Solubility studies, rational amino acid replacements and structural analyses of streptomyces jumonjinensis isopenicillin n synthase 1

Chapter 4.1 Results Comparative expression analysis of different bacterial IPNS isozymes in E. coli Peculiarly, the expression of bacterial IPNS in E. coli seemed to be more problematic then the expression of its fungal counterparts in E. coli. Most of the soluble IPNS proteins were cloned from the fungal origins and in contrast, S. clavuligerus IPNS (scIPNS) was the only soluble bacterial IPNS expressed in E. coli at the beginning of this study (Table 2.4b). It was interesting to note that although the bacterial IPNS were closely related in terms of sequence homology and function, differences in their expression characteristics in E. coli exist. For example, S. jumonjinensis IPNS (sjIPNS), despite sharing 82% amino acid sequence homology with scIPNS (Table 2.3), the highest amongst all known bacterial IPNS with scIPNS, was insoluble. However, the limited studies on the expression of bacterial IPNS preclude the conclusion that the highly homologous gene structures of bacterial IPNS each dictates a distinctive soluble expression characteristic in E. coli. To address this question, the first part of this study was to carry out thorough comparative expression studies of four bacterial IPNS under the same conditions. The bacterial IPNS studied were scIPNS, sjIPNS, Nocardia lactamdurans IPNS (nIPNS) and S. fimbriatus IPNS (sfIPNS). To date, no expression studies have been reported for nIPNS while sfIPNS was newly isolated for this study. Successively, the comparative expression results of the four IPNS isozymes would provide valuable information for deciphering how the minute dissimilarities in the primary amino acid sequences of bacterial IPNS may cause different levels of soluble protein production. Chapter 4.1.1 Results Construction of recombinant expression vectors for different IPNS isozymes scIPNS gene previously cloned under the control of T7 promoter in pET24a prokaryotic expression vector (Sim et al., 1996) (identified as pET-SC) was used in this study. High levels of soluble scIPNS of up to 29% of total soluble proteins, have been reported for the expression of scIPNS under the control of T7 promoter in E. coli BL21(DE3) at 25°C (Sim et al., 1996). Thus, attempts were also made to clone the respective sjIPNS, nIPNS and sfIPNS genes into the same pET24a expression vector to investigate the possibility of expressing these isozymes as highly soluble enzymes under the same expression system and conditions. The detailed plasmid map of pET24a expression vector is shown in Appendix III. 4.1.2 Cloning strategy for sjIPNS and nIPNS The gene sequences of sjIPNS and nIPNS were known (Shiffman et al., 1988; Coque et al., 1991) but that of sfIPNS was unknown and had to be determined. Hence, slightly different strategies were adopted for the cloning of sjIPNS and nIPNS, and the cloning of sfIPNS. A schematic diagram depicting the cloning strategy for sjIPNS and nIPNS is shown in Fig. 4.1a. For sfIPNS, extra steps in determining the full gene sequence were carried out in addition to those shown in Fig. 4.1a. 4.1.2.1 PCR amplification of sjIPNS and nIPNS to create suitable flanking restriction enzyme sites for cloning To ensure efficient expression of sjIPNS and nIPNS under the control of the T7promoter in pET24a vector, it was essential to insert the respective IPNS gene precisely downstream of the promoter using suitable cloning sites. Detailed examination of pET24a Fig. 4.1 Construction of recombinant sjIPNS and nIPNS expression vector. (a) Schematic representation of the cloning strategy used to construct recombinant vectors pET-SJ and pET-NL. (b) Gel electrophoresis of PCR amplified sjIPNS and nIPNS. kb PCR amplification from genomic DNA 5’ 3’ sjIPNS: primers OL151/OL152 nIPNS: primers OL155/OL156 NdeI Amplified sjIPNS and nIPNS products (~1 kb) were separated by gel electrophoresis show in lane and respectively. Lane shows the λHindIII marker. Lane and are the PCR control reactions without addition of DNA template. 