Coupling receptor activation to cytoskeleton changes 2

Chapter – Material and Methods 2.1 Preparation of Competent Bacteria Cells for Transformation via Electrophoration E.coli of XL-1 Blue (For DNA production) or BL-21(For protein production) strains were streaked on plain LB agar plate under sterile condition and incubated overnight at 37 0C. A single colony was inoculated into 50ml of LB and incubated overnight at 37 0C using a shaker. The culture was diluted 20x into 400ml of LB and incubated at 37 0C using a shaker for around hrs till the OD660 was about 0.6 to 0.8. The cooled bacteria were spun down at 4000 rpm for 15 at 0C. The supernatant was discarded and the pellet was resuspended in ice cold deionized water for desalting. This step was repeated and the bacteria pellet was resuspended in cold water with 10% glycerol and transferred to Falcon tube on ice. The bacteria were spin at 2800 rpm for 15 at 0C. The supernatant was carefully removed and the bacteria were resuspended in 1ml of cold water with 10% glycerol. The bacteria suspension were aliquoted into sterile eppendorf tube, snapped freezed and store at -80 0C. 2.2 Preparation of Competent Bacteria Cells for Transformation via Heat Shock method XL-1 Blue (For DNA production) or BL-21(For Protein production) bacteria were streaked on plain LB agar plate under sterile condition and incubated overnight at 37 0C. A single colony was inoculated into 50ml of LB and incubated overnight at 37 0C using a shaker. The culture was diluted 20x into 400ml of LB and incubated at 37 0C using a shaker for around hrs till the OD660 was about 0.6 to 0.8. The cooled bacteria were spun down at 4000 rpm for 15 at 0C. The supernatant was discarded and the pellet was resuspended in 15ml of ice cold 0.1M CaCl2 and incubated in ice for 40min. The bacteria were spun down at 4000 rpm for 15 at 0C and the pellet was resuspended in 8ml 0.1M CaCl2 with 20% glycerol. The bacteria were aliquoted into sterile eppendorf tube, snapped freeze and store 800C. 74 2.3 Cloning The gene of interest was typically amplified via PCR with primers containing suitable restriction sites. The amplified product of the correct size (analyzed using gel electrophoresis) was then digested overnight at 370C with the suitable restriction enzymes (NEB). Meanwhile, the desired vector was also digested for a few hours at 370C. The digested samples were diluted with 6X DNA loading buffer (5mM Tris-Cl pH 8, 0.5mM EDTA, 50% glycerol, bromophenol blue) into a final concentration of 1X DNA loading buffer and the samples were ran in agarose gel electrophoresis (Invitrogen, Ultrapure Low melting point agarose). The band of the correct size was excised and melted at 70 0C for about 10 mins. The vector and the insert were mixed at a ratio of 1:10 and incubated with T4 ligase (Fermentas) in T4 ligase buffer containing 10 mM ATP (New England BioLabs) and incubated at 16 0C overnight for ligation. After ligation, a few microliters of the samples were transformed into the E.coli XL1 blue strain via either electrophoration or heat shock method. Briefly, for heat shock method, the thawed bacteria on ice were incubated with the 10ul of ligated mixture (diluted 2x with water) on ice for 30 and immediately transferred into 42 0C water bath for min. The bacteria mixture were cooled immediately on ice for and allowed for recovery in SOC buffer (see below) at 37 0C for hr before plating on antibiotic containing LB agar plate (Ampicillin 50ug/ml or Kanamycin 30ug/ml). For electroporation method, thawed bacteria on ice was mixed with 10ul of the ligated mixture (diluted 2x with water) and transferred into the provided electroporation cuvette. The bacteria were electroporated using the Bio-Rad MicroPulser and allowed for recovery in SOC buffer and plated. The plates were incubated overnight at 37 0C and a few colonies were inoculated in the antibiotic-containing LB broth (4ml) and incubated overnight at 37 0C in a shaker. The bacteria cultures were then spun at 3500rpm for 10min to collect the pellet and subjected to plasmid purification using the mini-prepation method (Qiagen). A small volume of the purified plasmids were digested with suitable restriction enzymes and ran in agarose gel electrophoresis to diagnose whether the insert is successfully cloned in. 75 Confirmation was done via DNA sequencing of the plasmid using designed primers. Briefly, a few microliters of the plasmid was mixed with specific 5‟ end or 3‟ end primers and ABI big dye containing the DNA polymerase and tagged nucleotides. The reactions were allowed to carry out at: Step1: 96 0C -30s Step2:96 0C -10s Step3:50 0C - 5s Step4:60 0C – 4min Step5:4 0C -  Repeat Step 2-4 for 30cycles. After the PCR, the reaction mix was then sent to a DNA sequencing unit for reading the sequences. The sequences were aligned with the relevant sequences from Pubmed using the BLAST service and checked for proper reading frame and lack of mutation. The bacteria containing the correct insert was inoculated into 200ml/400ml LB culture with antibiotic for subsequent purification of the plasmid in medium or large scale (midi-prep or maxi-prep) respectively. 