichment and 0.5% of glycerol) (Biomed Diagnostics, BD Difco Middlebrook OADC Enrichment catalogue no.212351) for four weeks. Bacterial colonies were harvested and washed thrice with phosphate buffered saline with tween80 (PBST) and cells were vortexed. Bacterial cells were lysed using probe sonicator with the following parameters: 60% amplitude, 5 mins, 10 seconds 41 pulse on 5 seconds off and the lysed cells were centrifuged at 14000rpm; protein was estimated using the Lowry’s protein estimation method. 2.8 Fluorescent click chemistry Samples were prepared for click reaction by washing the M. bovis BCG cells with phosphate buffered saline with tween80 (PBST) thrice and once with phosphate buffered saline (PBS) and centrifuged at 3500g for 15 minutes at 4 ºC thereafter lysed in phosphate buffered saline (PBS) at 50% amplitude. 100µg of protein was used for the reaction in which drug was incubated with protein. The amounts of reagents used for each reaction have been described in table 2.1. After incubation; samples were prepared for gel electrophoresis run. Table 2.1 Click reaction 2.9 Gel Electrophoresis Samples were prepared for the gel run by adding 600 µl of acetone and left at -20 ºC for 24 hours cells were centrifuged at 14,000 rpm then washed with 200 µl of methanol. Subsequently, cell lysis was done using sonicator with the following parameters: 60% amplitude, 5 mins, 10 sec pulse on/ 5 sec off after cell lysis 50 µl of SDS dye was added and boiled at 95 ºC for 5 mins. Equal amounts of 10 micro gram protein was separated on 12% SDS-polyacrylamide gel, ran at 120 V for 110 mins followed by in-gel fluorescence scanning with Typhoon 9410 Variable Mode Imager scanner (GE Amersham, UK) . The cyc3/cyc5 scan protocol adopted was as follows: 3*108 cells for each staining 42 and washed once with phosphate buffered saline with 0.05%tween80 (PBST) and centrifuged at 3000g for 5mins at 4 ºC. Subsequently washed with phosphate buffered saline (PBS) after which 10ng of LD540 dye was added and incubated for 10 mins at room temperature. 500µl of 4% formaldehyde was added and tubes were centrifuged at 3000g for 5mins at 4 ºC. Cells were again washed with phosphate buffered saline (PBS) and permealized with 500 µl of 0.25% Triton-X 100 in PBS for 15 mins . 2.10 Enzymatic Assays The enzymatic assays were performed with whole cell lysates of BCG cells overexpressing proteins BCG_2991c (lipN probable lipase/esterase), BCG_2950 (tesA probable thioesterase) and BCG_3229 (lipV possible lipase) using p-nitrophenyl (pNP) esters (Sigma Aldrich) with carbon chain lengths of C2, C4 and C16. The pNP release was measured at 400nm by using a 96 well plate spectrophotometer. The enzymatic reaction was performed with 225µl of NaDC tris buffer (Tris 15.14mg, Nacl-0.8766g, Sodium deoxycholate -1mM (20.7mg) measured and dissolved in 25ml of milliq water and the pH of the whole medium was adjusted to pH 8.0). This was added to each reaction along with 2.5µg/µl of protein concentration and 1mM of pnP-C2/C4/C16 substrate incubated for 30mins at 37 ºC. The final volume of each well was kept at 250 µl and the absorption was measured at 400nm using a 96 well plate spectrophotometer and readings were recorded at 0, 1, 2.5, 5 and 10 minutes time points. All reactions were performed in triplicates. The schematics of pNP assay are depicted in fig.2.3 43 Figure 2.3: Scheme of pNP Assay Table 2.2 Concentrations of reagents used Enzymatic assay of M. bovis overexpressing clones using pnitrophenylphosphate C2/C4/C16 as substrate Stock Conc. Working conc. Volume Buffer - - 225µl Overexpression protein whole cell lysate - 2.5µg 1µl pNP substrate 10 mM 1 mM 25 µl 2.11 Inhibitor assays Fresh stock of frozen cells at -80 ºC was used for every experiment. The vials were thawed in ice for 30 minutes and fresh substrate p-nitrophenol butyrate (pnP-C4) used in the inhibition experiments was prepared to 1mM concentration (dissolving 2µl of pnP-C4 in 9.7ml of dimethyl sulfoxide), buffer NaDC tris buffer ( Tris 15.14mg , Nacl-0.8766g, Sodium deoxycholate -1mM (20.7mg) measured and dissolved in 25ml of milli-Q water and the pH of the whole medium was adjusted to pH 8.0). 225 µl of NaDC tris buffer, 2.5µg of protein and different concentrations of inhibitors such as THL 44 (tetrahydrolipstatin) E600 (diethyl-p-nitrophenylphosphate) was used from .01µM to 100µM (volume kept at 1µl) were added to each well of 96 well plate. DMSO (dimethyl sulfoxide) concentration was maintained at 0.004% in each well, incubation time was 30 mins at 37 ºC and the absorption was measured at 400nm using a 96 well plate spectrophotometer. Measurement readings were recorded at 0, 1, 2.5, 5 and 10 minutes time points. All reactions were performed in triplicates. The template indicating the component of each well of the 96 well plate has been shown in figure 2.4 Figure 2.4: Template design of a 96 well plate used for Inhibitor assays 45 3. Results 3.1 Molecular modelling of protein 3D structures In order to understand the insight as well as structural details and characterize four putative esterases/lipases belonging to (α/β) hydrolase family viz. BCG_1460c (lipH probable lipase), BCG_2991c (lipN probable lipase/esterase), BCG_2950 (tesA probable thioesterase) and BCG_3229 (lipV possible lipase), a computational prediction of their ligand specificity for catalytic triad was performed. 3D model structures were generated using molecular modelling protocol, at first we validated the molecular modelling protocol by predicting in silico the 3D structure of protein named thioesterase domain of fatty acid synthase (Human FAS-TE) (Protein Databank ID: 2PX6) whose X-ray 3D structure is well known this acted as our positive control. Molecular overlay of the modelled 3D structure with known 3D structure of FAS-TE (figure 3.1 (a)) revealed that in silico modelled FAS-TE structure could mimic the known FAS-TE structure reasonably well with a carbon alpha backbone (Cα) root mean square deviation (rmsd) of 0.192Å (figure 3.1b) and an acceptable statistics in Ramachandaran plot (Suplatov, Besenmatter et al. 2012). The 3D model structure of BCG_1460c (lipH probable lipase) was generated based on structural homologues of 3 thermophilic esterases with significant sequence identity in the range of 40 to 44% namely Alicyclobacillus acidocaldarius (carboxyl esterase Est2) (Protein data bank ID: 1U4N) with 44% sequence identity, Archaeoglobus fulgidus (carboxyl esterase AFEST) (Protein data bank ID: 1JJI) with 41% sequence identity and bacterial acetyl esterase (HerE) (Protein data bank ID: 1LZL) had 40% 46 sequence identity. It was also revealed that BCG_2950 (tesA probable thioesterase) has 2 bacterial thioesterases structural homologues with sequence identity in the range of 31-33% namely Streptomyces coelicolor (Thioesterase) (Protein data bank ID: 3QMV) having 33% sequence identity and thioesterase from Amycolactopsis mediterranei (Protein Data Bank ID: 3FLB) had 31% sequence identity with protein sequence of BCG_2950 (tesA probable thioesterase). For BCG_2991c (lipN probable lipase/esterase) the BLAST searches found that it has structural homologs in 2 carboxyl esterases with sequence identity ranging from 39% to 41% : Hormone sensitive lipase-like Carboxylesterase from Sulfolobus Tokodaii (Protein data bank ID: 3AIO) (41%) , carboxyl esterase (Est2) Alicyclobacillus acidocaldarius (Protein data bank ID: 2HM7) (39%) while BCG_3229 (lipV possible lipase) shows structural homologs in the sequence identity range of 27% to 31% with two esterases: thioesterase domain from Curacin biosynthetic pathway (Protein data bank ID: 2HM7) (31%) and Rv0045c from Mycobacterium tuberculosis (Protein Data Bank ID: 3P2M). (a) (b) 47 Figure3.1: (a) 3D structure Overlay of FAS-TE modelled structure over FAS-TE known X-ray 3D structure in protein data bank (2PX6) (b) Cα – backbone overlay r.m.s.d 0.192Å (red: in silico modelled 3D structure, yellow: X-ray known 3D structure Protein Databank ID: 2PX6) (a) (b) (c) (d) M Figure3.2 3D structure models: (a) BCG_2950 (tesA probable thioesterase) (b) BCG_1460c (lipH probable lipase) (c) BCG_2991c (lipN probable lipase/esterase) (d) BCG_3229 (lipV possible lipase) 48 The 3D structure models (figure 3.2) indicated that all 4 putative esterases/lipases namely BCG_1460c (lipH probable lipase), BCG_2991c (lipN probable lipase/esterase), BCG_2950 (tesA probable thioesterase) and BCG_3229 (lipV possible lipase) are globular proteins similar to other alpha/beta (α/β) hydrolase enzymes and consist of 11 α- helices and a central β-sheet core containing 6 parallel β- strands. The GXSXG motif characteristic of esterases/lipases was found to be conserved in all 4 enzymes viz. BCG_1460c (lipH probable lipase), BCG_2991c (lipN lipase/esterase), BCG_2950 (tesA probable thioesterase) and probable BCG_3229 (lipV possible lipase) whereas the invariant motif HGG of hormone sensitive lipase family was conserved in BCG_1460c (lipH probable lipase), BCG_2991c (lipN probable lipase/esterase). The catalytic triad was known to be composed of nucleophilic serine which is the active site, a charge relay network aspartate and proton carrier histidine. The structure validation report from four different validation soft wares on NIH MBI laboratory [http://nihserver.mbi.ucla.edu/SAVES/] for structural genomics and proteomics are shown in fig.3.3 whereas angle distribution of amino acids in 3D structure models is shown in fig.3.4 Figure 3.3: Structure validation report from 4 different validation soft wares 49 on NIH MBI Laboratory for Structural Genomics and Proteomics [http://nihserver.mbi.ucla.edu/SAVES/] Figure 3.4: Ramachandran plot statistics of backbone dihedral angle distribution of amino acids in the 3D structure model having no disallowed regions. 50 Fig. 3.5 illustrates protein structure analysis from PROSA (protein structural analysis) web server as depicted below whereas fig 3.6 illustrates molecular dynamic simulation on validated 3D structure models. Figure 3.5: Protein structure analysis from PROSA (protein structural analysis) web server shows 3D structure models have Z-score -6.47 in the acceptable range for near native conformation of X-ray crystal structures Figure 3.6: Molecular dynamic simulations of modelled 3D structures show that the energy minimized 3D model structures are energetically stable 51 3.2 Molecular Structure based Ligand Screening In order to identify natural substrates/potential inhibitors and to characterize the substrate specificity of BCG_1460c (lipH probable lipase), BCG_2991c (lipN probable lipase/esterase), BCG_2950 (tesA probable thioesterase) and BCG_3229 (lipV possible lipase), a structure based virtual ligand screening was performed. At first a in silico library of potential ligands was constructed based on literature review of substrate preferences of well characterized carboxyl esterases in mycobacterial species. This resulted into a in silico ligand library of natural substrates such vinyl esters of varying acyl chain lengths from short chain vinyl acetate (C2) to long chain palmitate (C16) along with triacylglycerol substrates (TAGs) varying from short chain TAGs such as tripropionate (C3) to long chain TAGs trioleate (C18) with potential inhibitors of serine hydrolases such as THL, PMSF and E600. The in silico potential ligand library was thereafter screened using molecular docking engine Autodock (Trott and Olson 2010) into the active site of 3D structures of BCG_1460c (lipH probable lipase), BCG_2991c (lipN probable lipase/esterase), BCG_2950 (tesA probable thioesterase) and BCG_3229 (lipV possible lipase) and results were subjected to further analysis and interpretation. 52 3.2.1 Evaluation of Ligand Screening Results The ligand screening results were evaluated based on two scoring functions: a.) Ligand binding affinity/energy towards its target enzyme. b.) Distance to active site (serine in all cases) which describes a near attack conformation (NAC) (Hur, Bruice et al. 2003) of the ligand in the binding site. The enzyme-ligand docked structures were ranked by frequency binding in near attack conformation obtained from 500 independent docking runs (pvalue C12) acyl chain ester ligands screening results, highlighted circle in red show most favourable ligand (highest ligand specificity) based on its lowest energy and least distance to active site (Serine). Graphs showing the ligand specificity pattern for (a) lipH (b) lipN (c) lipV (d) tesA Table 3.1 Summary of potential substrates screening results 54 Based on the two criteria evaluation of structure based virtual screening, results revealed that BCG_1460c (lipH probable lipase) favours docked near attack conformations with short acyl chain esters from vinyl butyrate (C4) up to vinyl laurate (C12) and short chain TAGs such as tripropionate having identical fatty acyl chains (3:0/3:0/3:0) and tri butyrate (4:0/4:0/4:0) (table 3.1) with highest ligand specificity for vinyl caproate (C6) and a binding affinity of -5.11 Kcal/mol and 2.5Å distance to active site (serine) (figure 3.7(a)). For BCG_2991c (lipN probable lipase/esterase), it had a similar binding affinity towards short acyl chain vinyl esters and TAGs ranging from vinyl butyrate (C4) up to vinyl lauraterate (C12) and tripropionate having identical fatty acyl chains (3:0/3:0/3:0) to tri butyrate (4:0/4:0/4:0) (table 3.1) with highest ligand specificity for vinyl butyrate (C4) and a binding affinity of -5.9 Kcal/mol with 2.62 Å distance to active site (serine) (figure 3.7(b)). On the other hand BCG_3229 (lipV possible lipase) also depicted ligand preference towards short chain vinyl esters such as vinyl butyrate (C4) up to (C14) and TAGs ranging from tripropionate having identical fatty acyl chains (3:0/3:0/3:0) to tricaproate (6:0/6:0/6:0) (table 3.1) with highest ligand specificity for vinyl caproate (C6) having a binding affinity of -6.0 Kcal/mol and 1.92Å distance to active site (serine) (figure 3.7(c)). However, interestingly BCG_2950 (tesA probable thioesterase) showed preference for very long chain lengths (>C16) with the highest ligand specificity for phthiocerol (C28) having a binding affinity of -7.2 Kcal/mol and 1.02Å distance to active site (serine) (figure 3.7(d)). 