Characterisation of the rho GTPase target dishevelled associated activator of morphogenesis 1 (DAAM1

In this thesis, I sought to characterise DAAM1 in terms of its domain organisation and function, and to compare observable cytoskeletal effects of DAAM1 with known formins in mammalian c

CHARACTERISATION OF THE RHO GTPASE TARGET DISHEVELLED ASSOCIATED ACTIVATOR OF

MORPHOGENESIS 1 (DAAM1)

ANG SU FEN

NATIONAL UNIVERSITY OF SINGAPORE

2008

CHARACTERISATION OF THE RHO GTPASE TARGET DISHEVELLED ASSOCIATED ACTIVATOR OF

MORPHOGENESIS 1 (DAAM1)

ANG SU FEN

(B.Sc (Hons.), NUS)

A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

NUS GRADUATE SCHOOL FOR INTEGRATIVE

SCIENCES AND ENGINEERING

NATIONAL UNIVERSITY OF SINGAPORE

2008

Acknowledgements

Acknowledgements

First and foremost, I would like to thank my supervisor, Dr Ed Manser, for his mentorship and guidance in these four years Also, I would like to thank Dr Jackson Zhao, my co-supervisor, who has offered me tremendous help, be it in experimental techniques or data analysis I am also grateful to Prof Louis Lim for granting me a position in GSK-IMCB lab to conduct my research, which finally led to the generation of this thesis At the same time, I would like to extend my gratitude to members on my thesis advisory committee, Dr Victor Yu and Dr Hooi Shing Chuan, for their suggestions and guidance that helped me progress through different stages of

my project

I am most fortunate to be part of the GSK-IMCB lab, a fun and interactive lab that one would never want to leave I would like to thank all my fellow lab mates for their support and presence in the lab which makes it a lively place to be in Special thanks go to Elsa, Yeow Fong and Jet Phey, who provided me with much assistance when I first joined the lab and in a way, inducted me into the lab Thanks also go to Yohendran, Delina, Praju, Jeff Yong, Paochun and Soon Tuck, fellow students who join me in the pursuit of a doctorate I would also like to thank members of the lab (past and present) who have made my four years of stay most memorable: Sinnisky, Evonne, Charis, Christy, Puneet, Irene, Dr Jeff Robens, Dr Chan Wing, Dr Dong Jing Ming, Dr Perry Chan, Dr Thomas Leung, Dr Ivan Tan, Mr Joel Lee, Ms Rossiter and

Ms Rani

Apart from my lab members, I also want to thank my best friends, Chengying, Jiamin, Aifen, June and Huifen, whom I have known for more than ten years They

Acknowledgements

never fail to offer encouragement and advice in times of need, which helped me overcome difficulties encountered in different stages of my life I would also like to express my thanks to members in my Honours lab and my ex-classmates They include Mirtha, Baohua, Koh Shiuan, Lily, Hang Yee, Kah Weng and Shiqi I am also glad to have Boon Kiat, someone who have always been my source of comfort and support, for company in this arduous stage of thesis writing,

In addition, I would like to express my thanks to my family, both immediate and extended, for being so understanding and encouraging in this whole process Their never-ending support and unconditional care give me the strength to persevere till the end Finally, I would like to thank A*STAR for giving me this scholarship, without which I would not be able to come this far, and also IMCB for providing the necessary facilities for my research I would also like to thank NGS for providing their best support to students It would be impossible to mention everyone here, so before I end I would like to say a big thank you to all those who have helped me in one way or another and have contributed to making this thesis a success Thank you very much!