2.4 DNA purification The desired plasmid transformed in bacteria was purified using Qiagen kit. Briefly, the bacteria were lysed under alkaline condition and the DNA was specifically adsorbed onto the provided column under high salt conditions. The plasmids were eluted under low salt conditions. The eluted DNA was precipitated by isopropanol and the dried DNA pellet was dissolved in TE buffer or water. 2.5 Electrophoresis Agarose gel electrophoresis was performed at 100 volts or 90 volts (low melting point agar) for around hr in 1x TAE buffer (see below). The agar gel was prepared with 1% 76 agarose in 1x TAE buffer with 5ug of Ethidium Bromide in 100ml of molten agar. The molten agar was allowed to solidify in suitable cast. For SDS-PAGE analysis (Sodium dodecyl sulfate polyacrylamide gel electrophoresis), the polyacrylamide gel of the suitable percentage (usually 10%, see below) was prepared and ran using 1x SDS running buffer (see below) at 160 volts for at least hr. The gel was then stained using Coomassie blue and destained with 40% Methanol/10% Glacial Acetic Acid or transferred onto PVDF membrane (Polyvinylidene fluoride) using the „Wet transfer‟ method in 1x Transfer buffer. 2.6 Generation of RTK constructs Constructs encoding the ORF of the kinases or complete EST clones were obtained from Open biosystem. The constructs were cloned into pcDNA3 with a C-terminal Flag-tag using standard PCR protocols. The respective primers used are documented in Table 3. Table 3. Primers for generating RTK constructs ALK 5' -TCCGAATTCATGGGAGCCATCGGGCTCCTG-3' 5' -CCGCTCGAGGGGCCCAGGCTGGTTCAT-3' Axl 5‟ –TTGAAGCTTATGGCGTGGCGGTGCCCCAGG-3‟ 5‟ –AGGGGCGGCCGCGGCACCATCCTCCTGCCC-3‟ DDR1 5' -TCAGAATTCATGGGACCAGAGGCCCTGTCA-3' 5' -TGTCTCGAGCACCGTGTTGAGTGCATCCTC-3' EPHB4 5‟–GGCAAGCTTATGGAACTCCGGGTGCTGCTC-3‟ 5‟–TCCTGCGGCCGCGTACTGCGGGGCCGGTCC-3‟ EPHA3 5‟ –ACCGGATCCATGGATTGTCAGCTCTCCATC-3‟ 5‟ –CGTCTCGAGCACGGGAACTGGGCCATTCTT-3‟ FGFR1 5‟ –AGAGGATCCATGTGGAGCTGGAAGTGCCTC-3‟ 5‟ – GGGTGCGGCCGCGCGGCGTTTGAGTCCGCC-3‟ v-fms 5‟ –GCGGGATCCATGGTCAGCTACTGGGACACC-3‟ 5‟ –AGTCTCGAGATGTTTTACATTACTTTGTGT-3‟ LTK 5‟-ACCGGATCCATGGGCTGCTGGGGACAGCTG-3‟ 5‟-AAGGCGGCCGCGGAGCGATAAGTGGGATT-3' NT3 5‟ –AATAAGCTTATGGATGTCTCTCTTTGCCCA-3‟ 5‟ –GAGGGTACCAAAGCCATGACGTCCTTTGCT-3‟ 5‟ –AAGGAATTCATGCGGCTTCCGGGTGCGATG-3‟ PDGFR 5' -CGAGCGGCCGCTTCAGGAAGCTATCCTCTG-3' RET 5‟ –GCAAAGCTTATGGCGAAGGCGACGTCCGGT-3‟ 5‟ –ACAGGCGGCCGCGAATCTAGTAAATGCATG-3‟ TEK 5‟ –GAACTCGAGATGGACTTGATCTTGATCAAT-3‟ 5‟ –TCTGGTACCGGCCGCTTCTTCAGCAGAACA-3‟ 77 2.7 Generation of ACK1, MIG6 and Grb2 constructs ACK T1 was constructed via PCR using the primers 5'–CTAGGATCCTGCCC GCCCTCCCTGGCGCAG-3' and 5'-CAGG TCGACTTAAGGCACAGGCAGGGGGGT-3', which contain flanking BamHI or SalI restriction sites. ACK T2 and T3, which were previously cloned into pXJ-Flag vector, were re-cloned into pXJ-GST via BamHI/HindIII restriction sites. MIG6 fragment CACGGATCCGCTGGCTCCTTTA was PCR using ACAAGCCA-3' the and following primers 5'- 5'-CGCCTCGAGCTAAG GAGAAACCACATAGGA-3'. The amplified products were cloned into pXJ-GST via BamHI/XhoI restriction sites. Grb2 mutants were created via 2-steps PCR mutagenesis and sequenced to confirm the mutations. The mutated full length products were cloned into pXJHA via BamHI/XhoI sites. 2.8 Generation of CRMP, MAP6 and Stathmin constructs Constructs encoding the ORF of rat CRMP1-4 and MAP6 were cloned into pXJ40HA via HindIII/XhoI restriction sites. The respective primers used are documented in Table (Supplementary experimental procedures). The C-terminal CRMP1(480-572), CRMP1(491572) and CRMP2(480-572) were cloned into pXJ-GST using PCR to introduce HindIII and XhoI cloning sites. Full length CRMP1 and CRMP2 were cloned into a modified pET21D His6 vector for expression in bacteria. CRMP1(491-572) was cloned into pGEX4T1 using introduced 5'BamHI and 3'XhoI restriction sites. Mouse stathmin was amplified from total cDNA and cloned via 5'BamHI and 3'XhoI restriction sites into pGEX4T1. The primers are listed in the Table 4. Site-directed mutagenesis of CRMP1 at Ser-522, Ser-537, Ser-540, Ser-542 and Thr554 were mutated and cloned into pXJ-HA as for wildtype. The primers employed are given in Table 4.The mutants were created via 2-steps PCR mutagenesis and sequenced to confirm the mutations. 78 Table 4. Primers for Cloning CRMP, CRMP mutants and Stathmin CRMP1 Full Length Primer UP: 5‟ –TCC GGA TCC AAG CTT ATG TCT CAT CAG -3‟ LP: 5'- CGT CTC GAG TCA ACC GAG GCT GGT GAT -3' CRMP2 Full Length Primer UP: 5‟- GGA TCC AAG CTT ACC ATG TCT TAT CAG-3‟ LP: 5‟- CGG GGC CTC GAG TTA GCC CAG GCT GGT-3‟ CRMP3 Full Length Primer UP: 5' -TGT AAG CTT ATG TCC TTC CAA GGC AAG AAG -3' LP: 5' - ACC GGT ACC CTA GGA AAG AGA CGT GAT GTT -3' CRMP4 Full Length Primer UP: 5' - ATC AAG CTT ATG TCC TAC CAG GGC AAG AAG -3' LP: 5' - TGG CTC GAG TTA ACT CAG GGA TGT GAT GTT -3' CRMP1 491-572 UP: 5' - GTT AAG CTT TTG CAT AGT GTC TCA AGG GGC -3' LP: 5'- CGT CTC GAG TCA ACC GAG GCT GGT GAT -3' CRMP1 480-572 UP: 5' - CAC AAG CTT CAG CGT GTC AGG ATC AGG AGC AAG -3' LP: 5'- CGT CTC GAG TCA ACC GAG GCT GGT GAT -3' CRMP2 480-572 UP: 5' - TTT AAG CTT AAA CGC