23.1 9.4 6.6 4.4 2.2 2.0 ~ 1kb BamHI IPNS Cloning into pGEM-T Easy vector T7 NdeI BamHI pET24a 5310bp NdeI/BamHI digestion NdeI sjIPNS: pET-SJ nIPNS: pET-NL BamHI recombinant pET24 6300bp (c) Restriction enzyme digestion of sjIPNS and nIPNS recombinant expression vectors. The DNA gel electrophoresis shows the results for NdeI/BamHI double digestion to confirm that the recombinant clones contained the respective sjIPNS and nIPNS inserts. Lane shows the λHindIII marker. Lane shows pET24a with NdeI digestion. Lane and show the restricted products of pET-SJ and pET-NL respectively. kb 23.1 9.4 6.6 4.4 2.2 2.0 0.5 ~ 5.3kb ~ 1kb Chapter Results vector sequence revealed that the ATG translation start codon of the T7 promoter was embedded in the unique NdeI (CATATG) restriction site (Fig. 4.2). Thus creation of NdeI site at the respective translation start codon of sjIPNS and nIPNS should allow precise insertion of each IPNS gene under the control of T7 promoter. For the 3’ end, a BamHI site was created after the TGA stop codon of both IPNS genes for cloning (Fig. 4.2). Purified S. jumonjinensis JCM 4947 and N. lactamdurans JCM 4912 genomic DNA were used as the templates for PCR amplifications of sjIPNS and nIPNS genes respectively. The sequences of the primers designed to facilitate the addition of Nde1 and BamH1 restriction sites at the 5’ and 3’ end of each gene (Fig. 4.2) are shown in Appendix II. The optimal reaction conditions derived for PCR amplification of both IPNS genes are specified in Table 3.5. The amplified products of sjIPNS and nIPNS (each corresponding to ~1 kb in size) were separated by agarose gel electrophoresis as shown in Fig. 4.1b. The primers designed were very specific since there was only one distinct amplified product that corresponded to the expected product size for both IPNS genes. The amplified products were purified from the agarose gel and sequencing was performed to ascertain that they carried the sjIPNS and nIPNS genes. 4.1.2.2 Cloning of amplified sjIPNS and nIPNS into pET24a expression vector The sjIPNS and nIPNS PCR products were initially cloned into pGEM-T Easy vector (Promega) based on the T/A cloning method (Clark, 1988). Excision of sjIPNS and nIPNS genes from the respective recombinant pGEM-T Easy vectors using restriction enzymes NdeI and BamHI would ensure the acquisition of the NdeI-BamHI-flanked sjIPNS and nIPNS inserts for subcloning into similarly digested pET24a expression vector (Fig.4.1a). The appropriate digested fragments were purified and the sjIPNS and nIPNS inserts were then ligated to the NdeI/BamHI site of pET24a vector. The detailed steps involved in the construction of recombinant expression vectors for both IPNS isozymes are described in Section 3.2.7. After successive screening (results not shown), the resultant recombinant pET24a constructs, Fig. 4.2 Sequence confirmation of cloned sjIPNS and nIPNS in recombinant pET24a expression vectors. (a) Detailed diagram showing the relative position of IPNS insert with respect to the promoter and ribosome binding site (RBS) in pET24a. (b) The electropherograms showing the partial sequenced regions (nucleotide 47-156) of the cloned sjIPNS and nIPNS genes in recombinant pET24a expression vectors are presented in (i) and (ii) respectively. (c) Alignment of the corresponding sequence regions (nucleotide 47-156) of sjIPNS (accession number M36687) and nIPNS (accession number X57310) obtained from Genbank. translation start site T7 promoter lac operator RBS NdeI BamHI CATATG GTATAC (a) IPNS insert TGAGGATCC ACTCCTAGG Nucleotide 47-156 (b) (i) sjIPNS in pET-SJ 50 70 90 110 50 70 90 110 (ii) nIPNS in pET-NL (c) 130 130 150 150 sjIPNS 47CGCCGCTGTCCGGAGACGACGCGAAGGCGAAGCAGCGGGTCGCGCAGGAGATCAACAAGGCTGCCCGCGGGTCCGGCTTCTTCTACGCGTCGAACCACGGTGTGGACGTA------156 nIPNS 47------TATTCGGGGACGACGCGCAGGAGAAGGTCCGGGTCGGCCAGGAGATCAACAAGGCCTGCCGCGGTTCGGGCTTCTTCTACGCCGCCAACCACGGCGTGGACGTCCAGCGG156 Chapter Results designated pET-SJ for sjIPNS and pET-NL for nIPNS were isolated. When these recombinant pET24a vectors were digested with restriction enzymes NdeI and BamHI, DNA fragments corresponding to the expected size (~1kb) were being released indicating that the respective putative recombinant clones contained the relevant IPNS insert. However, to ascertain the identities of both IPNS genes to avoid mix-up or cross contamination, repeated sequencing of the forward and reverse strands of the cloned sjIPNS and nIPNS genes in the recombinant pET24a plasmids were carried out using selected sets of primers (Appendix II). Electropherograms showing the partial sequenced regions (nucleotide 47-156) of the cloned sjIPNS and nIPNS in pET-SJ and pET-NL are presented in Fig. 4.2. These sequences matched exactly with the corresponding sequence regions of both IPNS genes deposited in GenBank (sjIPNS: accession number M36687; nIPNS: accession number X57310). After obtaining the full-length gene sequences of sjIPNS and nIPNS from the recombinant constructs, comparative sequence analysis confirmed that the cloned genes contained the full intact sequences of both IPNS and harbored no random mutations. 