Table of Contents

Table of Contents

Acknowledgements i

Table of Contents iii

Abstract ix

List of Figures and Tables xi

Abbreviations xiii

Chapter 1 Introduction 1

1.1 Formins 1

1.1.1 Formin family of proteins 1

1.1.2 Formin domains 2

1.1.3 Lessons from Diaphanous 8

1.2 Rho GTPases 10

1.2.1 Rho GTPase family 10

1.2.2 Regulation of Rho GTPases 11

1.2.3 RhoA, Rac1 and Cdc42 13

1.2.4 Rho GTPases in cell migration 16

1.3 Dishevelled Associated Activator of Morphogenesis 1 (DAAM1) 17

Table of Contents

1.4 Thesis objectives 18

Chapter 2 Materials and Methods 20

2.1 Cell culture 20

2.2 Antibodies 20

2.3 Reagents 21

2.4 Plasmids and oligonucleotides 21

2.4.1 List of DAAM1 primers 22

2.5 Site-directed mutagenesis 24

2.6 Sequence analyses and alignment 26

2.7 Transfection 26

2.8 siRNA Transfection 26

2.9 Drug treatment 27

2.10 Lipid raft purification 27

2.11 Immunoprecipitation 27

2.12 Western analysis 28

2.13 Wound healing assays 28

2.14 Microinjection 29

Table of Contents

2.15 Immunofluorescence 29

2.16 Live-cell imaging 30

Chapter 3 Results 31

3.1 DAAM1 31

3.1.1 DAAM1 domains 31

3.1.2 DAAM1 isoforms 31

3.1.3 DAAM1 versus DAAM2 34

3.1.4 DAAM1 in different species 34

3.1.5 Analysis of DAAM1 FH3 domain 34

3.2 Generation and purification of DAAM1 antibody 38

3.3 Localisation of DAAM1 38

3.3.1 Design of DAAM1 truncation constructs 40

3.3.2 Localisation of endogenous DAAM1 40

3.3.3 DAAM1 localisation to the actin cytoskeleton 40

3.3.4 DAAM1 and the Golgi apparatus 44

3.3.5 Localisation of putatively active DAAM1: DAAM1 FH1-FH2-DAD 44

Table of Contents

3.3.6 The FH1-FH2-DAD from different formins produce similar

phenotypes 49

3.3.7 The activity of DAAM1 in vivo requires a C-terminal basic region 54

3.3.8 Lipid raft association of DAAM1 59

3.4 Effects of DAAM1 on the cytokeleton 63

3.4.1 Effect of DAAM1 on actin 63

3.4.2 Effect of DAAM1 on microtubules 63

3.4.3 Effect of DAAM1 on myosin II 63

3.5 Interaction of DAAM1 with Rho GTPases 64

3.5.1 Co-immunopreciptation assays and Western analysis 64

3.5.2 Immunofluorescence 67

3.5.3 Deriving GTPase binding defective DAAM1 67

3.5.4 Localisation of DAAM1 N-ter, (1-233) and (1-440) GBD mutants 70

3.6 siRNA knockdown of DAAM1 in cell lines 73

3.7 DAAM1 and Dishevelled 2 (Dvl2) 73

3.8 A system to test DAAM1 involvement in cell migration 75

3.8.1 DAAM1 is essential for Golgi apparatus orientation in cell

migration 79

Table of Contents

Chapter 4 Discussion 90

4.1 DAAM1 localisation and its significance 90

4.1.1 DAAM1 localisation to actin stress fibres 91

4.1.2 DAAM1 localisation to the Golgi 92

4.1.3 DAAM1: To Golgi or actin stress fibres? 92

4.1.4 DAAM1 localisation with a subset of myosin II fibres 93

4.2 Defining regions important for DAAM1 activity in vivo 94

4.2.1 DAAM1 FH1-FH2-DAD and actin polymerisation 94

4.2.2 DAAM1 FH1-FH2-DAD and the HeLa phase-dark structures 95

4.2.3 DAAM1 FH1-FH2-DAD and microtubule reorganisation and

stabilisation 96

4.2.4 DAAM1 FH1-FH2-DAD and lipid raft association 97

4.2.5 Contribution of different domains to activation 97

4.2.6 DAAM1 localisation: COS 7 versus HeLa 99

4.3 Rho GTPases and DAAM1 99

4.3.1 Interaction of DAAM1 with GTPases 99

4.3.2 Analysis of DAAM1 GBD mutants 100

Table of Contents

4.4 DAAM1 and Dishevelled 2 (Dvl2) 101

4.4.1 DAAM1 and Dvl2 localisation 102

4.4.2 DAAM1, Rho GTPase and Dvl2 association 103

4.5 Role of DAAM1 in polarised migration 103

4.6 A summary of DAAM1 localisation 106

4.7 Conclusion 108

Bibliography 110

Abstract

Abstract

Dishevelled Associated Activator of Morphogenesis 1 (DAAM1) is a formin which has been found to be important for gastrulation Formins are long known as targets for Rho GTPases and their actin polymerisation effects More recently, formins have been implicated in the regulation of microtubule dynamics The involvement of formins in such cytoskeletal remodelling points to its importance in regulating downstream events like complex morphological re-organisation of tissues and cell migration

In this thesis, I sought to characterise DAAM1 in terms of its domain organisation and function, and to compare observable cytoskeletal effects of DAAM1 with known formins in mammalian cells The N-terminal portion of DAAM1 controls Rho GTPase interaction and subcellular localisation I found that DAAM1 can interact with active versions of RhoA, Rac1 and Cdc42 via the conserved N-terminal GTPase binding domain (GBD) I also observed that DAAM1 can localise to Golgi and actin/myosin II stress fibres The minimal region for Golgi localisation consists of residues 1-233 (GBD) of DAAM1 Residues 1-44 are insufficient but indispensable for Golgi localisation Stress fibre localisation requires at least residues 1-350 A coiled-coil containing construct consisting of residues 100-350 was also shown to generate thick fibrils that are enriched in DAAM1 and myosin II

Like most formins, the C-terminal portion is responsible for formin functions DAAM1 FH1-FH2-DAD (C-terminal half of the protein) generates long, fine actin fibres parallel to the long axes of HeLa cells (F-actin phenotype) It also generated phase-dark patches that contain the lipid raft marker, cholera toxin B (CTB) and Glu-

Abstract

tubulin, a form of tubulin found in stabilised microtubules) In contrary to general models, truncation of the Diaphanous autoinhibitory domain (DAD) could not generate the F-actin phenotype It transpired that the C-terminal 33 residues of DAAM1 (also removed in this DAD-deleted construct) were essential for both generation of actin fibres and the phase-dark patches Therefore, DAAM1 is directly involved in actin polymerisation and microtubule stabilisation

Cell migration requires the coordinated function of many cytoskeletal structures under the control of RhoA, Rac1 and Cdc42 in most vertebrate cells To assess the physiological roles of DAAM1 in the process of cell migration, a typical wound scratch assay was used When DAAM1 was knocked down by siRNA in COS-

7 cells, Golgi re-orientation, a process that occurs upon wounding, was strongly impaired and cells at the wound edge displayed many random protrusions rather than

a broad lamellopodium These pointed to a failure in polarisation since migration rates were unaffected Live-imaging results suggest that Golgi re-orientation occur via nuclear rotation In multiple cases, the Golgi apparatus was maintained in the same position with respect to the nucleoli throughout the process of re-orientation The nucleus rotates such that the Golgi is eventually re-positioned to face the wound edge These activities of DAAM1 acting on both actin and microtubule networks likely underlie its effect on Golgi orientation in response to polarity cues Hence, I propose that DAAM1 is important in transmitting cell polarity cues to the cytoskeleton