55 Table 3.2 Summary of potential inhibitors ligand screening results Protein Ligand Ligand function Distance to active site Binding affinity/energy (Kcal/mol) lipH THL Lipase 1.82 Å -7.10 2.02 Å -6.70 2.12 Å -5.60 2.08 Å -6.5 2.23 Å -5.2 2.32 Å -4.9 1. 91Å -7.2 2.37 Å -5.6 2.38 Å -5.4 1. 84Å -7.6 2.06 Å -5.2 2.62 Å -4.4 inhibitor lipH E600 Lipase inhibitor lipH PMSF Protease Inhibitor lipN THL Lipase inhibitor lipN E600 Lipase inhibitor lipN PMSF Protease Inhibitor tesA THL Lipase inhibitor tesA E600 Lipase inhibitor tesA PMSF Protease Inhibitor lipV THL Lipase inhibitor lipV E600 Lipase inhibitor lipV PMSF Protease Inhibitor The screening for potential inhibitors resulted in the prediction of THL (tetrahydrolipstatin) as the most potent inhibitor of BCG_1460c (lipH probable lipase), BCG_2991c (lipN probable lipase/esterase), BCG_2950 (tesA 56 probable thioesterase) and BCG_3229 (lipV possible lipase) as compared to E600 and PMSF as shown above in table 3.2. 3.3 Over expressing mycobacterial putative esterases/lipases. BCG_1460c (lipH), BCG_2991c (lipN), BCG_2950 (tesA) and BCG_3229 (lipV) were found to be over expressed and successfully transformed. The fluorescent gel image (fig.3.8) clearly demonstrates an over-expression in protein levels of BCG_1460c (lipH probable lipase) and BCG_2950 (tesA probable thioesterase) having molecular weight of 34.0 kDa and 29.0 kDa respectively were seen as thick bands compared to wild type M. bovis BCG (non-over expressed). Figure 3.8: SDS-PAGE fluorescent gel image showing change in protein levels of M. bovis BCG over expressing lipH and tesA 57 3.4 Biochemical Characterization 3.4.1 Enzymatic Assays To characterize the activities of BCG_1460c (lipH) and BCG_2950 (tesA) enzymes, the whole cell lysates of over expressed BCG_1460c (lipH) and BCG_2950 (tesA) were assayed with synthetic vinyl ester substrate paranitrophenol-butyrate (C4). A ~2.5 times fold change was observed in the absorption (measured at 400nm) for BCG_1460c (lipH) as compared to wild type M. bovis BCG (non-over expressed) (fig.3.9) Figure 3.9: Enzymatic assay with whole cell lysate of overexpressed BCG_1460c (lipH) and BCG_2950 (tesA) using substrate para-nitro phenol-butyrate (C4) (** n=2 biological replicates) 58 Within 2.5 mins of the enzyme reaction almost 80% of substrate paranitrophenol-butyrate (C4) was converted into products i.e. butyric acid and para-nitrophenol the latter showing maximum absorption at 400 nm. However, overexpressed BCG_2950 (tesA) indicated no change in absorption and was lesser compared to the wild type (non-overexpressed) (fig3.9). In order to ensure adequate accuracy, the enzymatic assay was performed with two biological and two technical replicates. 3.4.2 BCG_1460c (lipH probable lipase) shows short-chain esterase activity To further investigate the substrate specificity of BCG_1460c (lipH), enzyme assay was performed using synthetic substrates of vinyl ester substrates including short–chain esters such as para-nitrophenol-acetate (C2) and paranitrophenol-butyrate (C4) and long-chain ester para-nitrophenol-palmitate (C16) with whole cell lysate of over expressed BCG_1460c (lipH). The assay results revealed that BCG_1460c (lipH probable lipase) shows a short-chain esterase activity towards para-nitrophenol-acetate (C2) and paranitrophenol-butyrate (C4) (fig3.10) and there was no activity observed towards long chain-vinly esters (C16) i.e. para-nitrophenol-palmitate (C16) as shown in fig3.10. 59 Figure 3.10: Enzymatic assay of over expressed BCG_1460c (lipH) with varying acyl chain length substrates para-nitrophenol-acetate (C2), butyrate (C4), palmitate (C16) (** n=2 biological replicates) 3.5 THL (Tetrahydrolipstatin) strongly inhibits short-chain esterase activity of BCG_1460c (lipH) Inhibition experiments were performed using well known lipase inhibitor tetrahydrolipstatin (THL) and E600 (diethylparanitrophenyl phosphate) the latter being a specific inhibitor of catalytic site serine were assayed with whole cell lysate of over expressed BCG_1460c (lipH) with the choice of substrate being p-nitrophenol butyrate (pNP-C4) since all our previous enzymatic reactions of over expressed BCG_1460c (lipH) were most stable with pNP-C4. Tetrahydrolipstatin (THL) was found to strongly inhibit the short-chain 60 esterase activity of BCG_1460c (lipH) as indicated by its IC50 value of 0.12±0.035µM (fig3.11) and E600 (diethylparanitrophenyl phosphate) inhibitor having an IC50 value of 0.399±0.172µM (fig3.12). All the inhibition assays were performed with 2 biological and 2 technical replicates. Of note, IC50 values are expected to be even lower for purified BCG_1460c (lipH) enzyme since we used whole cell lysates for our inhibition assays. Figure 3.11: THL (Tetrahydrolipstatin) inhibitor assay (IC50) towards BCG overexpressing BCG_1460c (lipH) from log phase culture (*** n=3) Figure 3.12: E600 (diethylparanitrophenyl phosphate) inhibitor assay 61 (IC50) towards BCG overexpressing BCG_1460c (lipH) from log phase culture (*** n=3) 3.6 Predicted binding mode model of THL inhibition in BCG_1460c (lipH) 3D structure To understand at the structural level THL inhibition of short-chain esterase activity of BCG_1460c ligand docking experiments were performed. 3D structure model of lipH is shown in fig.3.13 (a) with its potential docked substrate (Vinyl caproate) and inhibitor (THL) predicted from in silico ligand screening results. Interactions of substrate (Vinyl caproate) within binding pocket have been shown in fig.3.13 (a) while interactions of THL (tetrahydrolipstatin) within the binding pocket shown in fig. 3.13(b) revealed a near attack conformation of β-lactone ring from the active site serine further the molecular overlay of catalytic triad (serine, histidine, aspartate) from substrate bound over inhibitor (THL) bound shown in fig. 3.13(c) revealed (a) lipH + substrate Amino acid interaction Ligand binding pocket Ile210 Asp260 Gly291 Vinyl caproate Vinyl caproate Gly90 His290 Asn294 Gly89 Ser162 Asp260 His290 Ser162 Tyr190 His100 Asp161 Tyr86 Binding Affinity/Energy -5.11 Kcal/mol Distance to active site (Serine) 1.76 Å 62 Area Volume Length Width 298.1 Å 348.4 Å 14.21Å 9.32Å Ligand binding pocket Amino acid interaction (b) lipH + THL Arg38 Val215 Ile210 Ile216 Phe219 Leu39 THL Asp260 His290 Gly90 Phe295 Asn294 Thr99 His100 Gly91 Gly89 Ser162 Thr192 Asp161 Tyr86 Leu220 THL Asp260 His290 Trp92 Ser162 Binding Affinity/Energy -7.10 Kcal/mol Distance to active site (Serine) 1.82 Å Area Volume Length Width (c) lipH catalytic site overlay Ser162 rmsd 0.567Å His290 rmsd 0.392Å Asp260 rmsd 1.012Å Figure 3.13 (a & b). Three dimensional model of lipH structure depicting the core α/βhydrolase fold with catalytic triad (yellow). The 3D model is docked with lipH probable substrate, vinyl caproate (blue) and probable inhibitor, THL (red). The insert (middle) depicts the catalytic triad and other amino acids interacting with docked ligand. And the binding energy of ligand binding pocket is represented on far right to show that area, volume and width of the pocket decide the specificity of ligand conformation and the folding pattern. (c) Overlay of catalytic triad docked with substrate (blue) and with THL (red). The change in C—C atom r.m.s.d value of lipH catalytic site triad with substrate and THL is mentioned at the bottom of the figure. 