4.1.3 Cloning strategy for sfIPNS A 990bp DNA fragment was previously amplified from S. fimbriatus JCM 4910 genomic DNA during screening of Streptomyces spp. for the presence of IPNS gene. This fragment was subsequently cloned into pGEM®-T Easy vector (Fig. 4.3) and sequenced. Sequence and blast results revealed that the fragment encodes a partial IPNS gene with the 5’ upstream and 3’ downstream flanking ends remaining unknown. Two separate methods described in the following sections were used to obtain the gene sequence upstream and downstream of the partial sfIPNS gene fragment. The retrieval of a partial IPNS gene from S. fimbriatus was interesting, as very little is known about the β-lactam antibiotic synthesis capability of this organism even though it has been implied to be a cephamycin producer (Stapley et al., 1972). Hence, it would be significant to retrieve the full IPNS gene from S. fimbriatus for characterization through expression and functional studies. Chapter Results Fig 4.3 Steps involved in retrieving the upstream DNA sequence of sfIPNS gene. (a) kb 23.1 9.4 6.6 4.4 2.2 2.0 0.5 3kb SC8 ~1kb partial sfIPNS gene SC9 Amplified 990bp IPNS-like DNA fragment from S. fimbriatus Lane shows the λHindIII DNA marker. Lanes and show ® EcoR1 digested pGEM -T Easy vector and recombinant pGEM clone containing the partial sfIPNS gene respectively To obtain the highlighted upstream unknown DNA sequence of sfIPNS gene PCR amplification from sfIPNS genomic DNA using sfIPNS internal primer (OL222) and consensus primer (OL254) specific to 3’ end of ACVS gene to amplify the upstream region of sfIPNS. Intergenic region pcbAB OL254 pcbC OL222 Proposed arrangement of β-lactam biosynthetic genes coding for ACVS and IPNS in S. fimbriatus PCR product amplified with OL254 and OL222 (b) kb 23.1 9.4 6.6 4.4 2.2 2.0 0.5 partial ACVS gene intergenic region partial IPNS gene ~366bp ~0.37kb Lane shows the λHindIII DNA marker. Lane shows the PCR product amplified with OL254 & OL222. Lane is the PCR control reaction without addition of DNA template. ACATCCTCGATCCGATCAACTACCACTACACGCCGAGCCGGGAG GACCTCGACCGGCTGGGCGACCGGCTGGGCAGGCTGGTGATGTT CAAGGCGGAGGAGCCCAACGAGATCGTCCGCGACCAGCAGCAGC ACCGGCTGTTCGAGTACTACCGCCGGACGCCGTACAACGCCCTG GACACCCTGCTGCCGGCCGGGTCGATCGAGGTCCGGCCGCTGCG CGGCGAGACCCATCACTCGTGGGTGCGCAATGAACGCCTGGTCA CCGAGATGTGCGAGCTGATCTCGGCGTCGCTGCGGGACGCCTGA CGAAACGGAGGATGCCATGCCCATTCTGATGCCATCGGCCGACG TGCCGACGATCGAC Start of sfIPNS gene Chapter Results 4.1.3.1 Procurement of the 5’ upstream sequence of sfIPNS through PCR amplification using homology based primers β-lactam biosynthetic genes are found to be linked in gene cluster(s) in both bacterial and fungal producers (Section 2.3). Close scrutiny revealed that the arrangement of biosynthetic genes coding for ACVS (pcbAB) and IPNS (pcbC), the first two enzymes in the biosynthetic pathway, are conserved in the β-lactam gene clusters elucidated thus far (Fig. 2.2). In all reported cases, pcbAB is found to precede pcbC (i.e. upstream of pcbC). In bacterial producing organisms, both pcbAB and pcbC are also found to be transcribed in the same direction. Hence, although the β-lactam gene-cluster of S. fimbriatus has not been elucidated, it is highly probable that the same arrangement of pcbAB and pcbC occurs in S. fimbriatus (Fig. 4.3). Base on this assumption, a homology based primer, OL254, specific to a conserved 3’ region of known pcbAB gene sequences was designed to amplify the upstream region of sfIPNS with an internal primer OL222 specific to the known 5’ sequence of the partial sfIPNS (Fig. 4.3). Purified S. fimbriatus 4910 genomic DNA was used as the PCR template. A distinct ~370bp amplified product that corresponded to the expected product size was obtained from the PCR reaction using OL254 and OL222 (Fig. 4.3b). The amplified product was purified and sequenced in both strands using the same primers employed in its amplification. Sequence results and alignment confirmed that the amplified fragment contained the partial putative S. fimbriatus ACVS gene (highlighted in green), an intergenic region (non-highlighted region) and the newly determined 5’ end sequence of sfIPNS (highlighted in pink) that overlaps with the known sfIPNS 5’end sequence retrieved previously (illustrated by the underlined pink region). 