ATC AAG GCA AGG AGC -3' LP: 5‟- CGG GGC CTC GAG TTA GCC CAG GCT GGT-3‟ CRMP1 (1-490) UP: 5‟ –TCC GGA TCC AAG CTT ATG TCT CAT CAG -3‟ LP: 5‟ – GAC CTC GAG TCA CCC GAA AAC CTT GCT CCT -3‟ CRMP1 (1-520) UP: 5‟ –TCC GGA TCC AAG CTT ATG TCT CAT CAG -3‟ LP: 5' - AGA CTC GAG TTA CTT GGC AGA AGG AGC AGG - 3' CRMP1 (1-550) UP: 5‟ –TCC GGA TCC AAG CTT ATG TCT CAT CAG -3‟ LP: 5' - TGT CTC GAG TTA ATT GTT GTC ATC TAT CTG -3' CRMP1 (1-560) UP: 5‟ –TCC GGA TCC AAG CTT ATG TCT CAT CAG -3‟ LP: 5' - GCC CTC GAG TTA CGC CAC GAT GCG GTG -3' CRMP1 (1-565) UP: 5‟ –TCC GGA TCC AAG CTT ATG TCT CAT CAG -3‟ LP: 5' -GGT CTC GAG TTA GCG GCC ACC AGG GGG -3' CRMP1 S522A UP: 5‟ –TCC GGA TCC AAG CTT ATG TCT CAT CAG -3‟ ALP: 5' –CTG GTG TTT AGA AGG CGC GGA CTT GGC AGA AGG -3' AUP: 5‟ –CCT TCT GCC AAG TCC GCG CCT TCT AAA CAC CAG -3‟ LP: 5'- CGT CTC GAG TCA ACC GAG GCT GGT GAT -3' CRMP1 S522D UP: 5‟ –TCC GGA TCC AAG CTT ATG TCT CAT CAG -3‟ DLP: 5' –CTG GTG TTT AGA AGG ATC GGA CTT GGC AGA AGG -3' DUP: 5‟ –CCT TCT GCC AAG TCC GAT CCT TCT AAA CAC CAG -3‟ LP: 5'- CGT CTC GAG TCA ACC GAG GCT GGT GAT -3' CRMP1 S537A UP: 5‟ –TCC GGA TCC AAG CTT ATG TCT CAT CAG -3‟ ALP: 5' - TGA CAA GCT GAA GTT GGC CTG GTG GAG GTT-3' AUP: 5' - AAC CTC CAC CAG GCC AAC TTC AGC TTG TCA -3' LP: 5'- CGT CTC GAG TCA ACC GAG GCT GGT GAT -3' CRMP1 S537D UP: 5‟ –TCC GGA TCC AAG CTT ATG TCT CAT CAG -3‟ DLP: 5' - TGA CAA GCT GAA GTT GTC CTG GTG GAG GTT-3' DUP: 5' - AAC CTC CAC CAG GAC AAC TTC AGC TTG TCA -3' LP: 5'- CGT CTC GAG TCA ACC GAG GCT GGT GAT -3' 79 CRMP1 S540A UP: 5‟ –TCC GGA TCC AAG CTT ATG TCT CAT CAG -3‟ ALP: 5' - GGC ACC TGA CAA GGC GAA GTT GGA CTG GTG-3' AUP: 5' - CAC CAG TCC AAC TTC GCC TTG TCA GGT GCC-3' LP: 5'- CGT CTC GAG TCA ACC GAG GCT GGT GAT -3' CRMP1 S540D UP: 5‟ –TCC GGA TCC AAG CTT ATG TCT CAT CAG -3‟ DLP: 5' - GGC ACC TGA CAA GTC GAA GTT GGA CTG GTG-3' DUP: 5' - CAC CAG TCC AAC TTC GAC TTG TCA GGT GCC-3' LP: 5'- CGT CTC GAG TCA ACC GAG GCT GGT GAT -3' CRMP1 S542A UP: 5‟ –TCC GGA TCC AAG CTT ATG TCT CAT CAG -3‟ ALP: 5' - TAT CTG GGC ACC TGC CAA GCT GAA GTT GGA-3' AUP: 5' - TCC AAC TTC AGC TTG GCA GGT GCC CAG ATA -3' LP: 5'- CGT CTC GAG TCA ACC GAG GCT GGT GAT -3' CRMP1 S542D UP: 5‟ –TCC GGA TCC AAG CTT ATG TCT CAT CAG -3‟ DLP: 5' - TAT CTG GGC ACC GTC CAA GCT GAA GTT GGA-3' DUP: 5' - TCC AAC TTC AGC TTG GAC GGT GCC CAG ATA -3' LP: 5'- CGT CTC GAG TCA ACC GAG GCT GGT GAT -3' CRMP1 T554A UP: 5‟ –TCC GGA TCC AAG CTT ATG TCT CAT CAG -3‟ ALP: 5' - GAT GCG GTG CCC TGC ACG CCT TGG ATT GTT -3' AUP: 5' - AAC AAT CCA AGG CGT GCA GGG CAC CGC ATC -3' LP: 5'- CGT CTC GAG TCA ACC GAG GCT GGT GAT -3' CRMP1 T554E UP: 5‟ –TCC GGA TCC AAG CTT ATG TCT CAT CAG -3‟ ELP: 5' - GAT GCG GTG CCC TTC ACG CCT TGG ATT GTT -3' EUP: 5' - AAC AAT CCA AGG CGT GAA GGG CAC CGC ATC -3' LP: 5'- CGT CTC GAG TCA ACC GAG GCT GGT GAT -3' Stathmin BAMUP: 5' - CTG GGA TCC ATG GCA TCT TCT GAT ATT CAG -3' XHOLP: 5' - CGG CTC GAG TTA GTC AGC CTC AGT CTC ATC -3' 2.9 Materials for Chapter High Affinity Glutathione-Sepharose beads were from GeneScript. Anti-ACK1 (A11), anti-EGFR, anti-myc, anti-actin and anti-Cdc42 antibodies were from Santa Cruz. AntiAxl (N-terminal) and anti-Axl (C-terminal) were from R&D Systems and Santa Cruz respectively. Anti-Flag (M2), anti-GST antibodies and Fibronectin solution were from Sigma. Anti-Grb2, anti-phosphotyrosine (4G10), anti-Rac1 antibodies and EGF were from Millipore/Upstate. Anti-HA antibody (12CA5) was from Roche Molecular Biochemicals. Anti-pAkt (Ser473, 4060) and anti-pERK1/2 (Thr202/Tyr204, 9101) antibodies were from Cell Signaling Technology. Transwell of 8m pore size and 6.5mm diameter was from Costar. Secondary antibodies used for immuno-fluorescence (IF) were from Molecular Probes. 80 2.10 Materials for Chapter Anti-HA (Y-11) and anti--actin (C4) antibodies were from Santa Cruz. AntiCRMP2 (C-terminal region) was from ECMbiosciences. Anti--tubulin, Anti--tubulin, Antipolyhistidine and Epothilone B were from Sigma. Anti-CRMP1 was generated previously in the lab. The reverse transcriptase – MuLV RT enzyme was from NEB and the RNase inhibitor was from Roche. Specific Cdk1 inhibitor –RO3306 and Taxol (Paclitaxel, semisynthetic) were from Calbiochem. CK1 inhibitor was from Tocris. Purified Bovine Brain tubulin (TL238) was from Cytoskeleton Inc. The full length or Kinase Domain (KIN) of ROK constructs were provided by a colleague. HRP-coupled Secondary antibodies for Western blot were from Dako (Denmark). Secondary antibodies used for immunofluorescence (IF) were from Molecular Probes. 2.11 Cell cultures COS7, OLDN-93, NIH3T3 and N1E-115 cells were maintained in DMEM supplemented with 10 % Fetal Bovine Serum (FBS) in a 37 0C incubator with 5% CO2. DU145 cells were cultured using RPMI supplemented with L-glutamine and 10% FBS and incubated under the same condition as the other cell lines. 