63 533.2 Å 579.5 Å 26.05 Å 9.56 Å that there is only a very small root mean square deviation (difference) of the catalytic triad restudies with active site serine having root mean square deviation of 0.567 Å, histidine 0.392 Å and aspartate 1.012 Å (fig. 3.13(c)). Therefore, it was predicted that THL inhibitor binds in the substrate pocket of BCG_1460c (lipH) where the hexanoyl (C6) arm of THL binding to the substrate pocket may well be mimicking the short-chain substrate (vinyl caproate C6) binding in the ligand binding pocket of BCG_1460c (lipH) this hypothesis has been discussed in details in the discussion section which would now follow. 4. Discussion Mycobacterium tuberculosis incorporates an unusually high number of genes in its lipid metabolism (Cole et al., 1998) and it is known that there are 250 genes encoding putative lipid synthesis/degrading enzymes as compared to only 50 genes in E.coli having a similar genome size. Recent studies have suggested that success of Mycobacterium tuberculosis pathogen relies on its exceptional capacity to latently infect and re-infect its host which is mainly attributed to its lipid metabolism. The mycobacteria prior to entering into nonreplicating state have been shown to accumulate intracellular lipids (TAGs) (Garton, Christensen et al. 2002). The studies of Coles group, in 2008 (Cotes, Bakala N'goma J et al. 2008) have reported that during the mycobacterial reinfection cycle i.e. exit from non-replicating state, the bacteria hydrolyses its intracellular lipid deposits (TAGs) using hydrolytic enzymes like esterases/lipases. Sequence analysis has revealed 31 of such putative lipolytic 64 enzymes out of which 24 have been classified under lip family as putative esterases/lipases but very few have been functionally annotated and the 3D structure of only one esterase lipW (PDB ID: 3QH4) has been reported to have been established so far. Our results from this study conducted in Mycobacteirum bovis BCG provides insights into molecular structure of 4 putative mycobacterial esterases/lipases namely BCG_1460c (lipH probable lipase), BCG_2991c (lipN probable lipase/esterase), BCG_2950 (tesA probable thioesterase) and BCG_3229 (lipV possible lipase) and predicting natural substrates and a potent inhibitor THL (tetrahydrolipstatin) by structure based virtual ligand screening apart from biochemical characterization of short-chain esterase activity BCG_1460c (lipH probable lipase) inhibited by THL (tetrahydrolipstatin). However, detailed results would now be discussed in following sections 4.1 In silico Studies: 4.1.1 Role of Virtual Screening in Antibacterial Drug Discovery The golden era of antibacterial chemotherapy began in the 1950s and by the advent of 1970s almost all major classes of antibacterial agents currently in use (Simmons, Chopra et al. 2010) were discovered this was a major scientific and medical achievement that had enormous benefits for treatment of deadly infectious diseases (caused by bacteria) affecting the human race. However, the emergence of widespread global occurrence of bacteria resistant to the antibiotics and synthetic drugs threatens to reverse our ability to treat infectious diseases (Chopra 2013). Furthermore the new drugs in pharmaceutical pipelines are mostly derivatives of older classes of 65 antibacterial currently in use and therefore making them more prone to the existing mechanisms of bacterial resistance. Figure 4.1 Showing principal antibacterial drug discovery strategies (above the date line) in the period from 1940 to the present day and supporting technologies (below the date line). The golden era of antibacterial drug discovery(∼1945–76) is also indicated (Adapted from Chopra 2013) As shown in figure 4.1 the most critical step in the process of antibacterial drug discovery is the viable lead identification step. The early predictions on the lead quality set the stage for the subsequent efforts to enhance therapeutic efficacy through selectivity, pharmacokinetics, potency and toxicity (Polgar 2007). In a retrospective view of the antibacterial drug discovery process, the essential step of lead identification was mainly driven by in vivo methodologies, but the limitations of in vivo models were later found to be major factors in evaluating attrition rates which therefore suggested researchers to introduce rational approaches such as structure based virtual screening and in vitro methodologies at the frontline of drug discovery campaigns. Virtual screening (VHTS) combines both rational approaches such 66 as structure-based screening with high throughput approaches (HTS). The typical workflow of a high throughput virtual screening has been depicted in fig. 4.2 Fig. 4.2 State of the art in Virtual Screening Figure 4.3 Detailed workflow of a high throughput virtual screening (VHTS) (Source: http://www.molfunction.com/virtual.htm ) 67 4.1.2 Concepts, Feasibility and Drawbacks of Virtual Screening Virtual screening is a strategy aimed at bringing together a more focused approach to high throughput screening by applying rational computational analysis to a subset of compounds considered to be appropriate for a given receptor. It is quite clear that this strategy implies that there is some starting point information which is available pertaining to either the nature of the binding site of receptor and/or ligand type that would be expected to favourably bind within the active site of the receptor. However, it should be realized that virtual screening itself combines a variety of computational screens, which encompasses simplistic to sophisticated algorithms which explore different types of information describing receptor. Similarly, it can be used to produce either a highly focused compound subset (for instance if only the close structural analogs of a lead compound are of interest) or a highly open ended subset (for instance a constraint on size, described by molecular weight, may be applied), although this largely depends on the objectives and interests of the HTS project. 