List of Figures and Tables

List of Figures and Tables

Figure 1.1 The seven subfamilies of metazoan formins 2

Figure 1.3 Crystal structure of mDia1 N ter and RhoC 5

Figure 1.6 Role of Rho GTPases in cell migration 16

Figure 2.1 Site directed mutagenesis (two-step PCR) 25

Figure 3.4 Alignment of FH3 consensus sequences of DAAM1

Figure 3.5 Generation and purification of DAAM1 antibody 39

Figure 3.7 Localisation of endogenous DAAM1 in different cell

Figure 3.8 DAAM1 and its localisation to the cytoskeleton 43

Figure 3.9 DAAM1 and its localisation to the Golgi apparatus 45-48

Figure 3.10 Expression of DAAM1 FH1-FH2-DAD in different

Figure 3.11 hDia1 and FHOD2 C-ter generates phase-dark and

Figure 3.12 C-terminal basic region of DAAM1 is required for

DAAM1 actin polymerisation activity 56-57 Figure 3.13 DAD alone is not sufficient to activate DAAM1 58

List of Figures and Tables

Figure 3.14 Association of DAAM1 with lipid rafts 60-62

Figure 3.15 DAAM1 FH1-FH2-DAD generated phase-dark patches

Figure 3.16 Effects of DAAM1 100-350 on myosin II in COS 7

Figure 3.17 Interaction of DAAM1 with Rho GTPases (Co-IP) 68

Figure 3.18 Interaction of DAAM1 with active Rho GTPases (IF) 69

Figure 3.19 Generation of DAAM1 N-ter GBD mutants and

determination of binding to the Rho GTPases 71

Figure 3.23 Migration of COS 7 in wound healing assay 80-81

Figure 3.24 Golgi re-orientation of COS 7 in wound healing assays 82

Figure 3.25 Effects of different drug treatments on Golgi re-orient-

Figure 3.26 Tubulin staining of COS 7 wound edge cells 85

Figure 3.27 Effects of αPAK KID and dominant inhibitory Rho

GTPases on Golgi re-orientation in COS 7 cells 86

Figure 3.28 Golgi re-orientation and nuclear rotation in COS 7 88-89

Figure 4.2 Detyrosination/Tyrosination cycle of tubulin 96

Figure 4.3 Non-canonical/Planar cell polarity (PCP) pathway 102

Table 3.1 Sequence identities between DAAM1 of different

Abbreviations

Abbreviations

APC: Adenomatous polyposis coli

Arp2/3: Actin related protein 2/3

Bni1p: Bud not involved 1 protein

CC: Coiled-coil

Cdc42: Cell division cycle 42

CIP4: Cdc42 interacting protein 4

DAD: Diaphanous auto-regulatory domain

Dia: Diaphanous

DID: Diaphanous inhibitory domain

Dvl: Dishevelled

EB1: End-binding protein 1

FBS: Fetal bovine serum

FH: Formin homology

FHOD: Formin homology domain containing protein FMN: Formin-like protein

FRL: Formin related gene in leukocytes

GAP: GTPase activating protein

GBD: GTPase binding domain

GDI: Guanine nucleotide dissociation inhibitors GDP: Guanosine-5’-diphosphate

GEF: Guanine nucleotide exchange factors

GFP: Green fluorescent protein

INF: Inverted formin

IQGAP: IQ motif-containing GTPase-activating protein

LARG: Leukaemia-associated Rho-GEF

MBS: Myosin binding subunit

MLCK: Myosin light chain kinase

MLCP: Myosin light chain phosphatase

MRCK: Myotonic dystrophy kinase-related Cdc42-binding kinase

MTOC: Microtubule organising centre

M CD: Methyl- -cyclodextrin

PAK: p21 activated kinase

PBS: Phosphate buffered saline

PCR: Polymerase chain reaction

PDZ: Post synaptic density protein (PSD95), Drosophila disc large tumor suppressor (DlgA), and zonula occludens-1 protein (zo-1)

PKC: Protein kinase C

Rac: Ras-related C3 Botulinum toxin substrate

Ras: Rat sarcoma viral oncogene

RFP: Red fluorescent protein

Abbreviations

Rho: Ras homolog

ROK: Rho kinase

SDS: Sodium dodecyl sulphate

siRNA: small interfering RNA

SRF: Seum response factor

in the form of unilateral or bilateral renal aplasia [1]

1.1.1 Formin family of proteins

To date, a total of 15 formin genes were identified in mammals [2-4] In metazoans, formins are classified into 7 subfamilies, namely Diaphanous (Dia), DAAM, formin related gene in leukocytes (FRL), formin homology domain containing protein (FHOD), formin-like protein (FMN), inverted formin (INF) and Delphilin (Figure 1.1) Formins are generally large proteins that span over a thousand amino acids in length Conserved domains of formins include: GTPase binding domain (GBD), formin homology (FH) 1, 2, 3 domains and the Diaphanous auto-regulatory domain (DAD) (Figure 1.2a) The FH1 and the FH2 domains are most conserved among the different formins The crystal structure of the FH2 domain of Bni1p, a formin found

in the budding yeast Saccharomyces cerevisiae has been resolved [5] The structure of

the GBD with either the DAD or RhoC was also resolved for mouse Diaphanous (mDia) [6-10] These successes in protein structure resolution helped substantiate the

Chapter 1: Introduction

proposed structural organisation of various domains and the mechanism of formin

regulation and function

Figure 1.1 The seven subfamilies of metazoan formins

Mouse formins were aligned using ClustalW Accession numbers of sequences used

are: Dia1 (O08808), Dia2 (Q9Z207), Dia3 (O70566), DAAM1 (Q8BPM0), DAAM2

(Q80619), Delphilin (NP_579933), FRL1 (NP_005883), FRL2 (NP_443137), FRL3

(NP_783863), FHOD1 (Q6P9Q4), FHOD2 (Q76LL6), INF1 (XP_130991), INF2

(NP_940803), FMN1 (NP_034360), FMN2 (NP_062318)