2.12 DNA transfection and RNAi COS7 cells were transfected at 80-90% confluency with Lipofectamine 2000 (Invitrogen) at a ratio of 1ug DNA to 3ul of reagent and in conditions according to manufacturer‟s instructions. Cells were harvested at 24 hrs or 48 hrs post-transfection. For RNAi, the ratio of 20pmoles to 3ul of the transfection reagent was used. The SiRNAs were synthesized by Invitrogen. Cells were treated with control SiRNA and SiRNAs against ACK1, Grb2 and Cdc42. The SiRNA sequences were: ACK siA (5'-AAGAUGGUGACAGAGCUGGCA-3'), ACK siA2 (5'-GAAGAUGGUGACAGAGCUGGCACdTdT-3'), ACK siC (5'-GCCUGUCCCACUUUGAGUAdTdT-3'), and 81 Grb2 SiRNA (5‟–CAUGUUUCCCCGCAAUUAUdTdT-3‟). Cells were typically transfected for 24hrs before serum-starvation for another 24hrs before harvest. For Chapter experiments, The SiRNAs were synthesized by Invitrogen. Double stranded CRMP2 SiRNA sequences contained 3' dTdT overhangs: CRMP2 SiA (5'ACUCCUUCCUCGUGUACAUdTdT-3') and CRMP2 SiB (5'CCCACUCCAGAAUGGUGAUdTdT-3'). Cells were typically used 48hrs post-transfection. 2.13 Synthesis of recombinant GAS6 cDNA of human GAS6 (Open biosystem) was amplified via PCR using the primers 5'-AATGGATCCACCATGGCCCCTTCGCTCTCG-3' and 5'-TAAGCGGCCGCAAGGC TGCGGCGGG-3'. The amplified product was cloned into C-terminal His-tag pcDNA3 vector via BamHI/NotI sites. The construct was transfected into HEK293 cells via Lipofectamine 2000 (Invitrogen) for 4hrs before changing into serum-free media containing 4M Menadione sodium bisulfite (an analog of Vitamin K). The transfected cells were allowed to express and secrete the recombinant GAS6 into the media for 48hrs. The media with the secreted GAS6 was purified via nickel beads (Ni-NTA, Qiagen) based His-tagged purification method. Briefly, the media was reconstituted into a final concentration of 50mM NaH2PO4, 500mM NaCl, 10mM imidazole, 0.1% Triton-X100 and adjusted to pH 8.0. The media was allowed to flow through the nickel beads column and washed extensively with washing buffer of similar salts concentrations. Recombinant GAS6 was eluted from the beads with 300mM imidazole and dialyzed against 1xPBS. The protein concentration was measured via BioRad protein assay. 82 2.14 Synthesis of recombinant proteins Bacteria BL-21 carrying the pGEX4T1 vector, pGEX4T1 CRMP1 491-572, or pGEX4T1 Stathmin plasmid were induced with 20mM IPTG for 4hrs at room temperature for protein expression. The bacteria were collected at 6krpm for 10mins at 0C. The pellet was resuspended in 1% Triton-X, 50mM Tris pH 8.0, 1mM EDTA, 0.1mM DTT and 10% glycerol with protease inhibitor cocktail and subjected lysis via 1mg/ml lysozyme at 0C for 30min. Complete lysis was ensured via pulsed-sonication. The released proteins were separated from the cell debris via 13.5 krpm centrifugation for 30min at 0C. The supernatants were passed through a column containing equilibrated Glutathione sepharose beads (GenScript) and washed with the lysis buffer. The GST proteins were eluted with Elution buffer of 20mM Hepes, 150mM NaCl, 1mM DTT and 0.6% reduced L-Glutathione at pH 7.3. The eluted proteins were dialyzed against PEM buffer. The protein concentration was measured via BioRad protein assay. The His6-CRMP1 and His6-CRMP1 constructs were transformed into BL21 bacteria and protein expression was induced as above. The protein was purified via nickel beads (NiNTA, Qiagen) based His-tagged purification method. Briefly, the bacteria pellet was resuspended in a buffer (pH 8.0) containing 50mM NaH2PO4, 500mM NaCl, EDTA-free protease inhibitor cocktail, 10mM imidazole, and 0.1% Triton-X100. Lysis was performed as above. The supernatant containing the His6-CRMP1 was allowed to flow through the nickel beads column and washed extensively with washing buffer of similar salts concentrations. Recombinant His6-CRMP1 was eluted from the beads with 300mM imidazole and dialyzed against PEM buffer. The protein concentration was measured via BioRad protein assay. 2.15 RO-synchronization with taxol and epothilone B treatment NIH3T3 or OLDN-93 cells were synchronized overnight with M of RO-3306. The synchronized cells at G2/M phase were released via three washes with media. To determine the effect of Taxol/Epothilone B on mitotic spindle CRMP2, upon 25 into release, 100 nM of Epothilone B or 200 nM Taxol were added to the media for 15 till the 40 time 83 point post-release was reached. The effect of the drugs on midzone CRMP2 was achieved by adding 50 nM of Epothilone B or 100 nM Taxol to the media at 80 post-release for 15 till the 90 time point was reached. 2.16 Reverse Transcriptase (RT)-PCR Total RNA was obtained from the various cell lines according to the protocol of RNeasy Mini Kit (Qiagen). The RNA samples were quantitated and 2ug of RNA was subjected to each reverse transcription reaction. Briefly, annealing of the Oligo-dT (5pmole) was carried out at 70 0C for 10min and chilled quickly on ice for 2min. The reverse transcription was carried by incubating the samples with MuLV RT enzyme (NEB), RNase inhibitor and 0.5mM dNTPs in the provided reaction buffer at 37 0C for 1hr. The reaction was stopped via heat inactivation at 95 0C for 5min and chilled on ice for 5min before aliquoting for storage at -80 0C or for subsequent PCR reaction. The obtained cDNAs was subjected to PCR using the following primers to detect the expression of the various CRMP isoforms: CRMP1: 5‟TTGTTCCTGAACCTGGGTCCAGC-3‟, 5‟GCTCATGACCT-TGGTGATGTACAC-3‟, CRMP2: 5‟AGACATATACATGGAAGATGGGTT-3‟, 5‟CCATACACCACAGTTCCCTTCT-3‟, CRMP3: 5‟GACATCGTGGAGGAGGAACAGA-3‟, 5‟GCCACACATTTCTCCCAGACCA-3‟, CRMP4: 5‟CAAATTGGAGACAATCTGATTGTCC-3‟, 5‟TGGCCAGCAAGGAGTTGATGTA-3‟, CRMP5: 5‟GACACCAGCACCCACTTCCACC-3‟, 5'AGCAGCTGCAATGACATCAC-3'. The amplified products were subjected to agarose gel electrophoresis for analysis. 