4.1.3 Molecular 3D Structure Modelling and Virtual Ligand Screening In our in silico study, we have demonstrated 3D structure models of BCG_1460c (lipH probable lipase), BCG_2991c (lipN probable lipase/esterase), BCG_2950 (tesA probable thioesterase) and BCG_3229 (lipV possible lipase), with an accuracy of >95% having near native conformation of energetically stable and validated 3D structure models. 68 Partially modelled 3D structure of Rv1399c (BCG_1460c lipH) in Mycobacterium tuberculosis has been reported in the study of Canaan group in 2004 (Canaan, Maurin et al. 2004) and Rv2928 (BCG_2950 tesA) from Chavadi group in 2011 (Chavadi, Edupuganti et al. 2011) whereas in the present study we have predicted complete domain modelling of BCG_1460c (lipH probable lipase), BCG_2950 (tesA probable thioesterase), BCG_2991c (lipN probable lipase/esterase), and BCG_3229 (lipV possible lipase). We have uniquely extended the concept of molecular modelling to a structure based ligand screening to predict and understand the ligand specificities particularly those pertaining to BCG_1460c (lipH probable lipase), BCG_2950 (tesA probable thioesterase), BCG_2991c (lipN probable lipase/esterase), and BCG_3229 (lipV possible lipase). Our results suggest that BCG_1460c (lipH probable lipase), BCG_2991c (lipN probable lipase/esterase) and BCG_3229 (lipV possible) show an inclined tendency of ligand affinity towards short-chain vinyl esters such as vinyl butyrate (C4) and vinly caproate (C6) whereas for triacylglycerol (TAGs) substrates were found to be tripropionate having identical fatty acyl chains (3:0/3:0/3:0) to tricaproate having identical fatty acyl chains (6:0/6:0/6:0). Our results were performed with 500 independent docking runs involving 300000 maximum energy evaluations to achieve desired statistical significance (p-value95%. In addition complete domain modelling of all structures and their respective ligand specificities was also undertaken. It is to be pointed out that this was a unique feature particularly in view of the fact that only a partial modelling of lipH (Rv1399c) and tesA (Rv2928c) was so far done in the studies reported by (Canaan et. al.2004) and (Chavadi et. al. 2006) respectively. Further for the first time this study validated models for BCG_3229 (lipV possible lipase) and BCG_2991c (lipN probable lipase/esterase) 3D structures. 77  In order to experimentally characterize these and also validate the in silico ligand specificity predictions an in vitro biochemical characterization was carried out with whole cell lysates of BCG overexpressing BCG_1460c (lipH probable lipase), BCG_2991c (lipN probable lipase/esterase), BCG_2950 (tesA probable thioesterase) and BCG_3229 (lipV possible lipase). Out of these four, one BCG_1460c (lipH probable lipase) was shown to have a short chain esterase activity and further inhibitor studies indicated that this short chain esterase activity was strongly inhibited by a well-known FDA approved drug called THL (Tetrahydrolipstatin).  In silico molecular modelling predictions put forth were observed to be in line with biochemical experimental data making it an effective and validated characterization approach to mycobacterial esterases/lipases.  Future work in continuation to the present work would preferably be to understand the exact functional role of BCG_1460c (lipH probable lipase) and the pathways in which this enzyme acts in mycobacteria so as to understand its exact functional role. At this point of time we can only hypothesize its probable function in mycobacteria that it might be acting on short-chain substrate pathways such as regulation, detoxification, signalling or support to the membrane and may provide mycobacteria an alternate source of carbon. However, it would be worthwhile to design and undertake a systematic study to unfold the truth of the current hypothesis. 78 References Ali, Y. B., R. Verger and A. Abousalham (2012). "Lipases or esterases: does it really matter? Toward a new bio-physico-chemical classification." Methods Mol Biol 861: 31-51. Canaan, S., D. Maurin, H. Chahinian, B. Pouilly, C. Durousseau, F. Frassinetti, L. Scappuccini-Calvo, C. Cambillau and Y. Bourne (2004). "Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis. A novel (lipH probable lipase) carboxyl esterase structurally related to the HSL family." Eur J Biochem 271(19): 3953-3961. Daniel, J., C. Deb, V. S. Dubey, T. D. Sirakova, B. Abomoelak, H. R. Morbidoni and P. E. Kolattukudy (2004). "Induction of a novel class of diacylglycerol acyltransferases and triacylglycerol accumulation in Mycobacterium tuberculosis as it goes into a dormancy-like state in culture." J Bacteriol 186(15): 5017-5030. Daniel, J., H. Maamar, C. Deb, T. D. Sirakova and P. E. Kolattukudy (2011). "Mycobacterium tuberculosis uses host triacylglycerol to accumulate lipid droplets and acquires a dormancy-like phenotype in lipid-loaded macrophages." PLoS Pathog 7(6): e1002093. Deb, C., J. Daniel, T. D. Sirakova, B. Abomoelak, V. S. Dubey and P. E. Kolattukudy (2006). "A novel lipase belonging to the hormone-sensitive lipase family induced under starvation to utilize stored triacylglycerol in Mycobacterium tuberculosis." J Biol Chem 281(7): 3866-3875. Dhouib, R., A. Ducret, P. Hubert, F. Carriere, S. Dukan and S. Canaan (2011). "Watching intracellular lipolysis in mycobacteria using time lapse fluorescence microscopy." Biochim Biophys Acta 1811(4): 234-241. Garton, N. J., H. Christensen, D. E. Minnikin, R. A. Adegbola and M. R. Barer (2002). "Intracellular lipophilic inclusions of mycobacteria in vitro and in sputum." Microbiology 148(Pt 10): 2951-2958. Kremer, L., C. de Chastellier, G. Dobson, K. J. Gibson, P. Bifani, S. Balor, J. P. Gorvel, C. Locht, D. E. Minnikin and G. S. Besra (2005). "Identification and structural characterization of an unusual mycobacterial monomeromycolyl-diacylglycerol." Mol Microbiol 57(4): 1113-1126. Lonon, M. K., D. E. Woods and D. C. Straus (1988). "Production of lipase by clinical isolates of Pseudomonas cepacia." J Clin Microbiol 26(5): 979-984. Low, K. L., P. S. Rao, G. Shui, A. K. Bendt, K. Pethe, T. Dick and M. R. Wenk (2009). "Triacylglycerol utilization is required for regrowth of in vitro hypoxic nonreplicating Mycobacterium bovis bacillus Calmette-Guerin." J Bacteriol 191(16): 5037-5043. 