1.1.2 Formin domains

The GTPase binding domain (GBD), as its name suggests, is the region to which Rho

GTPases bind It resides at the N-terminal portion of formins In mDia1, the GBD is

mapped to residues 60-260, the region where RhoA specifically binds [11] However,

a sequence-related GBD is not present in all formins Formins of the FMN, INF and

Delphilin subfamilies do not apparently contain a GBD In typical GBD-containing

Dia2Dia3

FMN1

FHOD1

FHOD2

Dia2Dia3

FMN1

FHOD1

FHOD2

Dia2Dia3

FMN1

FHOD1

FHOD2

Dia2Dia3

FMN1

FHOD1

Dia2Dia3

FMN1

FHOD1

FHOD2

Chapter 1: Introduction

formins like mDia1, the GBD is essential for formin activation mDia1 is inhibited via the interaction of its Diaphanous inhibitory domain (DID) and DAD [10, 12] The mDia1 DID is a protease resistant stretch of 241 amino acids involving residues 129-361, a region that overlaps with both the GBD and the FH3 “domains” [13] Formin activation is achieved by binding of a GTP loaded Rho GTPase to the GBD This binding occurs primarily via hydrophobic interactions and results in a change in the protein conformation Electrostatic repulsion of the DAD from the DID and the GTPase occurs as a result of the conformational change [9] The ‘activated’ formin is proposed to exist in an “open” conformation with its FH2 domain exposed for interaction with profilin:actin (Figure 1.2b) A recent paper reported that the DID-DAD interaction could mediate hetero-dimerisation between mDia1 and mDia2, suggesting the possibility of cross-regulation among different formins [14], however this remains to be demonstrated in the context of endogenous proteins

auto-An important component for auto-inhibition, the DAD, is a stretch of 20-30 amino acids found C-terminal to the FH2 domain The DAD is characterised by a number of amino acids including leucines and basic residues The consensus sequence for DAD, GXMDXLLXXL (where X stands for any amino acid), has been identified [15] Basic residues (positively charged motif RRKR) found C-terminal to this were found to be indispensable for DID-DAD interaction [15, 16] Expression of the DAD can relieve mDia2 auto-inhibition leading to increased actin fibres and consequential stimulation of serum response factor (SRF) activity Mutation of residues within the mDia2 DAD core to alanines (M1041A, L1044A and L1048A) abolish interaction with DID and these effects on actin and SRF activity This reinforces the observation that DAD mediates auto-inhibition by binding to the DID, thereby keeping the formin

Figure 1.2 Formin structure and regulation

(a) Domain structure of a typical formin (b) Regulation of formin: formin exists in an auto-inhibited state maintained by the interaction of the GBD (DID) and the DAD Binding of an active GTPase to the GBD disrupts the DID-DAD interaction, thereby relieving the inhibition The formin then exists in an active conformation poised for interaction with its downstream effectors

Chapter 1: Introduction

Figure 1.3 Crystal structure of mDia1 N-ter and RhoC

Interaction of the GBD, DAD and Rho, picture adapted from reference 9

The FH3 domain is the least conserved regions in formins In mDia1, the FH3 domain contains part of the DID and the dimerisation domain (DD, residues 377-452) [7] The functions of the FH3 domain are largely unknown and it is not clear whether this region forms a functional domain In the case of the fission yeast, sequences within the FH3 of Fus1p targets it to the projection tip during conjugation [17] The C-terminal portion of the FH3 in mDia1 is required for its localisation to the mitotic spindle in HeLa cells [18] Given the absence of well defined residues and the lack of functional data, the existence of a FH3 “domain” is speculative

Chapter 1: Introduction

The FH1 domain lies between the FH3 and FH2 domains It contains several stretches of proline-rich residues that are variable in length and poorly conserved between species Due to its proline-rich nature, FH1 domain can bind SH3 and WW-containing proteins, although its primary function appears to be profilin binding in formins Indeed, SH3-containing proteins like Src and IRSp53 can bind to the FH1 domain of mDia under overexpression conditions [19, 20] Profilin, a G-actin binding protein, associates with the FH1 domain to mediate actin nucleation and fibre elongation in combination with the FH2 domain

Profilin can bind to an actin monomer and a poly-proline sequence simultaneously Profilin bound to FH1 has been demonstrated to increase the actin elongation rate for Bni1p [21] and mDia1 [22] There are a number of proposals as to how FH1-bound profilin can affect the F-actin elongation rate First, FH1-bound profilin can bring the actin monomer in close proximity to the juxtaposed FH2 domain to increase the actin concentration at the barbed end This proposition accounts for the varying effects of different FH1 to elongation rate owing to the different number of profilin binding sites they possess Another possibility would be that profilin binding helps present the actin monomer in the appropriate orientation for addition to the barbed end Finally, profilin may alter the processive nature of FH2 domains The requirement of FH1 for FH2 processivity in mDia1 has been demonstrated by Romero et al [22] However, this model is contentious as subsequent studies produced contradictory results suggesting that FH1 is not necessary for FH2 processivity [12, 21, 23, 24]

Chapter 1: Introduction

The FH2 domain was initially characterised as a stretch of conserved amino acids composing approximately 100 residues with a consensus motif GNXMN (X = any amino acid) [25] It was discovered in later studies that the domain was in fact much larger at 400 residues [26, 27] The activity of the FH2 domain alters actin polymerisation The FH2 domain is capable of activities that include increasing actin nucleation, elongation [24, 28, 29], and competing with capping proteins for binding

to the barbed ends of F-actin [30, 31] Capping proteins are negative regulators of actin polymerisation in that they bind to the barbed ends and prevent further elongation Formins are considered as “leaky caps” as they bind to the barbed ends but do not block elongation [31] The formin is also said to be “processive” since it binds to the barbed ends and allow for monomer addition without dislodging from the fibre