2.17 Coupling Peptide to Aldehyde-Agarose for antibody purification Five hundred microlitres of aldehyde-agarose beads (Sigma #A9951) were washed (rolling) with 10ml of Coupling buffer (100mM phosphate buffer, pH 7.8) in a 15ml Falcon tube at 40C and spun down at 3000rpm for a few minutes. The beads were transferred to an eppendorf tube and the remaining supernatant was removed. 1mg of the peptide (provided by the antibody production company) was dissolved in 200ul of Coupling buffer and added to 84 beads. 20ul of the Coupling Solution (1M NaCNBH3 in deionized water) was added in to mixed well. The beads were spun down and 10ul of the supernatant was removed, diluted in 490ul of water and read at 280nm using quartz cuvette to set as the initial uncoupled level of peptide. The beads and peptide were incubated for at least 4hrs at 0C and spun down again to remove 10ul for absorbance reading at 280nm. If the coupling was less than 80%, the coupling process was allowed for another few hours. If it was more than 80%, the beads were transferred to a column and washed times with 5ml of Wash Buffer (0.5M NaCl at pH 7.0). The beads were then incubated with 3ml of Blocking Buffer (100mM Tris, pH 8.0 + 100mM NaCNBH3) and stored in 1ml of Coupling buffer with 500uM of vanadate in 0.02% sodium azide at 40C. 2.18 Affinity Purification of Antibodies Four millitres of serum (2ml serum + 2ml of 1x PBS) was incubated with 500ul of beads for 2hrs at 40C to preclear the serum. The suspension was then passed through a column to remove the beads and the flow through was collected (10ul of serum was kept for western blot analysis). The flow through serum was added to the 500ul of peptide-coupled beads and rolled overnight at 40C. The suspension was passed through a column and washed with 5ml of cold 1xPBS/0.1% TritonX-100. Four tubes of 15ml conical tubes were prepared and 30ul of 1M Tris at pH 8.5 was added to tube and 50ul of 1M Tris at pH 8.5 to the subsequent tubes 2-4. For elution of the antibody, 500ul of Elution Buffer (1x PBS, 0.05% TritonX-100, 100mM Glycine, pH 2.5) was added to the column and collected in tube 1. The step was repeated for tube 2-4. This step was done quickly as the low pH is detrimental to the antibody. The pH of the eluates was checked using litmus paper to be between pH 7-8. Western blot was used to analyze the eluates, crude sera and the initial flow through fraction. Those fractions with good immunoreactivity were pooled and stored at 40C or -20 0C with 5% glycerol. 85 2.19 Activated Axl detection and endogenous Axl immunoprecipitation A phospho-peptide encompassing the Y702/3 residues of Axl activation loop was synthesized: Ac-C-K-I-Y-N-G-D-pTyr-pTyr-R-Q-G-R (Genemed Synthesis, Inc.). PhosphoY702/3 specific antibodies were purified from immunized rabbit sera using immobilized peptide (see section above). To detect endogenous Axl/ACK1 complexes serum-starved COS7 cells were treated with GAS6 (400ng/ml) and lysed at various time points. Endogenous Axl was immuno-precipitated with the goat Axl antibodies/Protein G beads for 4hrs at 0C and washed at times, before elution with sample buffer. The protein samples were then subjected to SGS-PAGE and Western blot analysis. 2.20 Phospho-CRMP detection via phospho-S537 antibody Antibodies directed against the phospho-S537 and phospho-S540 sites were generated in rabbit (GenScript) using phospho-peptides coupled at their N-termini via cysteine to keyhole limpet haemocyanin as follow: (Ac-CIRNLHQpSGFSLSG and AcCRNLHQSGFpSLSGAQ). After affinity purification (see section above) the antibodies were pre-cleared against immobilized non-phosphorylated GST-CRMP1(491-572). Antibodies in 1% BSA/0.05% Tween-20/PBS buffer were employed in Western blot analysis. 2.21 Pull-down Assays, Ligands stimulation and Western Blot Analysis For RTKs interaction analysis, cells were pretreated with 500μM of sodium orthovanadate for 30min before cell lysis. In these pull-down assays, the cells were washed with cold PBS and harvested with Triton-lysis buffer of 50mM Hepes pH 7.3, 1mM EDTA, 0.1mM DTT, 10% glycerol, 1% Triton-X100, 1.5mM MgCl2, 10mM NaF, 150mM NaCl, 1mM NaV03, protease inhibitors cocktail and 20mM glyceraldehye -glycerophosphate. The lysates were sonicated and spun in a microfuge at 14000 rpm for 10min. The supernatants were incubated with GST beads for at least 2hrs at 4°C before extensive washing with the same lysis buffer and eluted with sample buffer. For the co-immunoprecipitation of ROK with CRMPs, transfected cells were washed with cold PBS and lysed with Lysis Buffer 86 (50mM Tris-Cl, pH 8.0, 1mM EDTA, 0.1mM DTT, 10% Glycerol, 1% TritonX-100) containing 1mM NaV03, protease inhibitors cocktail and 20mM glyceraldehye glycerophosphate. The supernatants were incubated with M2 