79 Low, K. L., G. Shui, K. Natter, W. K. Yeo, S. D. Kohlwein, T. Dick, S. P. Rao and M. R. Wenk (2010). "Lipid droplet-associated proteins are involved in the biosynthesis and hydrolysis of triacylglycerol in Mycobacterium bovis bacillus Calmette-Guerin." J Biol Chem 285(28): 21662-21670. Mattos, K. A., H. D'Avila, L. S. Rodrigues, V. G. Oliveira, E. N. Sarno, G. C. Atella, G. M. Pereira, P. T. Bozza and M. C. Pessolani (2010). "Lipid droplet formation in leprosy: Toll-like receptor-regulated organelles involved in eicosanoid formation and Mycobacterium leprae pathogenesis." J Leukoc Biol 87(3): 371-384. Mattos, K. A., F. A. Lara, V. G. Oliveira, L. S. Rodrigues, H. D'Avila, R. C. Melo, P. P. Manso, E. N. Sarno, P. T. Bozza and M. C. Pessolani (2011). "Modulation of lipid droplets by Mycobacterium leprae in Schwann cells: a putative mechanism for host lipid acquisition and bacterial survival in phagosomes." Cell Microbiol 13(2): 259-273. McKinney, J. D., K. Honer zu Bentrup, E. J. Munoz-Elias, A. Miczak, B. Chen, W. T. Chan, D. Swenson, J. C. Sacchettini, W. R. Jacobs, Jr. and D. G. Russell (2000). "Persistence of Mycobacterium tuberculosis in macrophages and mice requires the glyoxylate shunt enzyme isocitrate lyase." Nature 406(6797): 735-738. Parrish, N. M., J. D. Dick and W. R. Bishai (1998). "Mechanisms of latency in Mycobacterium tuberculosis." Trends Microbiol 6(3): 107-112. Peyron, P., J. Vaubourgeix, Y. Poquet, F. Levillain, C. Botanch, F. Bardou, M. Daffe, J. F. Emile, B. Marchou, P. J. Cardona, C. de Chastellier and F. Altare (2008). "Foamy macrophages from tuberculous patients' granulomas constitute a nutrient-rich reservoir for M. tuberculosis persistence." PLoS Pathog 4(11): e1000204. Rollof, J., J. H. Braconier, C. Soderstrom and P. Nilsson-Ehle (1988). "Interference of Staphylococcus aureus lipase with human granulocyte function." Eur J Clin Microbiol Infect Dis 7(4): 505-510. Russell, D. G. (2007). "Who puts the tubercle in tuberculosis?" Nat Rev Microbiol 5(1): 39-47. Schue, M., D. Maurin, R. Dhouib, J. C. Bakala N'Goma, V. Delorme, G. Lambeau, F. Carriere and S. Canaan (2010). "Two cutinase-like proteins secreted by Mycobacterium tuberculosis show very different lipolytic activities reflecting their physiological function." FASEB J 24(6): 1893-1903. Shen, G., K. Singh, D. Chandra, C. Serveau-Avesque, D. Maurin, S. Canaan, R. Singla, D. Behera and S. Laal (2012). "LipC (Rv0220) is an immunogenic cell surface esterase of Mycobacterium tuberculosis." Infect Immun 80(1): 243-253. 80 Singh, G., G. Singh, D. Jadeja and J. Kaur (2010). "Lipid hydrolizing enzymes in virulence: Mycobacterium tuberculosis as a model system." Crit Rev Microbiol 36(3): 259-269. Wheeler, P. R. and C. Ratledge (1988). "Use of carbon sources for lipid biosynthesis in Mycobacterium leprae: a comparison with other pathogenic mycobacteria." J Gen Microbiol 134(8): 2111-2121. Ali, Y. B., R. Verger and A. Abousalham (2012). "Lipases or esterases: does it really matter? Toward a new bio-physico-chemical classification." Methods Mol Biol 861: 31-51. Anuchin, A. M., A. L. Mulyukin, N. E. Suzina, V. I. Duda, G. I. El-Registan and A. S. Kaprelyants (2009). "Dormant forms of Mycobacterium smegmatis with distinct morphology." Microbiology 155(Pt 4): 1071-1079. Beisel, W. R. and R. H. Fiser, Jr. (1970). "Lipid metabolism during infectious illness." Am J Clin Nutr 23(8): 1069-1079. Berto, P., P. Commenil, L. Belingheri and B. Dehorter (1999). "Occurrence of a lipase in spores of Alternaria brassicicola with a crucial role in the infection of cauliflower leaves." FEMS Microbiol Lett 180(2): 183-189. Betts, J. C., P. T. Lukey, L. C. Robb, R. A. McAdam and K. Duncan (2002). "Evaluation of a nutrient starvation model of Mycobacterium tuberculosis persistence by gene and protein expression profiling." Mol Microbiol 43(3): 717-731. Camacho, L. R., D. Ensergueix, E. Perez, B. Gicquel and C. Guilhot (1999). "Identification of a virulence gene cluster of Mycobacterium tuberculosis by signature-tagged transposon mutagenesis." Mol Microbiol 34(2): 257-267. Camus, J. C., M. J. Pryor, C. Medigue and S. T. Cole (2002). "Re-annotation of the genome sequence of Mycobacterium tuberculosis H37Rv." Microbiology 148(Pt 10): 2967-2973. Canaan, S., D. Maurin, H. Chahinian, B. Pouilly, C. Durousseau, F. Frassinetti, L. Scappuccini-Calvo, C. Cambillau and Y. Bourne (2004). "Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis. A novel carboxyl esterase structurally related to the HSL family." Eur J Biochem 271(19): 3953-3961. Chavadi, S. S., U. R. Edupuganti, O. Vergnolle, I. Fatima, S. M. Singh, C. E. Soll and L. E. N. Quadri (2011). "Inactivation of tesA Reduces Cell Wall Lipid Production and Increases Drug Susceptibility in Mycobacteria." Journal of Biological Chemistry 286(28): 24616-24625. Chopra, I. (2013). "The 2012 Garrod Lecture: Discovery of antibacterial drugs in the 21st century." Journal of Antimicrobial Chemotherapy 68(3): 496-505. 81 Cole, S. T., R. Brosch, J. Parkhill, T. Garnier, C. Churcher, D. Harris, S. V. Gordon, K. Eiglmeier, S. Gas, C. E. Barry, 3rd, F. Tekaia, K. Badcock, D. Basham, D. Brown, T. Chillingworth, R. Connor, R. Davies, K. Devlin, T. Feltwell, S. Gentles, N. Hamlin, S. Holroyd, T. Hornsby, K. Jagels, A. Krogh, J. McLean, S. Moule, L. Murphy, K. Oliver, J. Osborne, M. A. Quail, M. A. Rajandream, J. Rogers, S. Rutter, K. Seeger, J. Skelton, R. Squares, S. Squares, J. E. Sulston, K. Taylor, S. Whitehead and B. G. Barrell (1998). "Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence." Nature 393(6685): 537-544. Cotes, K., C. Bakala N'goma J, R. Dhouib, I. Douchet, D. Maurin, F. Carriere and S. Canaan (2008). "Lipolytic enzymes in Mycobacterium tuberculosis." Appl Microbiol Biotechnol 78(5): 741-749. Cudrey, C., H. van Tilbeurgh, Y. Gargouri and R. Verger (1993). "Inactivation of pancreatic lipases by amphiphilic reagents 5-(dodecyldithio)-2-nitrobenzoic acid and tetrahydrolipstatin. Dependence upon partitioning between micellar and oil phases." Biochemistry 32(50): 13800-13808. Daniel, J., C. Deb, V. S. Dubey, T. D. Sirakova, B. Abomoelak, H. R. Morbidoni and P. E. Kolattukudy (2004). "Induction of a novel class of diacylglycerol acyltransferases and triacylglycerol accumulation in Mycobacterium tuberculosis as it goes into a dormancy-like state in culture." J Bacteriol 186(15): 5017-5030. Daniel, J., H. Maamar, C. Deb, T. D. Sirakova and P. E. Kolattukudy (2011). "Mycobacterium tuberculosis uses host triacylglycerol to accumulate lipid droplets and acquires a dormancy-like phenotype in lipid-loaded macrophages." PLoS Pathog 7(6): e1002093. Deb, C., J. Daniel, T. D. Sirakova, B. Abomoelak, V. S. Dubey and P. E. Kolattukudy (2006). "A novel lipase belonging to the hormone-sensitive lipase family induced under starvation to utilize stored triacylglycerol in Mycobacterium tuberculosis." J Biol Chem 281(7): 3866-3875. Dhouib, R., A. Ducret, P. Hubert, F. Carriere, S. Dukan and S. Canaan (2011). "Watching intracellular lipolysis in mycobacteria using time lapse fluorescence microscopy." Biochim Biophys Acta 1811(4): 234-241. Dundas, J., Z. Ouyang, J. Tseng, A. Binkowski, Y. Turpaz and J. Liang (2006). "CASTp: computed atlas of surface topography of proteins with structural and topographical mapping of functionally annotated residues." Nucleic Acids Res 34(Web Server issue): W116-118. Fisher, M. A., B. B. Plikaytis and T. M. Shinnick (2002). "Microarray analysis of the Mycobacterium tuberculosis transcriptional response to the acidic conditions found in phagosomes." J Bacteriol 184(14): 4025-4032. 