Structural analyses of the FH2 domain have led to a number of models for formin processivity One of them is the “stair-step” model [5, 30, 32] The FH2 domains homo-dimerise and form a doughnut-shaped clamp that holds the actin in its core The residues I1431 and K1601 (numbering according to Bni1p), which are important for actin polymerisation, are found in these actin binding interfaces [33] The formin then moves step-wise along the actin fibre as elongation continues The screw cap model was proposed later by Shemesh et al [34] as a solution to the rotation paradox first discussed by Pollard [35] It explains how the formin could move along the actin fibre during elongation and yet do not result in supercoiling of the fibre which would be expected in the stair-step model In this model, the formin rotates with respect to the actin fibre The authors predicted that a combination of the

Chapter 1: Introduction

two modes of processivity (repeating sequence of twelve stair steps followed by one screw step) would render the actin fibre torsion-free

1.1.3 Lessons from Diaphanous

To date, the most well studied formins are the mouse Diaphanous proteins Since its identification in 1997 by Narumiya’s lab [11], many studies have been performed to investigate its structure and function Biochemical data from Watanabe et al supports the binding of endogenous mDia1 to activated RhoA and profilin [11] The interaction

of mDia1 with profilin was independent of RhoA binding and was shown in later studies to be mediated by the FH1 domain [36] The FH1 and FH2 domains of mDia1 are both required for formation of long, fine actin fibres aligned parallel to the long axes of HeLa cells [37], now considered as a classical phenotype exhibited by active formins The last 73 amino acids of mDia1 (DAD) are critical for binding to the N-terminus In addition, both active Rho-kinase (ROK) and and active mDia1 are required to generate actin:myosin stress fibres This suggests that these two downstream targets of Rho may cooperate with each other to generate the final acto-myosin contractile unit Because there are multiple formins, no single formin knockdown has been reported to abolish stress fibres

Besides its effects on actin, mDia1 is also involved in the regulation of microtubule dynamics Watanabe et al showed that mDia1 residues 543-1192 (containing FH1 and FH2 domains) caused elongation of HeLa cells and a re-alignment of microtubules along the long, fine actin fibres [38] The FH2 domain is essential for microtubule alignment and actin bundling The parallel alignment of microtubules is responsible for cell elongation and is independent of mDia1’s effects

Chapter 1: Introduction

on actin mDia2 was further identified in Rho effector mutant screens to be involved

in microtubule stabilisation [39] GBD mDia2 (GBD-deleted mDia2) induced formation of Glu microtubules, a form of stabilised microtubules Formation and orientation of Glu microtubules are independent of microtubule and actin co-alignment since the DAD, which did not produce co-alignment, was capable of activating endogenous mDia2 and forming Glu microtubules End-binding protein 1 (EB1) and adenomatous polyposis coli (APC) can interact with mDia2 and colocalisation of all three to microtubule tips suggests that they may form a capture complex for microtubule stabilisation [40] In a recent paper, mDia2 was shown to regulate phosphorylation of glycogen synthase kinase 3 (GSK3 ) via novel protein kinase Cs (PKCs) to promote microtubule stabilisation [41] In both cases, microtubule stabilisation is important for cell migration [40, 41]

Given their extensive effects on both the actin and microtubule cytoskeleton, it

is no surprise that various physiological roles of formins involve the regulation of cell morphology and movement mDia1 has been implicated in activation of the serum response factor (SRF) through its effects on actin polymerisation [42, 43] Formins also participate in the mounting of immune responses by directly affecting T lymphocyte trafficking [44, 45] and macrophage phagocytosis [46] mDia1 has been shown recently to interact with IQGAP1 to promote cell migration and phagocytic cup formation [47] It can also interact with leukaemia-associated Rho-GEF (LARG), upon RhoA release of mDia1 auto-inhibition, to regulate cancer cell invasion [48] Apart from RhoA, mDia also interacts with RhoB to regulate endosome trafficking and transport [49, 50]

Chapter 1: Introduction

1.2 Rho GTPases

1.2.1 Rho GTPase family

As upstream activators of formins and a range of signalling intermediates, Ras homolog guanosine triphosphatases (Rho GTPases) act as molecular switches in signal transduction There are 23 genes encoding Rho GTPases in mammals that are divided into six subfamilies, namely Rho, Rac, Cdc42, RhoBTB, Rnd and Miro [51] (Figure 1.4) The different Rho GTPases are at least 40% identical in amino acid sequence but share only approximately 25% identity to Ras

Figure 1.4 Dendrogram of Rho GTPase family

Rho GTPases classification was based on sequence similarities Adapted from

reference 51

Chapter 1: Introduction

Rho GTPases are subjected to post-translational modification at a conserved cysteine four amino acids from the C-termini The last three residues are removed by proteolysis and the remaining cysteine is carboxymethylated Various forms of lipid modifications are possible, including palmitoylation, farnesylation and geranylgeranylation The type of lipid modification as specified by the C-terminus sequences potentially affects the cellular localisation and/or effector interaction of different Rho GTPases [52]