4.1.3.2 Genome walking for 3’ end of sfIPNS gene sequence As seen from the physical map of bacterial and fungal β-lactam biosynthetic gene clusters in Fig. 2.2, the gene arrangement downstream of IPNS is generally less conserved. Chapter Results Hence genome walking was carried out to obtain the 3’ downstream sequence of sfIPNS. Detailed description of this method that is used for cloning unknown genomic sequences adjacent to a DNA fragment of known sequence is presented in Section 3.2.6.2. The first step involved the construction of genomic DNA libraries of S. fimbriatus through complete digestion of separate aliquots of the genomic DNA with appropriate restriction enzymes, followed by ligation to GenomeWalk Adaptors. In this study, only PvuII digested genomic DNA library was constructed (Fig. 4.5a) as positive results obtained in previous genome walking experiments were mostly derived from PvuII digested libraries. A pair of nested primers, outer OL224 and inner OL225, designed based on the 3’ end of the retrieved sfIPNS partial gene fragment were used with nested adaptor primer AP1 and AP2 respectively to probe the adjoining unknown sfIPNS gene sequence (Fig. 4.4). Three amplified products with size ranging between ~0.6-0.3kb were obtained for the primary PCR reaction using OL224 and AP1 as primers (Fig. 4.5b) A secondary PCR amplification was performed using the amplified products from the primary PCR as template and nested primers OL225 and AP2. This resulted in the smallest amplified fragment from the primary PCR being the major product (Fig. 4.5b). This fragment was subsequently purified and sequenced directly using primer OL225 and AP2. Sequence analyses and homology sequence searches confirmed that the genome walked fragment encodes nucleotide 958 to 990 of sfIPNS gene (highlighted in pink in Fig. 4.4) with part of the sequence overlapping the known 3’ end of sfIPNS gene (indicated by the underlined pink region). Finally, the complete sfIPNS gene consisting of 990bp that encodes for 329 amino acids was obtained by piecing the upstream, downstream and partial sequences of S. fimbriatus through sequence alignments (Fig. 4.6). 4.1.3.3 PCR amplification of full-length sfIPNS to create suitable flanking restriction enzyme sites for subcloning Upon obtaining the full sequence of sfIPNS, subsequence steps undertaken for the cloning of full-length sfIPNS into expression vector are the same as those used for sjIPNS and Chapter Results Fig. 4.4 Retrieval of 3’ downstream gene sequence of sfIPNS through Genome walking. Known DNA sequences and arrangement of ACV and IPNS genes in S. fimbriatus thus far 958 ACV sfIPNS partial partial To obtain the highlighted downstream unknown DNA sequence of sfIPNS gene Design of nested primers specific to known 3’ end of sfIPNS ACV 958 sfIPNS OL224 OL225 Genome walking Construction of PvuII digested genomic library & ligation to GenomeWalker adaptors OL224 OL225 Amplified gene of interest from the library using gene specific & adaptor specific primer pairs AP2 AP1 Primary PCR amplification using primers AP1 & OL224 Secondary PCR amplification using primers AP2 & OL225 ~300bp TACCTCCAGCACGGCTTCCATGCGCTCATCGCCAAGAACGGACAGACCTGAGAGTGACC… End of sfIPNS gene Chapter Results Fig. 4.5 Gel electrophoresis of the PvuII digested sfIPNS genomic library and the amplified PCR products obtained from the genome walking experiment. (a) Lane shows the purified genomic DNA of sfIPNS. Lane shows an aliquot of sfIPNS genomic DNA completely digested by PvuII enzyme followed by phenol: chloroform purification. (b) Lanes and are the λHindIII DNA marker. Lane shows the three major amplified products, ranging in size from 0.6 to 0.3kb, resulted from the primary anchored PCR amplification. Lane shows the single ~0.3kb amplified product of the secondary anchored PCR amplification using the primary PCR products as template. (a) (b) kb 23.1 9.4 6.6 4.4 2.2 2.0 0.5 kb ~0.6kb ~0.4kb ~0.3kb 23.1 9.4 6.6 4.4 2.2 2.0 0.5 Fig. 4.6 ~0.3kb The full DNA sequence of sfIPNS and its translated amino acid sequence deposited in Genbank under the accession numbers AF320779 and AK11177.1 respectively. atgcccattctgatgccatcggccgacgtgccgacgatcgacatctcacccctgttcggc M P I L M P S A D V P T I D I S P L F G gacgacccggacgccaagacacacgtcgcccagcagatcaacaaggcgtgccgcggctcg D D P D A K T H V A Q Q I N K A C R G S ggcttcttctacgcctcccaccacggcatcgacgtccagcaactccaggacgtggtcaac G F F Y A S H H G I D V Q Q L Q D V V N gagttccacgggaccatgaccgacgaggagaagtacgacctggcgatcaacgcgtacaac E F H G T M T D E E K Y D L A I N A Y N agcgccaatccgcgggtgcgcaacggctactacatggccgtcgagggcaagaaggccgtc S A N P R V R N G Y Y M A V E G K K A V gagtcctggtgctatctgaacccgtcgttcggcgaggaccacccgatgatccggtcaggg E S W C Y L N P S F G E D H P M I R S G acaccgatgcacgaggtcaacatctggccggacgagaagcggcacgagcggttccggccg T P M H E V N I W P D E K R H E R