Characterisation of the rho GTPase target dishevelled associated activator of morphogenesis 1 (DAAM1
... 1. 2 .1 Rho GTPase family 10 1. 2.2 Regulation of Rho GTPases .11 1. 2.3 RhoA, Rac1 and Cdc42 13 1. 2.4 Rho GTPases in cell migration 16 1. 3 Dishevelled Associated Activator ... structure of mDia1 N ter and RhoC Figure 1. 4 Dendrogram of Rho GTPase family 10 Figure 1. 5 Regulation of Rho GTPase activity 12 Figure 1. 6 Role of Rho GTPases in cel...
Ngày tải lên: 12/09/2015, 08:19
... bilateral ovarian mature teratoma, using both biochemical and histological techniques The Patient Clinical Findings An eight- year- old female presented with a three-week history of abdominal swelling ... high amounts of mucin- like amino acids, serine, threonine and proline Serine and threonine are points of O-glycosylation found in the tandem repeat regions of mucin...
Ngày tải lên: 26/10/2012, 10:03
... Kamitani et al Enzymatic actions of P multocida toxin Results Analysis of enzymatic actions of PMT with Gaq Q209E-specific monoclonal antibodies According to a previous study [16], the deamidation ... by the deamidation of Gln205 to Glu by PMT from a cell-based assay and MS [15,16] Gaq was also considered to be deamidated by the toxin The deamidat...
Ngày tải lên: 22/03/2014, 16:20
Báo cáo sinh học: " Genetic characterisation of the recent foot-and-mouth disease virus subtype A/IRN/2005" pptx
... propagation of the virus Amino acid comparison of the Leader protease Figure displays the alignment of the deduced amino acid sequence of the first 96 residues of the FMDV Leader protease from the A/IRN/05 ... on the epidemiology of FMDV in Pakistan Open Session of the Research Group of the European Commission for the Control of Foot-and-Mouth Dise...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " Genetic characterisation of the recent foot-and-mouth disease virus subtype A/IRN/2005" ppt
... propagation of the virus Amino acid comparison of the Leader protease Figure displays the alignment of the deduced amino acid sequence of the first 96 residues of the FMDV Leader protease from the A/IRN/05 ... on the epidemiology of FMDV in Pakistan Open Session of the Research Group of the European Commission for the Control of Foot-and-Mouth Dise...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Respiratory syncytial virus (RSV) attachment and nonstructural proteins modify the type I interferon response associated with suppressor of cytokine signaling (SOCS) proteins and IFN-stimulated gene-15 (ISG15)" potx
... (Figure 1A) This finding is in keeping with the findings of NS1/NS2 antagonism of type I IFNs [4,46,47] and suggests the possibility that type I IFN antagonism is linked to NS1/NS2 induction of ... interfere with direct TLR signaling, but instead regulate paracrine IFN signaling [7] The SOCS protein family is comprised of eight proteins (CIS, cytokine- induci...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" Expression of interleukin-1 (IL-1) ligands system in the most common endometriosis-associated ovarian cancer subtypes" pdf
... medicine 2008, 5:e232 doi:10.1186/1757-2215-3-3 Cite this article as: Keita et al.: Expression of interleukin-1 (IL-1) ligands system in the most common endometriosis-associated ovarian cancer ... 0.05) The levels of IL-1b in the supernatant of all ovarian cancer cell lines studied were Table Comparative expression of IL-1b and IL-1RA in endomet...