1.2.2 Regulation of Rho GTPases

Rho GTPases act as molecular switches by cycling between their inactive GDP bound forms and active GTP bound forms All Rho GTPases possess a 20kD G domain that

is responsible for nucleotide binding and hydrolysis [53] The G domain is made up of five helices, six strands and 5 polypeptide loops The loop region is most conserved and can be divided further into two functional regions: switch I and II Switch I is the site for effector and GTPase activating protein (GAP) binding, hence it

is also known as the effector loop The P loop that resides between Switch I and II is responsible for coordinating the Mg2+ and the -phosphate of GTP Threonine 35 (numbering according to Ras) in Switch I and glycine 60 (part of DXXG motif) in Switch II are important for binding to the -phosphate

Activation requires the exchange of bound GDP for GTP This is facilitated by the guanine nucleotide exchange factors (GEFs) Binding of GEF to the GTPase pushes Switch I out of its original position and pulls Switch II nearer to the nucleotide binding region This displaces the bound GDP and allows the Rho GTPase for acceptance of a GTP Only the GTP bound Rho GTPase (active) can transduce signal

Chapter 1: Introduction

to its downstream effectors The active Rho GTPase can be deactivated to its inactive state by GTP hydrolysis As the the intrinsic GTPase activity of the Rho GTPase is weak, this process is facilitated by the GTPase activating proteins (GAPs) The GAP provides an additional arginine to the catalytic site This arginine residue cooperates with the existing glutamine residue in the catalytic site of the Rho GTPase to increase the GTP hydrolysis rate The GTP bound Rho GTPase is thus analogous to a loaded spring in which upon GTP hydrolysis, the two switch regions “spring” back into the GDP associated conformation

Rho GTPases are sequestered in the cytoplasm in their inactive forms by guanine nucleotide dissociation inhibitors (GDIs) which interact with the lipid tails of the GTPases An activating signal is required to trigger the release of Rho GTPases from the GDIs and allow their translocation to the membrane for another round of activation Cycling between the “ON” and “OFF” states ensures that the Rho GTPases function as efficient switches in cellular signalling where fast activation and termination of the signal is required (Figure 1.5)

Figure 1.5 Regulation of Rho GTPase activity

GAP GEF

GDI Rho-GDP

GDI Rho-GDP

GDI Rho-GDP

Rho-GDP Rho- Rho- GTP GTP

GTP

Effectors

Downstream cellular events

P i

Chapter 1: Introduction

The structure and identification of critical residues in Ras GTPase for activity

has been the basis for generation of mutants that allow functional studies in vivo [54]

Constitutively active and dominant inhibitory Rho GTPase mutants are believed to be specific in experimental studies The G to V mutation at position 12 (for Rac and Cdc42) or 14 (RhoA) and the Q to L mutation at position 61 or 63 are commonly used

to generate constitutively active proteins that are deficient in GTP hydrolysis, thus maintaining the protein in an active state The T to N mutation at position 17 (for Ras) generates dominant inhibitory proteins that are proposed to bind and titrate the GEFs, thereby preventing endogenous Rho activation

1.2.3 RhoA, Rac1 and Cdc42

RhoA, Rac1 and Cdc42 are the most well studied members of the Rho GTPase family They have been shown to be involved in various signalling pathways, many of which involve the cytoskeleton There are three members in the RhoA subfamily, RhoA, RhoB and RhoC RhoA has been shown to bind to downstream targets like Rho- kinase (ROK/ROCK) [55, 56] and mDia1 [36] Kimuro et al showed that the activation of ROK by RhoA resulted in the phosphorylation and inhibition of myosin light chain phosphatase (MLCP) [57] The phosphorylation status of myosin light chain (MLC) is determined by the balance of MLCP and myosin light chain kinase (MLCK) Phosphorylated MLC is the active form which contributes to acto-myosin contractility ROK phosphorylates myosin binding subunit (MBS) of MLCP and inhibits it activity In addition, MLC can also be directly phosphorylated by ROK The combination of these effects raises the levels of phosphorylated MLC and thus results in increased cell contractility

Rac (Ras related C3-Botulinium substrate) was found to induce membrane ruffling in serum starved fibroblasts [62] Since then, Rac has been implicated in the formation of membrane protrusions containing a meshwork of actin filaments known

as lamellipodia Among the targets of Rac is p67phox, a component of the NADPH oxidase in phagocytic cells [63]: Rac activation generates reactive oxygen species

Cdc42 (Cell divison cycle 42) was first identified in a genome wide screen S cerevisiae, and found to be important for budding [64] In fibroblasts, active Cdc42

was shown to induce the formation of microspikes and filopodia, finger-like membrane protrusions containing actin bundles [65, 66]

A common target for Rac and Cdc42 was purified from rat brain lysates and named p21 activated kinase (PAK) [67] Rac and Cdc42 interact with PAK and

Chapter 1: Introduction

related effectors via the Cdc42/Rac interactive binding (CRIB) domain [68] PAK is a serine/threonine kinase that exists as a homodimer in a trans-inhibited conformation Binding of the active GTPase disrupts the interaction of the kinase inhibitory domain and the catalytic domain, thereby allowing the auto-phosphorylation of PAK which is necessary for its full activation [69] Among a large number of PAK substrates that affect cytoskeletal dynamics are LIM kinases, MLCKs and stathmin/Op18 [70-72]

Both the RhoA target ROK and PAK phosphorylate and activate LIM kinase, resulting in its activation and inhibition of cofilin, an actin depolymerising factor [70] PAK can also directly phosphorylate and partially inhibit MLCK [71] The influence

of PAK on microtubule dynamics is suggested to involve phosphorylation of stathmin/Op18 that binds to and destabilises microtubules Phosphorylation of stathmin at serine 16 by PAK1 inhibits this microtubule destabilising function [72] PAK1 is not localised to the microtubule network but rather to focal complexes to promote disassembly of actin stress fibres and focal adhesions [73] PAK-interacting exchange factor (PIX) and G-protein-coupled receptor kinase-interacting protein (GIT) target PAK to focal adhesions, where it promotes focal adhesion turnover [74]