F R P ttctgcgagcagtactaccgggacatgttccagctctccaagacgctgatgcggggcttc F C E Q Y Y R D M F Q L S K T L M R G F gcgctggcgctgggcaagcccgaggacttcttcgacgcgaacctgccggaggacgacacg A L A L G K P E D F F D A N L P E D D T ctgtccgccgtgtcgctcatccgctacccccacctgaaggcctacccgccggtgaagacg L S A V S L I R Y P H L K A Y P P V K T gggccggacggcacgaagctgagcttcgaggaccacctggacgtgtcggtgatcaccgtc G P D G T K L S F E D H L D V S V I T V ctgttccagaccgaggtgcagaacctccaggtcgagacggtgaacggctggcaggacctg L F Q T E V Q N L Q V E T V N G W Q D L ccgacgtcgggtgacgacttcctggtgaactgcggcacctacatggggtacctgacgaac P T S G D D F L V N C G T Y M G Y L T N gactacttcccggcgccgaaccaccgggtgaagttcatcaacgcggagcgcctgtccctg D Y F P A P N H R V K F I N A E R L S L ccgttcttcctgcacgccgggcacaccaccttgatggagccgttcagcccggaggacacc P F F L H A G H T T L M E P F S P E D T ggtggcaaggagctgaacccgccgatcgagtacggcgactacctccagcacggcttccat G G K E L N P P I E Y G D Y L Q H G F H gcgctcatcgccaagaacggacagacctga A L I A K N G Q T - 91 Chapter Results nIPNS (Fig. 4.1). To isolate the complete sfIPNS gene for cloning into pET24a, a pair of primers annealing to and incorporating single Nde1 and BamH1 site at the respective 5’ and 3’ end of full-length sfIPNS gene was needed. The principles behind choosing these sites for cloning of sfIPNS were the same as those discussed in Section 4.1.2.1. Close examination of the 5’ sequence of sfIPNS with those of sjIPNS and nIPNS revealed that both sfIPNS and sjIPNS shared the same identities for the first 13bp (Fig. 2.3). Hence, the same primer used to introduce Nde1 site at the 5’ end of sjIPNS through PCR amplification (Appendix II) could be used for the same purpose in sfIPNS. However, no match was found between the 3’ sequence of sfIPNS and the two isozymes. Hence, a new primer bearing the BamH1 site and specific to sfIPNS was designed to facilitate the incorporation of this site at the 3’ end of full-length sfIPNS (Appendix II). Purified S. fimbriatus JCM 4910 genomic DNA was used as the PCR template and the amplification conditions used for sfIPNS gene were the same as that optimised for the amplification of sjIPNS and nIPNS genes (Table 3.5). The resultant PCR products resolved in 0.8% agarose gel are shown in Fig. 4.7a. The primer pair used was very specific since only one major PCR product (~1kb) was obtained with minimal non-specific amplification. The amplified products were purified from the agarose gel and sequenced to ascertain that the products corresponded to sfIPNS gene. 4.1.3.4 Cloning of amplified full-length sfIPNS into pET24a expression vector After PCR amplification, the amplified full-length sfIPNS product was cloned into pGEM®-T Easy vector (Promega) (Clark, 1988). Nde1 and BamH1 restriction enzyme digestion of the recombinant pGEM®-T Easy plasmid was performed to release the cloned sfIPNS gene insert for ligation to the corresponding sites in pET24a vector. The resultant recombinant pET24a construct carrying the sfIPNS gene was named pET-SF. Restriction enzyme digestion was done to confirm that the recombinant construct contained the cloned gene inserts (Fig. 4.7b). Chapter Results Fig. 4. Gel electrophoresis of PCR amplified full-length sfIPNS, restriction enzyme digestion and sequence confirmation of cloned sfIPNS gene in recombinant pET24a expression vector. (a) The PCR amplified full-length sfIPNS with flanking NdeI/BamHI ends is shown in lane 2. Lane shows the λHindIII DNA marker. Lane is the PCR control reaction without the addition of DNA template. (b) Results for the restriction enzyme digestion to confirm that the recombinant pET-SF contained the sfIPNS insert. Lane shows the λHindIII DNA marker. Lanes and show the products of pET24a with NdeI and pET-SF with NdeI/BamHI digestion respectively. (c) The electropherogram showing the partial sequenced region (nucleotide 100-183) of the cloned full-length sfIPNS gene in recombinant pET-SF. (d) Alignment of the sequenced region of sfIPNS with the corresponding sequence regions of sjIPNS and nIPNS. (a) kb 23.1 9.4 6.6 4.4 2.2 2.0 0.56 b) kb 23.1 9.4 6.6 4.4 2.2 2.0 0.56 ~1kb ~5.3kb ~1kb translation start site (c) T7 promoter lac operator RBS BamHI TGAGGATC ACTCCTAGG NdeI CATATG GTATAC sfIPNS insert Nucleotide 100-183 100 sfIPNS in pET-SF 120 140 160 180 (d) sjIPNS sfIPNS nIPNS 100 AACAAGGCTGCCCGCGGGTCCGGCTTCTTCTACGCGTCGAACCACGGTGTGGACGTACAGCTGCTCCAGGACGTGGTGAACGAG 183 100 AACAAGGCGTGCCGCGGCTCGGGCTTCTTCTACGCCTCCCACCACGGCATCGACGTCCAGCAACTCCAGGACGTGGTCAACGAG 183 100 AACAAGGCCTGCCGCGGTTCGGGCTTCTTCTACGCCGCCAACCACGGCGTGGACGTCCAGCGGCTGCAGGACGTGGTCAACGAG 183 Chapter Results As mentioned earlier, due to the