beads (containing immobilized Flag antibody) for at least 2hrs at 4°C before extensive washing with the same lysis buffer and eluted with sample buffer. For EGF/GAS6 stimulation, Cos7 cells were serum starved overnight before stimulation with EGF (100ng/ml) or GAS6 (200ng/ml or 400ng/ml). The cells were then washed with cold PBS and lysed with Ripa lysis buffer (0.1 M Tris, pH 7.4, 0.15 M NaCl, 1% Triton X-100, 0.5% deoxycholate, 0.1% SDS, 5% glycerol, mM PMSF, 20mM glycerophosphate and protease inhibitor cocktail). For the detection of endogenous Axl, ACK or CRMP levels, the cells were also lysed with the same Ripa buffer. For GSK3 and CK1 inhibition, the transfected cells were treated with either 20 mM NaCl, 20 mM LiCL or 40 μM D4476 for hrs before 50 μM calyculin A treatment and cell lysis with Ripa buffer. The lysates were sonicated and spun in a microfuge at 14000 rpm for 10min. Protein sample buffer was added into the supernatants and boiled before SDS-polyacrylamide gel electrophoresis. All the protein samples were subjected to SDS-polyacrylamide gel electrophoresis and transferred onto PVDF membrane. The membranes were blocked with 3% BSA in 0.05% Tween-20/Tris buffer for 30min and incubated with primary antibodies diluted in 3% BSA/0.05% Tween-20/Tris buffer for at least 1hr at room temperature or overnight at 4°C. For Chapter 4, the membranes were blocked with 5% skimmed milk in 0.05% Tween-20/PBS buffer instead of BSA. The membranes were washed with 0.05% Tween-20/Tris buffer and incubated with anti-rabbit/goat/mouse Hrp secondary antibodies for 1hr at room temperature. After washing, signals were visualized with ECL detection reagents (Super Signal from Thermo Scientific). 87 2.22 Overlays with [-32P]-GTP labeled proteins The SH3 array filters were purchased from Panomics (Array II. The cat no. is MA3012). The fusion proteins of GST-(ACK1-732-761) and GST-(ACK1 771-800) were labeled as described previously (Chan et al. 2009) and used at 10 μg/ml. This experiment was performed by Dr. Wing Chan. 2.23 Transwell Migration COS7 cells were treated with control and ACK SiRNAs for 48hrs inclusive of 24hrs serum-starvation before detachment from culture dishes by trypsin. Excess trypsin was washed out. Cells were counted using haemocytometer and diluted to a cell density of 2.5 x 105 per ml. The underside of the transwells were precoated with 10ug/ml of fibronectin in 37 C incubator for at least 1hr and washed away with PBS. A volume of 100ul of the cells were added to the top well and allowed for migration towards the underside of the well submerged in 600ul of serum-free media with 400ng/ml of GAS6 for 3hrs in the 37 0C incubator. Thereafter, the migrated cells were fixed via 3% paraformaldehye for 15min. Non-migrated cells were scraped off via cotton swap. The membrane with the migrated cells were cut out of the well and stained with TRITC-phalloidin and Hoechst dye for 1hr before washing with 0.1% Triton-X/PBS for times. The membranes were placed onto glass slides with the cell facing up and mounted with mounting media and coverslips. Axioplane microscope was used to view the cells and the number of nuclei per 40x field was counted. At least 30 fields per membrane were quantitated. 2.24 In vitro MT cosedimentation Purified tubulin was made up to 5mg/ml in 10% glycerol- PEM buffer (80mM PIPES, mM MgCl2, mM EGTA, pH 6.8). The tubulin was pre-clarified in a high speed spin of 90,000rpm for in 0C. The tubulin solution was polymerized at 37 0C for 30 with mM DTT, 1x protease inhibitor, mM GTP, the recombinant proteins (GST and His CRMP1 at 0.2 mg/ml or GST and GST CRMP1 491-572 at 0.5 mg/ml), and with or without 88 10 μM Taxol. The final tubulin concentration was mg/ml. MTs were spun down at 65,000 rpm for 15 at 25 0C. The pellets were washed with warm PEM buffer. The pellets and supernatants were diluted with SDS sample buffers and subjected to SDS-PAGE and Western blot analysis. 2.25 Surface Plasmon Resonance (SPR) BIAcore 2000 system and CM5 chip were from BIAcore AB using standard HBS buffer. A reference flow cell contained immobilized GST protein (at equivalent RU). Dialysed recombinant GST CRMP1(491-572), His6CRMP1 and GST-stathmin were precleared at 90,000 rpm, min, before coupling to the CM5 chip via amine coupling (GE Health Science). The recombinant proteins were flowed at 5l/min (~0.4 M): un-reacted sites were blocked with 0.1M ethanolamine pH 8.5 for at 5l/ml. Purified tubulin dimer (Bovine; Cytoskeleton Inc.) dissolved in PEM+T (80 mM PIPES, mM MgCl 2, mM EGTA, 0.005% Tween-20, pH 6.8). The tubulin was pre-clarified in a high speed spin of 90,000 rpm (rotor) for at 0C. Tubulin (5 M and 10 M in PEM +1 mM GTP) was allowed to associate for 6min at 15l/min and the dissociation phase for various periods. In between runs, the sensorchip was regenerated with 30 l of 50 mM Hepes (pH 7.4), 300 mM KCl, 3mM EDTA and 0.005% Tween-20. For analysis, the data from the GST control sensorgram was subtracted from the other sensorgrams to abolish non-specific background noise. 