82 Garton, N. J., H. Christensen, D. E. Minnikin, R. A. Adegbola and M. R. Barer (2002). "Intracellular lipophilic inclusions of mycobacteria in vitro and in sputum." Microbiology 148(Pt 10): 2951-2958. Gu, S., J. Chen, K. M. Dobos, E. M. Bradbury, J. T. Belisle and X. Chen (2003). "Comprehensive proteomic profiling of the membrane constituents of a Mycobacterium tuberculosis strain." Mol Cell Proteomics 2(12): 1284-1296. Guex, N. and M. C. Peitsch (1997). "SWISS-MODEL and the Swiss-Pdb Viewer: An environment for comparative protein modeling." ELECTROPHORESIS 18(15): 2714-2723. Hadvary, P., H. Lengsfeld and H. Wolfer (1988). "Inhibition of pancreatic lipase in vitro by the covalent inhibitor tetrahydrolipstatin." Biochem J 256(2): 357-361. Hess, B. (2007). "P-LINCS: A Parallel Linear Constraint Solver for Molecular Simulation." Journal of Chemical Theory and Computation 4(1): 116-122. Hess, B., H. Bekker, H. J. C. Berendsen and J. G. E. M. Fraaije (1997). "LINCS: A linear constraint solver for molecular simulations." Journal of Computational Chemistry 18(12): 1463-1472. Hochuli, E., E. Kupfer, R. Maurer, W. Meister, Y. Mercadal and K. Schmidt (1987). "Lipstatin, an inhibitor of pancreatic lipase, produced by Streptomyces toxytricini. II. Chemistry and structure elucidation." J Antibiot (Tokyo) 40(8): 1086-1091. Hotelier, T., L. Renault, X. Cousin, V. Negre, P. Marchot and A. Chatonnet (2004). "ESTHER, the database of the alpha/beta-hydrolase fold superfamily of proteins." Nucleic Acids Res 32(Database issue): D145-147. Jacob, R. B., T. Andersen and O. M. McDougal (2012). "Accessible HighThroughput Virtual Screening Molecular Docking Software for Students and Educators." PLoS Comput Biol 8(5): e1002499. Kremer, L., C. de Chastellier, G. Dobson, K. J. Gibson, P. Bifani, S. Balor, J. P. Gorvel, C. Locht, D. E. Minnikin and G. S. Besra (2005). "Identification and structural characterization of an unusual mycobacterial monomeromycolyl-diacylglycerol." Mol Microbiol 57(4): 1113-1126. Larkin, M. A., G. Blackshields, N. P. Brown, R. Chenna, P. A. McGettigan, H. McWilliam, F. Valentin, I. M. Wallace, A. Wilm, R. Lopez, J. D. Thompson, T. J. Gibson and D. G. Higgins (2007). "Clustal W and Clustal X version 2.0." Bioinformatics 23(21): 2947-2948. Lonon, M. K., D. E. Woods and D. C. Straus (1988). "Production of lipase by clinical isolates of Pseudomonas cepacia." J Clin Microbiol 26(5): 979-984. 83 Low, K. L., P. S. Rao, G. Shui, A. K. Bendt, K. Pethe, T. Dick and M. R. Wenk (2009). "Triacylglycerol utilization is required for regrowth of in vitro hypoxic nonreplicating Mycobacterium bovis bacillus Calmette-Guerin." J Bacteriol 191(16): 5037-5043. Low, K. L., G. Shui, K. Natter, W. K. Yeo, S. D. Kohlwein, T. Dick, S. P. Rao and M. R. Wenk (2010). "Lipid droplet-associated proteins are involved in the biosynthesis and hydrolysis of triacylglycerol in Mycobacterium bovis bacillus Calmette-Guerin." J Biol Chem 285(28): 21662-21670. Mattos, K. A., H. D'Avila, L. S. Rodrigues, V. G. Oliveira, E. N. Sarno, G. C. Atella, G. M. Pereira, P. T. Bozza and M. C. Pessolani (2010). "Lipid droplet formation in leprosy: Toll-like receptor-regulated organelles involved in eicosanoid formation and Mycobacterium leprae pathogenesis." J Leukoc Biol 87(3): 371-384. Mattos, K. A., F. A. Lara, V. G. Oliveira, L. S. Rodrigues, H. D'Avila, R. C. Melo, P. P. Manso, E. N. Sarno, P. T. Bozza and M. C. Pessolani (2011). "Modulation of lipid droplets by Mycobacterium leprae in Schwann cells: a putative mechanism for host lipid acquisition and bacterial survival in phagosomes." Cell Microbiol 13(2): 259-273. McKinney, J. D., K. Honer zu Bentrup, E. J. Munoz-Elias, A. Miczak, B. Chen, W. T. Chan, D. Swenson, J. C. Sacchettini, W. R. Jacobs, Jr. and D. G. Russell (2000). "Persistence of Mycobacterium tuberculosis in macrophages and mice requires the glyoxylate shunt enzyme isocitrate lyase." Nature 406(6797): 735-738. Menendez, J. A., L. Vellon and R. Lupu (2005). "Antitumoral actions of the anti-obesity drug orlistat (XenicalTM) in breast cancer cells: blockade of cell cycle progression, promotion of apoptotic cell death and PEA3-mediated transcriptional repression of Her2/neu (erbB-2) oncogene." Ann Oncol 16(8): 1253-1267. Mishra, K. C., C. de Chastellier, Y. Narayana, P. Bifani, A. K. Brown, G. S. Besra, V. M. Katoch, B. Joshi, K. N. Balaji and L. Kremer (2008). "Functional role of the PE domain and immunogenicity of the Mycobacterium tuberculosis triacylglycerol hydrolase LipY." Infect Immun 76(1): 127-140. Morris, G. M., D. S. Goodsell, R. S. Halliday, R. Huey, W. E. Hart, R. K. Belew and A. J. Olson (1998). "Automated docking using a Lamarckian genetic algorithm and an empirical binding free energy function." Journal of Computational Chemistry 19(14): 1639-1662. O'Reilly, L. M. and C. J. Daborn (1995). "The epidemiology of Mycobacterium bovis infections in animals and man: a review." Tuber Lung Dis 76 Suppl 1: 1-46. 84 Ollis, D. L., E. Cheah, M. Cygler, B. Dijkstra, F. Frolow, S. M. Franken, M. Harel, S. J. Remington, I. Silman, J. Schrag and et al. (1992). "The alpha/beta hydrolase fold." Protein Eng 5(3): 197-211. Parrish, N. M., J. D. Dick and W. R. Bishai (1998). "Mechanisms of latency in Mycobacterium tuberculosis." Trends Microbiol 6(3): 107-112. Peyron, P., J. Vaubourgeix, Y. Poquet, F. Levillain, C. Botanch, F. Bardou, M. Daffe, J. F. Emile, B. Marchou, P. J. Cardona, C. de Chastellier and F. Altare (2008). "Foamy macrophages from tuberculous patients' granulomas constitute a nutrient-rich reservoir for M. tuberculosis persistence." PLoS Pathog 4(11): e1000204. Polgar, T. (2007). "[The role of structure based virtual screening in the early phase of drug discovery]." Acta Pharm Hung 77(4): 223-234. Richter, L. and B. Saviola (2009). "The lipF promoter of Mycobacterium tuberculosis is upregulated specifically by acidic pH but not by other stress conditions." Microbiol Res 164(2): 228-232. Rollof, J., J. H. Braconier, C. Soderstrom and P. Nilsson-Ehle (1988). "Interference of Staphylococcus aureus lipase with human granulocyte function." Eur J Clin Microbiol Infect Dis 7(4): 505-510. Russell, D. G. (2007). "Who puts the tubercle in tuberculosis?" Nat Rev Microbiol 5(1): 39-47. Schue, M., D. Maurin, R. Dhouib, J. C. Bakala N'Goma, V. Delorme, G. Lambeau, F. Carriere and S. Canaan (2010). "Two cutinase-like proteins secreted by Mycobacterium tuberculosis show very different lipolytic activities reflecting their physiological function." FASEB J 24(6): 1893-1903. Shen, G., K. Singh, D. Chandra, C. Serveau-Avesque, D. Maurin, S. Canaan, R. Singla, D. Behera and S. Laal (2012). "LipC (Rv0220) is an immunogenic cell surface esterase of Mycobacterium tuberculosis." Infect Immun 80(1): 243-253. Simmons, K. J., I. Chopra and C. W. G. Fishwick (2010). "Structure-based discovery of antibacterial drugs." Nat Rev Micro 8(7): 501-510. Singh, G., G. Singh, D. Jadeja and J. Kaur (2010). "Lipid hydrolizing enzymes in virulence: Mycobacterium tuberculosis as a model system." Crit Rev Microbiol 36(3): 259-269. Suplatov, D. A., W. Besenmatter, V. K. Svedas and A. Svendsen (2012). "Bioinformatic analysis of alpha/beta-hydrolase fold enzymes reveals subfamily-specific positions responsible for discrimination of amidase and lipase activities." Protein Eng Des Sel 25(11): 689-697. 