high sequence homologies among different IPNS genes, precautionary steps were taken through repeated sequencing at different junctures of the cloning process to avoid cross-contamination and mixing up. Sequencing of pET-SF using select sets of primers (Appendix II) was carried out meticulously to confirm the authenticity of the cloned sfIPNS gene. Electropherograms showing the partial sequenced region (nucleotide 100 to 183) of sfIPNS in pET-SF are presented in Fig. 4.7c. Clearly, sfIPNS was successfully cloned into pET24a as the sequence obtained is specific to that of sfIPNS and different from those of sjIPNS and nIPNS (Fig. 4.7c). Repeated sequencing of the forward and reverse strands of the cloned sfIPNS also ascertained that no random gene mutations has been incorporated during the amplification and cloning process. 4.1.4 Expression of scIPNS, sjIPNS, sfIPNS and nIPNS in E. coli BL21(DE3) Previous expression of scIPNS under the T7-promoter in E. coli BL21(DE3) showed a distinct trend of increased soluble scIPNS production (3% to 29% of the total soluble proteins) with lowering of induction temperatures from 37°C to 25°C (Sim et al., 1996). Thus far, expression studies of sjIPNS were only carried out at 37°C and 30°C, which yielded mainly insoluble aggregates at 37°C and only small amounts of soluble sjIPNS was obtained at 30°C (Table 2.4b). Since then, there has been no further investigation on the expression of sjIPNS at induction temperature lower than 30°C. As for nIPNS, no work has been done on its cloning and expression in E. coli although nIPNS has been reported to be an intracellular soluble enzyme in its original host (Castro et al., 1988). As for sfIPNS, its expression profile remains uncharacterized since it has only been newly isolated in this study. Therefore, to investigate whether scIPNS, sjIPNS, sfIPNS and nIPNS exhibit different expression profiles, thorough expression studies of all the isozymes in E. coli over a range of induction temperatures, from 37°C, 30°C, 28°C to 25°C were compared. The expression of scIPNS was studied using a recombinant E. coli BL21(DE3) culture harboring the pET-SC plasmid (Sim et al., 1996). Likewise, the recombinant pET24a constructs, pET-SJ, pET-SF and Chapter Results pET-NL, carrying the respective sjIPNS, sfIPNS and nIPNS genes were also transformed into E. coli BL21(DE3) for this purpose. E. coli BL21(DE3) was used because the strain contains a chromosomal copy of the gene for T7 RNA polymerase which is required for transcription from the T7-promoter of pET24a. To ensure that the expression results were comparable, recombinant and nonrecombinant (control) E. coli BL21(DE3) cultures were grown to O.D.600 of ~1.2-1.3, induced with ImM IPTG and cultured for 15 hours at 37°C, 30°C, 28°C to 25°C. Subsequently, the induced cultures were harvested and cell-free extracts were prepared as described in Section 3.2.9.2. The soluble and insoluble protein fractions were analysed by SDS-PAGE and the percentages of various IPNS isozymes expressed in the corresponding protein fractions were determined using densitometric scanning (Fig. 4.8c). The expression studies were repeated at least times to demonstrate reproducibility. Unanimous results were obtained from the repeated expression studies. No overexpressed protein band was detected in both the soluble (S) and insoluble (I) protein fractions of the non-recombinant E. coli BL21(DE3) control cultures. Hence, only the soluble protein fractions of the control cultures were shown in lane C of all the SDS-PAGE gels showing the soluble protein fractions (Fig. 4.8aI-IV). High-level expression of the IPNS isozymes at all the temperatures were evident from the presence of ~37kDa overexpressed protein bands in the SDS-PAGE analyses of all the isozymes. This reflects the strength of the powerful T7promoter. Close analysis revealed that all IPNS isozymes showed similar profiles at 37°C and 30°C, whereby the IPNS proteins produced mainly aggregated in the insoluble protein fractions (Fig. 4.8). However, as temperatures were lowered to 28°C and 25°C, differences in expression were observed. For scIPNS, sfIPNS and nIPNS, ~9-13% of soluble proteins were obtained at 28°C (Fig. 4.8aI, II, III). Further reducing the temperature to 25°C markedly increased the soluble expression of all the three isozymes up to 25-41%, constituting a ~3 to fold increase in the soluble protein syntheses (Fig. 4.8c). Noticeably, the temperature at which the IPNS isozymes were expressed played a decisive role in the partitioning of the isozymes between the soluble Fig. 4.8 Expression