2.26 In vitro Kinase Assay The recombinant proteins of His6-CRMP1 and His6-CRMP2 were incubated with either recombinant PAK1, GSK3, CK1 or GSK3 +CK1 in kinase buffer (25 mM Hepes pH 7.3, 25 mM NaCl, mM -glycerolphosphate, 2.5 mM NaF, mM MgCl2 and 0.025% TritonX-100) with mM ATP. The reaction mix was incubated at 30 0C for 20min. Sample buffer was added and the samples were boiled and analyzed via SDS-PAGE and Western Blot. 89 2.27 In vitro actin co-sedimentation assay COS7 cells were transfected with either vector GST HA, HA-CRMP1, HACRMP1(S537A), HA-CRMP1(S537D) and HA-CRMP2 using lipofectamine 2000 for 24hrs before cell lysis with Buffer G (2mM Tris and 0. 2mM CaCl2 pH 8.0) +0.25% TritonX-100 + Protease Inhibitors (Complete, Roche). Lysates were sonicated for complete lysis and clarified via bench top centrifugation at 13krpm for 20min at 0C. The clarified lysates were incubated in ice for 1hr in the presence of 0.5mM DTT. After incubation, the membrane fractions were removed via high speed centrifugation at 75 krpm for 30min at 0C with TLA120.1 rotor in Beckman centrifuge. The resulting supernatants were divided into two fractions for „depolymerizing condition‟ and „polymerizing condition‟. For the depolymerizing condition, the lysates were incubated with equal volume of a mixture of Buffer KME (Final concentration to be 1X) + Buffer G on ice for 1hr. For the polymerizing condition, the lysates were also incubated with equal volume of a mixture of Buffer KME (Final concentration to be 1X) + Buffer G but with the addition of 0.25mM ATP and 0.5mM DTT and incubated in room temperature for 1hr. After incubation, both fractions were spun at high speed of 100krpm for 15min. The supernatants were collected and added with sample buffer. The pellets were resuspended in equal volume as the supernatant and added with sample buffer. The boiled samples were then analyzed using SDS-PAGE and Western Blot. The contents of 10X Buffer KME are 0.1M Tris, 500mM KCl, 10mM MgCl and 10mM EGTA at pH 8.0. 2.28 Phase-contrast Imaging Cells were imaged using Image Pro in a 370C, 5% CO2 stage with 32x lens through Zeiss Axiovert-135M microscope. For Chapter experiments, cells were transfected with control and ACK SiRNAs for 24hrs before detachment and reseeding at low density in 6-well plates and allowed for cell attachment (at least 5hrs) before serum starvation overnight. Images were taken around 5mins after GAS6 addition at a 40s interval scan and with fields per well and over 90min total time course. For Chapter experiments, cells were transfected 90 with control and CRMP2 SiRNAs and synchronized with RO-3306. Images were taken around 10mins after release at a 40s interval scan and with fields per well. The images were processed with ImagePro and Adobe Photoshop. 2.29 Nocodazole assay and GSK3 inhibition Transfected COS7 cells were treated with M nocodazole for 45 and partially pre-permeabilized with warmed 0.15% Triton X/ 1% paraformaldehyde (PFA)/ Pipes-EGTAMgCl2 (PEM) buffer before fixation with warmed 3% PFA/PEM. For GSK3 inhibition, the transfected cells were serum starved for hrs and treated with 20 mM NaCl or 20 mM LiCl for hrs before the nocodazole assay. For pre-permeabilization, warmed 0.1% TritonX100/PEM was added to the transfected cells briefly and washed with warmed PEM buffer and fixed with warmed 3% PFA/PEM. 2.30 Immunofluorescence Analysis For RTKs interaction analysis, cells were pretreated with 500μM of sodium orthovanadate for 30min before fixation. Cells were fixed with 3% paraformaldehyde (PFA) in PBS for at least 10min and washed with PBS. For Chapter experiments, prepermeabilization using 0.15% TritonX-100/PEM briefly (with one quick rinse of warmed 1x PEM buffer) or partial pre-permeabilization using 0.15% TritonX-100/1% PFA/PEM briefly was performed on the cells before fixation with 3% PFA in 1x PEM buffer. Cells were permeabilized with 0.2% Triton-X/PBS for 10min and blocked with 1% FBS in 0.1% TritonX-100/PBS for 10min and blocked with 10% FBS/PBS. Primary antibodies were diluted in 0.5% TritonX-100/PBS and incubated with the cells for at least 1hr at room temperature and washed with 0.1% TritonX-100/PBS. Secondary antibodies (antimouse/rabbit/goat Alexa-488 or Alexa-546; 1:500) were incubated and washed under similar conditions. Far Red Phalloidin and Hoechst dye were added in during the secondary antibody incubation step when required. For non-permeabilized staining of membrane Axl, the fixed 91 cells were not permeabilized with TritonX-100. The staining procedures were similar except that TritonX-100 was replaced with 2% BSA. Cells were mounted and viewed by Zeiss Axioplan2 coupled to a coolsnap HQ camera (Roper Scientific) using 63X oil lens. For imaging of the mitotic appartus, the cells were imaged using Olympus Fluorview 1000 confocal microscope. Images were processed by Adobe Photoshop. 