85 Thomson, C. A., P. J. Delaquis and G. Mazza (1999). "Detection and measurement of microbial lipase activity: a review." Crit Rev Food Sci Nutr 39(2): 165-187. Tortoli, E. (2006). "The new mycobacteria: an update." FEMS Immunol Med Microbiol 48(2): 159-178. Trott, O. and A. J. Olson (2010). "AutoDock Vina: Improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading." Journal of Computational Chemistry 31(2): 455-461. van Beers, S. M., M. Y. de Wit and P. R. Klatser (1996). "The epidemiology of Mycobacterium leprae: recent insight." FEMS Microbiol Lett 136(3): 221230. Wheeler, P. R. and C. Ratledge (1988). "Use of carbon sources for lipid biosynthesis in Mycobacterium leprae: a comparison with other pathogenic mycobacteria." J Gen Microbiol 134(8): 2111-2121. Wiederstein, M. and M. J. Sippl (2007). "ProSA-web: interactive web service for the recognition of errors in three-dimensional structures of proteins." Nucleic Acids Res 35(Web Server issue): W407-410. Xu, G., H. Jia, Y. Li, X. Liu, M. Li and Y. Wang (2010). "Hemolytic phospholipase Rv0183 of Mycobacterium tuberculosis induces inflammatory response and apoptosis in alveolar macrophage RAW264.7 cells." Can J Microbiol 56(11): 916-924. Zhang, J., Y. Liang and Y. Zhang (2011). "Atomic-Level Protein Structure Refinement Using Fragment-Guided Molecular Dynamics Conformation Sampling." Structure (London, England : 1993) 19(12): 1784-1795. Zhang, M., J. D. Wang, Z. F. Li, J. Xie, Y. P. Yang, Y. Zhong and H. H. Wang (2005). "Expression and characterization of the carboxyl esterase Rv3487c from Mycobacterium tuberculosis." Protein Expr Purif 42(1): 59-66. Solis, F. J., and Wets, R. J.-B. (1981) “Minimization by Random Search Techniques,” Mathematics of Operations Research, 6, 19-30. Sun Hur andThomas C. Bruice (2003) “The near attack conformation approach to the study of the chorismate to prephenate reaction”, PNAS 2003 100 86 87 [...]... esterases /lipases contribute to invasiveness and proliferation by causing 14 destruction of the host tissue thereby supplying hydrolysed material to the organisms as nutrients These esterases /lipases are one of the known and critical virulence factors in a host of bacterial species such as Pseudomonas cepacia, Staphylococcus aureus (Lonon, Woods et al 1988, Rollof, Braconier et al 1988) and also in... Introduction 1.1 Esterases /Lipases The biological relevance and coexisting variability of lipids has led to the development of wide range of lipid metabolizing enzymes Esterases (EC 3.1) are widely distributed amongst bacteria, fungi, plants and animals defined by their ability to catalyse the formation and cleavage of ester bonds They are classified based on the nature of the ester bonds (carboxyl... considered to be one of the known virulence factors in many bacteria such as Pseudomonas cepacia, Staphylococcus aureus (Lonon, Woods et al 1988 and Rollof, Braconier et al 1988) and fungal species like Candida albicans, Fusarium gramearium Further insight reveals that the lipid metabolizing enzymes of Propionibacterium acnes and Staphylococcus epidermis are probably involved in incidence of commonly prevalent... infections where they help triggering colonization and subsequent persistence of bacteria on the human skin 5 EFFECTS OF INFECTION ON LIPID METABOLISM OF HOST Presence of invading microorganism 1 Direct Effects Secondary effects due to infection  Decreased dietary intake of fats  Utilization of host lipids required by replicating microorganisms  Disruption of host cell metabolism by intracellular microorganisms... involved in the synthesis or degradation of lipids compared to 50 genes in Escherichia coli, which is known to have a similar genome size This feature, combined with the extremely large quantum of lipids representing 30–40% of the dry weight of M tuberculosis tends to suggest that lipids and lipid metabolizing enzymes play an important role in the mycobacterial life cycle and perhaps also in virulence In the... bacteria acquire and accumulate intra cytoplasmic lipid inclusion (ILIs) in their cytoplasm (Figure 1.4(B) and 1.4(C)) and persist in a non-replicating state ultimately and eventually leading to dormancy i.e latent infection It has been demonstrated in an in vitro model of human granulomas (Peyron, Vaubourgeix et al 2008) that these lipid bodies (LB and ILIs) serve as sources of carbon and energy for... metabolizing enzymes (esterases /lipases) appear to play an important central role and associate with important physiological functions and also contribute to the extraordinary capacity of survival of M tuberculosis within the infected host These enzymes are peculiar molecules that provide a metabolic turnover of lipids and can be defined as essential biocatalysts for the hydrolysis of esters containing long... long chainfattyacids 1.2 Esterases /Lipases in physiopathology and disease progression Pathogenic bacteria have been known to follow a number of mechanisms and pathways to cause and allow subsequent persistence of diseases in human hosts The molecular strategies used by the bacteria to interact with the host can be unique and characteristic to specific pathogens, and follow conserved pattern across... Hydrolysis of a carboxylic ester catalysed by carboxyl esterase enzyme (b) Hydrolysis of a triacylglycerol substrate catalysed by TAG 4 lipase enzyme (Source: Thomson, Delaquis et al 1999) 1.1.1 Esterases /Lipases in Infectious Diseases Several studies on lipid metabolism have been undertaken and the outcome of these studies has opened up new ways and avenues to analyse and characterize a host of diseases... characteristic to a number of hydrolase enzymes of largely different phylogenetic origin and catalytic function (Ollis, Cheah et al 1992) Each enzyme has a conserved alpha/beta (α/β) hydrolase core (fig.7b) consisting of alpha/beta sheet having 8 strands connected by helices They all have a similar arrangement of a catalytic triad composed of nucleophilic serine charge relay network aspartate and proton carrier ... structural features of mycobacterial putative esterases /lipases and distinguishing lipolytic and non-lipolytic enzymes at the structural level itself In vitro biochemical characterization of Mycobacterial. .. the whole ligand binding pocket and also allow for rotation and translation of ligands The schematics of computational docking are shown in fig.2.2 36 Figure 2.2: Schematic diagram of Computational. .. (Rv1076), lipY (Rv3097c) and are of high functional importance 1.5 Issues and Problems with functional Mycobacterial putative Esterases /Lipases characterization of A literature survey of the studies conducted