analysis of scIPNS, sfIPNS, nIPNS and sjIPNS in E. coli BL21(DE3) at various induction temperatures. The soluble protein fractions of scIPNS, sfIPNS, nIPNS and sjIPNS were shown in I(a), II(a), III(a) and IV(a) respectively, whereas I(b), II(b), III(b) and IV(b) contained the corresponding insoluble protein fractions of scIPNS, sfIPNS, nIPNS and sjIPNS. The first lane (marked M) in all gels shows the protein standards of various molecular sizes (kDa). The second lane (marked C) of gels in (a) shows the soluble protein fractions of E. coli BL21(DE3). Lanes through in both (a) and (b) shows the respective protein fractions obtained at 37°C, 30°C, 28°C and 25°C. The arrows indicate the positions of the expressed IPNS isozymes in each gel. The percentages of various IPNS enzymes expressed in the various protein fractions were measured using densitometric scanning and the values obtained were plotted in the charts shown in (c). (b) Insoluble protein fractions (a) Soluble protein fractions kDa 115 83.0 I. scIPNS M C 37ºC 30ºC 28ºC 25ºC kDa 100 75 M 37ºC 30ºC 28ºC 25ºC 34.6 29.0 M C 37ºC 30ºC 28ºC 25ºC kDa 100 75 50 50 37 37 25 25 kDa 150 100 75 M C 37ºC 30ºC 28ºC 25ºC kDa 37ºC 30ºC 28ºC 25ºC M 37ºC 30ºC 28ºC 25ºC 25 M C 37ºC 30ºC 28ºC 25ºC kDa 115 83.0 49.4 49.4 34.6 29.0 M 37 25 83.0 kDa 100 75 50 50 37 IV. sjIPNS 37ºC 30ºC 28ºC 25ºC 49.4 29.0 III. nIPNS M 49.4 34.6 II. sfIPNS kDa 115 83.0 34.6 29.0 Fig. 4.8 (Ctd.) (c) % of different IPNS isozymes expressed in the soluble % of different IPNS isozymes expressed in the insoluble protein fractions 50 40 40 % of IPNS expression % of IPNS expression protein fractions 50 30 20 30 20 10 10 37ºC 30ºC 28ºC 37ºC 25ºC 30ºC 28ºC Induction temperature (ºC) Induction temperature (ºC) sjIPNS scIPNS sfIPNS nIPNS 25ºC Chapter Results and insoluble protein fractions. However, a noteworthy point is that lowering of growth temperature seems to have a greater effect on the expression of nIPNS compared to the expression of scIPNS and sfIPNS. In contrast, sjIPNS was mainly associated with the insoluble fractions at all the temperatures studied (Fig. 4.8aIV, bIV). Apparently, lowering of induction temperature to 25°C has negligible effect on the soluble expression of sjIPNS, with only ~4% of soluble sjIPNS produced (Fig. 4.8c). As a note, the expression results of scIPNS and sjIPNS obtained in this study agree with the results from the previous reported studies. 4.1.5 Grouping of bacterial IPNS based on soluble expression characteristics in E. coli Besides the four bacterial IPNS examined in this study, one other bacterial IPNS from S. lipmanii (sIIPNS) (Loke et al., 2000) cloned and expressed in our laboratory was also included in the analysis of this section. sIIPNS was similarly expressed in E. coli BL21(DE3) under the T7-promoter in pET24a at the same conditions used in this study. Whereas negligible amount of soluble sIIPNS was expressed at 37°C, up to 21% of soluble sIIPNS was obtained at much lower temperature of 25°C. Sequence analysis revealed that scIPNS, sjIPNS, sfIPNS, nIPNS and sIIPNS share 77% to 85% DNA sequence identities and 70% to 82% amino acid sequence identities (Table 2.3). Furthermore, IPNS enzymes were also proposed to be structurally homologous, hence possessing the same characteristic folds (Roach et al., 1995). With such remarkable sequence and structural homologies, one would expect the IPNS enzymes to have the same expression profiles in E. coli. On the contrary, the five bacterial IPNS examined were shown to exhibit varied soluble expression in E. coli. Choosing 37°C and 25°C as the reference temperatures, it is possible to segregate the five bacterial isozymes into two groups based on their soluble expression at these two temperatures. Group I consists of scIPNS, sfIPNS, nIPNS and sIIPNS that display temperature-dependent solubility whereby soluble enzymes were only formed at 25°C instead Chapter Results Fig. 4.9 Grouping of IPNS isozymes based on soluble expression characteristics at 37°C and 25°C in E. coli. scIPNS sjIPNS T7 promoter T7 terminator sfIPNS pET24a expression vector nIPNS sIIPNS 77% to 85% DNA sequence identities and 70% to 82% amino acid sequence identities High sequence homologies High structural homologies Differential soluble expression in E. coli BL21(DE3) observed at 37°C & 25°C IPNS isozyme Length of amino acid Size (kDa) % soluble IPNS expressed 37°C 25°C 36.9 37.2 37.4 37.8 [...]... sfIPNS gene for cloning into pET24a, a pair of primers annealing to and incorporating single Nde1 and BamH1 site at the respective 5’ and 3’ end of full-length sfIPNS gene was needed The principles behind choosing these sites for cloning of sfIPNS were the same as those discussed in Section 4 .1. 