Cdc42 can also interact with many “effectors” including Wiscott Aldrich syndrome protein (WASP) while Rac binds the WASP family verprolin (WAVE) proteins WASP and WAVE are involved in the activation of the Arp2/3 complex, an actin nucleator that generates branched actin fibres, which are required for the formation of lamellipodia [75] Cdc42 regulation of the microtubule network is mediated via mDia3, which regulates microtubule attachment to kinetochores [76]

Chapter 1: Introduction

1.2.4 Rho GTPases in cell migration

The roles of the small GTPases on the cytoskeleton are best illustrated in cell migration, a complex process that is important in various physiological events like chemotaxis, phagocytosis and wound healing (Figure 1.6) The distribution of active Rho GTPases at different regions of a migrating cell is considered essential for generating the appropriate movement of the cell Active Rac and Cdc42 can be found

at the leading edge of a migrating cell Although Cdc42 is primarily localised in the peri-Golgi region while Rac is responsible for lamellipodia formation, Rho acts at the trailing edge by increasing contractility to retract the “tail” A few studies have implicated Rho in the regulation of protrusions at the leading edge as well [39, 77, 78] Signalling proteins allow crosstalk between the different GTPase pathways For example, ROK and PAK both contribute to increased contractility by increasing myosin light chain phosphorylation although PAK antagonises ROK functions The integration of different signalling pathways generates the spatial and temporal delivery of components for movement of the cell [79, 80]

Figure 1.6 Role of Rho GTPases in cell migration

Golgi

Nucleus

Leading edge Trailing edge

Chapter 1: Introduction

1.3 Dishevelled Associated Activator of Morphogenesis 1 (DAAM1)

Most studies of formins have been performed using Diaphanous proteins By comparison, relatively little is known about the biochemistry of DAAM1, the protein that is the focus of this thesis Habas et al identified DAAM1 as an interactor of the PDZ domain of mouse Dishevelled 2 (Dvl2) by yeast two hybrid [81] DAAM1 is placed downstream of Wnt signalling as DAAM1 is required for interaction of Dvl with RhoA upon Wnt stimulation The Dvl-RhoA-DAAM1 complex is proposed to be essential for activation of RhoA Use of DAAM1 morpholino-oligonucleotide to

block DAAM1 synthesis in Xenopus uncovered the requirement of DAAM1 for

gastrulation Loss of profilin and DAAM1 produce a synergistic inhibition of

blastopore closure in Xenopus, as expected for a formin [82] In Drosophila, DAAM

plays an important role in the regulation of tracheal cuticle patterning via its effects on actin organisation [83] In mammalian cells, DAAM1 is proposed to interact with Src and Cdc42 interacting protein 4 (CIP4) to regulate formation of cell protrusions [84] More recently, DAAM1 activation was found to be mediated by the binding of Dvl to its C-terminal rather than being driven solely by Rho GTPase interaction [85]

The crystal structure of DAAM1 FH2 domain has been resolved [86, 87] The FH2 domain undergoes homo-dimerisation but unlike mDia1 and Bni1p, the DAAM1 FH2 domains are oriented such that the actin binding surfaces are occluded Indeed, a DAAM1 C-terminal fragment is a poorer activator of actin polymerisation versus mDia1 This suggests that DAAM1 requires additional signals than Rho GTPases to overcome the constraints imposed by the inhibited structure of the FH2 domain

Chapter 1: Introduction

1.4 Thesis objectives

In this thesis, I sought to characterise in detail the localisations and functions of DAAM1 in mammalian cells A number of studies have implicated the importance of DAAM1 in embryonic development [81-83] As such, it is important to understand how the various domains contribute to DAAM1 functions and their potential contribution to known signalling pathways DAAM1 is an interacting partner of Dishevelled [81], but is also found in lipid rafts [88] DAAM1 will likely prove to be

an interesting target for further studies because of its similarities to other formins but uniqueness in its interaction with Dishevelled Since RhoA signalling from adhesion complexes is blocked by lipid raft depletion [61], it may be that many formins are lipid raft associated The localisation of DAAM1 and perhaps other formins to lipid rafts may thus allow specific signalling at these sites on the plasma membrane

To date, few partners for formins have been found DAAM1 exhibits an interesting localisation to the Golgi apparatus and a subset of stress fibres These localisations are not noted in developmental studies because of the problem in resolving subcellular localisations I have focused on determining the regulation and functions of DAAM1 in cultured mammalian cells in order to identify where the protein may be acting

One challenge was to identify the appropriate partner GTPases for DAAM1 in cells It transpired that DAAM1 could be recruited by RhoA, Rac1 and Cdc42 and potentially other family members Since DAAM1 localises to the peri-nuclear/Golgi area, Cdc42 is the most promising activator I found that DAAM1 is crucial for mediating Golgi re-orientation in cell migration and thus likely functions downstream

Chapter 1: Introduction

of Cdc42 Studies involving the interaction of DAAM1 with Dishevelled were also carried out but not extended (as yet) to those of Wnt signalling This thesis presents some interesting and exciting results regarding the interactions and localisations of DAAM1 that will pave the way for more in-depth studies using model organisms

Chapter 2: Materials and Methods

Chapter 2 Materials and Methods

2.1 Cell culture

HeLa cells (ATCC no CCL-2) were cultured in minimum Eagle’s medium supplemented with 10% fetal bovine serum (FBS), 2 mM L-glutamine, 10 mM sodium pyruvate, 0.15% w/v sodium bicarbonate, and 0.1 mM minimum Eagle’s medium nonessential amino acids (Invitrogen) COS 7 cells (ATCC no CRL-1651) and NIH3T3 cells (ATCC no CRL-1658) were cultured in Dulbecco’s modified Eagles’s medium supplemented with 10% fetal bovine serum NCI-H1299 cells (ATCC no CRL-5803) were cultured in Dulbecco’s modified Eagles’s medium supplemented with 10% fetal bovine serum and 2 mM L-glutamine MCF7 cells (ATCC no HTB-22) were cultured in RPMI medium supplemented with 10% FBS and 2 mM L-glutamine Cells were grown in a 37°C incubator with 5% CO2