Ngày tải lên: 20/06/2014, 07:20
Báo cáo y học: "Phenotypic and functional characterisation of CD4+ memory T cells homing to the joints in juvenile idiopathic arthritis" pps
... study we have investigated the role of CCR7 in the recruitment of CD4+ memory T cells into the inflamed joints of patients with JIA, and attempted the functional and anatomical dissection of these ... degree of disease activity and treatment at the moment of sampling Expression of CCL21 in SF and synovial tissue To gain further insight into t...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: " A promoter haplotype of the interleukin-18 gene is associated with juvenile idiopathic arthritis in the Japanese population" pps
... FAM-TTTTGGTATCCCTCTCC-MGB SNP11F ACAGGTTTTGGAAGGCACAGA SNP11 VIC- ACGGAAGAAAAGATTT-MGB SNP11R AATAAAGTGGCAGAGGATACGAGTACT SNP11 FAM-ACGGAAGAAAACATTT-MGB SNP12F AATTGTCTCCCAGTGCATTTTGC SNP12 allele1 VIC-CTGCCAACTCTGGCTG-MGB ... SNP2 allele2 FAM-CACTTATCTGTAGAGCTT-MGB SNP4F CTGGCAATTCTGCCTTGTTTCAG SNP4 allele1VIC- CCGAAGATAAAAGAATC-MGB SNP4R GGATTACAGCCGTGAGCCA SNP4 allele2 FAM- CGAAGATAGAAGAAT...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: " Characterisation of the immune response to type I collagen in scleroderma" pps
... determined by intracellular (IC) staining of lines PMA (phorbol 12-myristate 13-acetate)/ionomycin activated T cells (a) We detected interferon (IFN)-γ staining but no interleukin (IL)-4 staining ... of a more generalised immune reactivity to extracellular matrix proteins in SSc Laminin and, less often, type IV collagen can induce proliferation of SSc lymphocytes [16] Autoanti...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "Identification of an altered peptide ligand based on the endogenously presented, rheumatoid arthritis-associated, human cartilage glycoprotein-39(263–275) epitope: an MHC anchor variant peptide for immune modulation" pot
... substitutions may function as partial TCR agonists on the one hand and prevent unwanted immune reactivity on the other [32,33] This approach may thus provide an improved option for APL therapy The ... methods Peptides and altered peptide ligands Peptides were synthesised by solid phase peptide synthesis Purity and identity of the peptides were assessed by reverse pha...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo y học: "Characterisation of the cannabinoid receptor system in synovial tissue and fluid in patients with osteoarthritis and rheumatoid arthritis" pdf
... from synovia from OA and RA patients Discussion The novel finding of the present study is the identification of the key components of the cannabinoid receptor system in the knee synovia of patients ... levels of PEA were similar in the synovial fluid of OA and RA patients Thus, levels in the synovial fluid not simply reflect the leve...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: " Solitary Peutz-Jeghers type hamartomatous polyps in the duodenum are not always associated with a low risk of cancer: two case reports" pptx
... this article as: Sekino et al.: Solitary Peutz-Jeghers type hamartomatous polyps in the duodenum are not always associated with a low risk of cancer: two case reports Journal of Medical Case Reports ... Peutz-Jeghers type hamartomatous polyp Case was a hamartomatous polyp with a focus of well-differentiated adenocarcinoma, and Cas...
Ngày tải lên: 10/08/2014, 23:21
báo cáo khoa học: " Characterisation of the legume SERK-NIK gene superfamily including splice variants: Implications for development and defence" ppt
... doi:10.1186/1471-2229-11-44 Cite this article as: Nolan et al.: Characterisation of the legume SERK-NIK gene superfamily including splice variants: Implications for development and defence BMC Plant Biology 2011 11:44 ... All of the M truncatula sequences contain predicted transmembrane and kinase domains The genomic structure of each of the M truncat...
Ngày tải lên: 11/08/2014, 11:21
báo cáo khoa học: " Characterisation of the tryptophan synthase alpha subunit in maize" pptx
... Site-specific mutagenesis of the alpha subunit of tryptophan synthase from Salmonella typhimurium Changing arginine 179 to leucine alters the reciprocal transmission of substrateinduced conformational ... scheme of the tryptophan synthase reaction General General scheme of the tryptophan synthase reaction Indole, which is formed from IGP by the α-subunits i...
Ngày tải lên: 12/08/2014, 05:20