2.31 Buffers Components Table 2. Components of the buffers Buffer Name SOC medium 50X TAE Buffer (1L) 4X Tris-Cl/SDS pH 8.8 4X Tris-Cl/SDS pH 6.8 10% Acrylamide Gel 3% Stacking Gel 10X SDS PAGE Running Buffer 10X Transfer Buffer (1L) Components 0.5% Yeast extract 2% Tryptone 10mM NaCl 2.5mM KCl 10mM MgCl2 10mM MgS04 20mM Glucose 2M Tris 0.05M EDTA, pH 7.5-8 57.1ml Glacial Acetic Acid 1.5M Tris 0.4% SDS pH to 8.8 with HCl 0.5M Tris 0.4% SDS pH 6.8 with HCl 30% Acrylamide -5ml 4X Tris-Cl/SDS pH 8.8 – 3.75ml Deionised Water: 6.25ml 10% Ammonium Persulphate (AP) – 100ul TEMED – 20ul 30% Acrylamide (3.3% C) -650ul 4X Tris-Cl/SDS pH 6.8 – 1.25ml Water – 3.05ml 10% AP– 50ul TEMED – 10ul 0.25M Tris 2M Glycine 1% SDS 0.8M Glycine 0.25M Tris 92 [...]... Western Blot 89 2. 27 In vitro actin co-sedimentation assay COS7 cells were transfected with either vector GST HA, HA-CRMP1, HACRMP1(S537A), HA-CRMP1(S537D) and HA-CRMP2 using lipofectamine 20 00 for 24 hrs before cell lysis with Buffer G (2mM Tris and 0 2mM CaCl2 pH 8.0) +0 .25 % TritonX-100 + Protease Inhibitors (Complete, Roche) Lysates were sonicated for complete lysis and clarified via bench top centrifugation... abolish non-specific background noise 2. 26 In vitro Kinase Assay The recombinant proteins of His6-CRMP1 and His6-CRMP2 were incubated with either recombinant PAK1, GSK3, CK1 or GSK3 +CK1 in kinase buffer (25 mM Hepes pH 7.3, 25 mM NaCl, 5 mM -glycerolphosphate, 2. 5 mM NaF, 5 mM MgCl2 and 0. 025 % TritonX-100) with 1 mM ATP The reaction mix was incubated at 30 0C for 20 min Sample buffer was added and... Yeast extract 2% Tryptone 10mM NaCl 2. 5mM KCl 10mM MgCl2 10mM MgS04 20 mM Glucose 2M Tris 0.05M EDTA, pH 7.5-8 57.1ml Glacial Acetic Acid 1.5M Tris 0.4% SDS pH to 8.8 with HCl 0.5M Tris 0.4% SDS pH 6.8 with HCl 30% Acrylamide -5ml 4X Tris-Cl/SDS pH 8.8 – 3.75ml Deionised Water: 6 .25 ml 10% Ammonium Persulphate (AP) – 100ul TEMED – 20 ul 30% Acrylamide (3.3% C) -650ul 4X Tris-Cl/SDS pH 6.8 – 1 .25 ml Water... in 20 0ul of Coupling buffer and added to 84 beads 20 ul of the Coupling Solution (1M NaCNBH3 in deionized water) was added in to mixed well The beads were spun down and 10ul of the supernatant was removed, diluted in 490ul of water and read at 28 0nm using quartz cuvette to set as the initial uncoupled level of peptide The beads and peptide were incubated for at least 4hrs at 4 0C and spun down again to. .. (Super Signal from Thermo Scientific) 87 2. 22 Overlays with [-32P]-GTP labeled proteins The SH3 array filters were purchased from Panomics (Array II The cat no is MA30 12) The fusion proteins of GST-(ACK1-7 32- 761) and GST-(ACK1 771-800) were labeled as described previously (Chan et al 20 09) and used at 10 μg/ml This experiment was performed by Dr Wing Chan 2. 23 Transwell Migration COS7 cells were treated... with TritonX-100 The staining procedures were similar except that TritonX-100 was replaced with 2% BSA Cells were mounted and viewed by Zeiss Axioplan2 coupled to a coolsnap HQ camera (Roper Scientific) using 63X oil lens For imaging of the mitotic appartus, the cells were imaged using Olympus Fluorview 1000 confocal microscope Images were processed by Adobe Photoshop 2. 31 Buffers Components Table 2 Components... precleared at 90,000 rpm, 5 min, before coupling to the CM5 chip via amine coupling (GE Health Science) The recombinant proteins were flowed at 5l/min (~0.4 M): un-reacted sites were blocked with 0.1M ethanolamine pH 8.5 for 2 min at 5l/ml Purified tubulin dimer (Bovine; Cytoskeleton Inc.) dissolved in PEM+T (80 mM PIPES, 1 mM MgCl 2, 1 mM EGTA, 0.005% Tween -20 , pH 6.8) The tubulin was pre-clarified... with 2 M nocodazole for 45 min and partially pre-permeabilized with warmed 0.15% Triton X/ 1% paraformaldehyde (PFA)/ Pipes-EGTAMgCl2 (PEM) buffer before fixation with warmed 3% PFA/PEM For GSK3 inhibition, the transfected cells were serum starved for 3 hrs and treated with 20 mM NaCl or 20 mM LiCl for 2 hrs before the nocodazole assay For pre-permeabilization, warmed 0.1% TritonX100/PEM was added to. .. the drugs on midzone CRMP2 was achieved by adding 50 nM of Epothilone B or 100 nM Taxol to the media at 80 min post-release for 15 min till the 90 min time point was reached 2. 16 Reverse Transcriptase (RT)-PCR Total RNA was obtained from the various cell lines according to the protocol of RNeasy Mini Kit (Qiagen) The RNA samples were quantitated and 2ug of RNA was subjected to each reverse transcription... with 5ml of cold 1xPBS/0.1% TritonX-100 Four tubes of 15ml conical tubes were prepared and 30ul of 1M Tris at pH 8.5 was added to tube 1 and 50ul of 1M Tris at pH 8.5 to the subsequent tubes 2- 4 For elution of the antibody, 500ul of Elution Buffer (1x PBS, 0.05% TritonX-100, 100mM Glycine, pH 2. 5) was added to the column and collected in tube 1 The step was repeated for tube 2- 4 This step was done quickly . CRMP1(480-5 72) , CRMP1(491- 5 72) and CRMP2(480-5 72) were cloned into pXJ-GST using PCR to introduce HindIII and XhoI cloning sites. Full length CRMP1 and CRMP2 were cloned into a modified pET21D His 6. vector GST HA, HA-CRMP1, HA- CRMP1(S537A), HA-CRMP1(S537D) and HA-CRMP2 using lipofectamine 20 00 for 24 hrs before cell lysis with Buffer G (2mM Tris and 0. 2mM CaCl 2 pH 8.0) +0 .25 % TritonX-100. three washes with media. To determine the effect of Taxol/Epothilone B on mitotic spindle CRMP2, upon 25 min into release, 100 nM of Epothilone B or 20 0 nM Taxol were added to the media for 15 min