2.2 Antibodies

Rabbit polyclonal and mouse M2 anti-FLAG antibodies were from Sigma (St Louis, MO) Rabbit polyclonal anti-HA antibody and rabbit polyclonal anti-caveolin-1 antibody were from Santa Cruz Biotechnology (Santa Cruz, CA) Mouse anti-GM130 was from BD Transduction Labs (San Jose, CA) Mouse anti-human transferrin receptor was from Zymed Labs (South San Francisco, CA) Rabbit polyclonal anti-detyrosinated tubulin (Glu-tubulin) antibody was from Chemicon International (Billerica, MA) Monoclonal anti- -tubulin, rabbit polyclonal anti-gamma tubulin and rabbit polyclonal anti-GAPDH was from Sigma Polyclonal goat anti-rabbit IgG HRP and polyclonal rabbit anti-mouse IgG HRP were from Dako Cytomation (Glostrup,

Chapter 2: Materials and Methods

Denmark) Alexa Fluor 488, 546 and 647 fluorescent secondary antibodies were from Molecular Probes, Invitrogen Rabbit polyclonal antibody against human DAAM1 was generated using amino acids 594-1078 as the antigen Recombinant His-tagged DAAM1 (aa 594-1078) was sent to Genemed Synthesis Inc (South San Francisco, CA) for antibody production The antibody was purified by passing max bleed serum through a column with cyanogen bromide beads (Sigma) coupled to DAAM1 (aa 594-1078) and eluted in different fractions

2.3 Reagents

Taxol, nocodazole, cytochalasin D, blebbistatin, GSK inhibitor SB216763, ROCK inhibitor Y-27632 and methyl- -cyclodextrin were from Sigma PKC inhibitor RO 32-0432 was from Calbiochem (Darmstadt, Germany) TRITC-phalloidin was from Sigma Alexa Fluor 647 conjugated Cholera toxin B subunit and Alexa Fluor 647 phallodin were from Molecular Probes

2.4 Plasmids and oligonucleotides

Human DAAM1 full-length DNA (KIAA0666) was purchased from Kazusa DNA Research Institute (Chiba, Japan) Different DAAM1 truncation constructs were obtained by PCR and cloned into various N-terminal tagged pXJ40 vector using XhoI and KpnI sites Restriction enzymes were from New England Biolabs (NEB) and T4 ligase was from Invitrogen (Carlsbad, CA) Human formin homology 2 domain-containing 2 (FHOD2/KIAA1902) was purchased from Kazusa DNA Research Institute and the FH1-FH2-DAD construct (amino acid 525-1092) was generated by PCR and cloned into GFP tagged pXJ40 vector using XhoI and KpnI sites Human

Chapter 2: Materials and Methods

Diaphanous 1 FH1-FH2-DAD construct (amino acid 532-1272) was kindly provided

by Dr Koh Cheng Gee from our lab and was sub-cloned into GFP-tagged pXJ40 vector using XhoI and KpnI sites Human TGN46 protein (GenBank accession number U62390) was cloned into C-terminal GFP-tagged pXJ40 vector using BamHI and XhoI sites C-terminal GFP-tagged Mannosidase II was kindly provided by Dr Frederic Bard from IMCB Human Myosin IIA tail (aa 1091-1923) and Myosin IIB tail (aa 1097-1930) were cloned into pXJ40HA vector using HindIII, KpnI and NotI, KpnI sites respectively Human Dishevelled 2 (Dvl) EST clone (IMAGE 3852554) was purchased from the IMAGE Consortium and the full length protein was cloned into N-terminal HA-tagged pXJ40 vector using XhoI and KpnI sites GST-tagged constitutively active and dominant inhibitory Rho GTPases as well as αPAK kinase inhibitory domain (KID, amino acids 83-149) were kindly provided by Dr Dong Jing Ming and Ms Elsa Ng from our lab respectively

2.4.1 List of DAAM1 primers

DAAM1 full length

Chapter 2: Materials and Methods

DAAM1(1-280)

5’XhoI 5’- CCGCTCGAGATGGCCCCAAGAAAGAGAGGTG -3’ 3’ KpnI 5’- GGGGTACCTCAGGCAGTCTTGAGACTCACTTC-3’

DAAM1(1-350)

5’XhoI 5’- CCGCTCGAGATGGCCCCAAGAAAGAGAGGTG -3’ 3’KpnI 5’- GGGGTACCTGAAAATCTTTTGGCAAATTCTAGTTC -3’

DAAM1(1-356)

5’XhoI 5’- CCGCTCGAGATGGCCCCAAGAAAGAGAGGTG -3’ 3’ KpnI 5'- GGGGTACCTCAGTCTATGTGAACCAGTTCAAATC -3'

DAAM1(1-440)

5’XhoI 5’- CCGCTCGAGATGGCCCCAAGAAAGAGAGGTG -3’ 3’KpnI 5'- GGGGTACCTCAAACCAACATTCGTACGACATTC -3'

DAAM1 DAD (1-1030)

5’XhoI 5’- CCGCTCGAGATGGCCCCAAGAAAGAGAGGTG -3’ 3’KpnI 5’- GGGGTACCTCAGCTTTCTTCACTATTCTCTTTAG -3’