2 .1 Close examination of the 5’ sequence of sfIPNS with those of sjIPNS and nIPNS revealed that both sfIPNS and. .. of sfIPNS and different from those of sjIPNS and nIPNS (Fig 4.7c) Repeated sequencing of the forward and reverse strands of the cloned sfIPNS also ascertained that no random gene mutations has been incorporated during the amplification and cloning process 4 .1. 4 Expression of scIPNS, sjIPNS, sfIPNS and nIPNS in E coli BL 21( DE3) Previous expression of scIPNS under the T7-promoter in E coli BL 21( DE3)... of PCR amplified full-length sfIPNS, restriction enzyme digestion and sequence confirmation of cloned sfIPNS gene in recombinant pET24a expression vector (a) The PCR amplified full-length sfIPNS with flanking NdeI/BamHI ends is shown in lane 2 Lane 1 shows the λHindIII DNA marker Lane 3 is the PCR control reaction without the addition of DNA template (b) Results for the restriction enzyme digestion... digestion to confirm that the recombinant pET-SF contained the sfIPNS insert Lane 1 shows the λHindIII DNA marker Lanes 2 and 3 show the products of pET24a with NdeI and pET-SF with NdeI/BamHI digestion respectively (c) The electropherogram showing the partial sequenced region (nucleotide 10 0 -18 3) of the cloned full-length sfIPNS gene in recombinant pET-SF (d) Alignment of the sequenced region of sfIPNS with... (Clark, 19 88) Nde1 and BamH1 restriction enzyme digestion of the recombinant pGEM®-T Easy plasmid was performed to release the cloned sfIPNS gene insert for ligation to the corresponding sites in pET24a vector The resultant recombinant pET24a construct carrying the sfIPNS gene was named pET-SF Restriction enzyme digestion was done to confirm that the recombinant construct contained the cloned gene inserts... The soluble protein fractions of scIPNS, sfIPNS, nIPNS and sjIPNS were shown in I(a), II(a), III(a) and IV(a) respectively, whereas I(b), II(b), III(b) and IV(b) contained the corresponding insoluble protein fractions of scIPNS, sfIPNS, nIPNS and sjIPNS The first lane (marked M) in all gels shows the protein standards of various molecular sizes (kDa) The second lane (marked C) of gels in (a) shows the... structure of sjIPNS was adopted (Fig 4 .10 ) Manipulation of expression environment of sjIPNS includes using an alternative expression host strain, the use of extreme induction temperatures and linking sjIPNS to highly soluble fusion partners The other strategy explores the rational replacements of specific sjIPNS amino acid residues through site-directed mutagenesis to produce highly soluble and active sjIPNS... been no further investigation on the expression of sjIPNS at induction temperature lower than 30°C As for nIPNS, no work has been done on its cloning and expression in E coli although nIPNS has been reported to be an intracellular soluble enzyme in its original host (Castro et al., 19 88) As for sfIPNS, its expression profile remains uncharacterized since it has only been newly isolated in this study Therefore,... region of sfIPNS with the corresponding sequence regions of sjIPNS and nIPNS (a) kb 1 2 3 23 .1 9.4 6.6 4.4 2.2 2.0 0.56 b) kb 1 2 3 23 .1 9.4 6.6 4.4 2.2 2.0 0.56 ~1kb ~5.3kb ~1kb translation start site (c) T7 promoter lac operator RBS BamHI TGAGGATC ACTCCTAGG NdeI CATATG GTATAC sfIPNS insert Nucleotide 10 0 -18 3 10 0 sfIPNS in pET-SF 12 0 14 0 16 0 18 0 (d) sjIPNS sfIPNS nIPNS 10 0 AACAAGGCTGCCCGCGGGTCCGGCTTCTTCTACGCGTCGAACCACGGTGTGGACGTACAGCTGCTCCAGGACGTGGTGAACGAG... sjIPNS mutants Evidently from Fig 4.9, the only variable factor in the comparative expression analysis is the gene structures that in turn code for primary amino acid sequences of the different IPNS isozymes This implicates that the primary amino acid sequence of each IPNS, in particular the non-homologous regions, play an influential role in determining the folding characteristic of each IPNS during expression . shown in Appendix III. 4 .1. 2 Cloning strategy for sjIPNS and nIPNS The gene sequences of sjIPNS and nIPNS were known (Shiffman et al., 19 88; Coque et al., 19 91) but that of sfIPNS was unknown. corresponding sequence regions of both IPNS genes deposited in GenBank (sjIPNS: accession number M36687; nIPNS: accession number X57 310 ). After obtaining the full-length gene sequences of sjIPNS and. strands of the cloned sfIPNS also ascertained that no random gene mutations has been incorporated during the amplification and cloning process. 4 .1. 4 Expression of scIPNS, sjIPNS, sfIPNS and