Protective effects of s propargylcysteine (SPRC) on in vitro neuronal damage induced by amyloid beta (25 35 p 1 3

PROTECTIVE EFFECTS OF S-PROPARGYLCYSTEINE (SPRC) ON IN VITRO NEURONAL DAMAGE INDUCED BY AMYLOID-BETA(25-35) WONG WAN HUI B.Sc (Hons) National University of Singapore A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF PHARMACOLOGY NATIONAL UNIVERSITY OF SINGAPORE 2011 DECLARATION I hereby declare that this thesis is my original work and it has been written by me in its entirety I have duly acknowledged all the sources of information which have been used in the thesis This thesis has also not been submitted for any degree in any university previously Wong Wan Hui ACKNOWLEDGEMENTS I would like to thank the following people for making this thesis possible Firstly, I would like to convey my heartfelt thanks to my supervisor A/P Zhu Yi-Zhun for his support and guidance the past seven years in his laboratory I have learnt much and grew to be a better researcher with the independence and freedom he has always granted me Without his encouragement I would never have embarked on this journey of self-discovery and learning I would also like to thank my mentors Dr Wang Hong, Dr Sonja Koh and Dr Wang Zhong Jing for their patience and guidance Dr Wang Hong had been my mentor in both research and life I will never forget all the times we spent having lunch together and discussing about a wide range of issues Dr Sonja Koh had made herself always available to answer my doubts Her presence had been inspiring with her creativity and I always felt assured with her around Dr Wang Zhong Jing was the first person who introduced me to the world of hydrogen sulfide and research with his passion He taught me how to think through problems and to analyse research questions that made me a scientist today For this much guidance from such great scientists, I am most grateful Thirdly, I would like to extend my gratitude to the Head of Department and his staff from the Department of Pharmacology, Yong Loo Lin School of Medicine I had been in this department since my undergraduate days I have been nurtured on this unique field of study by wonderful and passionate teaching staff I also had the honour of knowing and working with most of the staff in our department Regardless of their positions, various staff from the department never failed to make me feel a part of the family, and always ready to extend their i help to me as a student and colleague alike It made my research journey so much more enjoyable with their support To my fellow seniors and juniors from this laboratory throughout these seven years, it had been a great honour to know each and every one of them They have given me their unbridled comments and encouragement through the times at lab meetings They have also inspired me with their perseverance and pulled me along Their friendship and camaraderie accompanied me on the most lonely days I would also like to thank my family members who have given me their unconditional support through this arduous time They have never doubted my ability even when I felt lost, and they have given me the motivation to stand up again despite falling down so many times Even through the difficult twelve-hour incubation times when I have to return to office at nights, my family would encourage me whenever I wanted to give up This thesis would not have been possible without them I want to specially mention my best friends Shi Ping, Shixin and Shu Min for their encouragement and belief in me throughout this time Even though they might not be in the same field of study, they were willing to lend a listening ear to me whenever I felt down In fact, without Shixin’s encouragement in the form of a bamboo story, I would still be that bamboo farmer who will give up because I cannot see the shoots growing I will also remember the times Shumin and I discuss our research topics over coffee, and how she told me to doubt in order to grow I am most blessed to have these best friends Lastly, I would like to thank my fiancé Isaac for being with me in this journey He had brought out the best in me, and allowed me to be myself He was always patient to listen to my ii woes and though he cannot understand the difficult pharmacological terms, he could empathise with my difficulties I will never forget the times he painstakingly tried to help me organize my thoughts for this thesis as he struggled to study for his own exams I will always be grateful to his understanding and patience, such that he would wait for me to finish my experiments and accompany me through those rushed dinners I am thankful to have him in this journey and will be happy to have him for the rest of my life I am most grateful for this chance to write this thesis and most importantly, a chance to prove myself as a researcher and a person I have grown to be more patient and determined from this experience And most importantly, I have learnt to pick myself up whenever I fall This is something I am sure, will help me through my life iii TABLE OF CONTENTS Acknowledgements i Abstract viii List of Tables .x List of Figures xi CHAPTER 1: INTRODUCTION 1.1 GENERAL INTRODUCTION 1.1.1 Alzheimer’s Disease (AD) 1.1.2 Aggregated proteins and diseases .2 1.1.3 Self-aggregation properties of amyloid peptides 1.1.4 Factors affecting fibril formation 1.2 AMYLOID-BETA PEPTIDE (Aβ) .6 1.2.1 Products of sequential cleavage 1.2.2 Neurotoxicity of Aβ25-35 1.2.3 Structure of Aβ25-35 .8 1.3 GARLIC AND S-ALLY-L-CYSTEINE (SAC) 10 1.3.1 Aged garlic extract 10 1.3.2 S-ally-L-cysteine .10 1.4 S-PROPARGYL-L-CYSTEINE (SPRC) 13 1.4.1 Chemical properties and pharmacokinetics 13 1.4.2 Cardioprotective effects 14 1.4.3 Neuroprotective effects .16 1.5 HYDROGEN SULFIDE (H2S) 17 1.5.1 General properties .17 1.5.2 Synthesis 17 1.5.3 Biological targets of H2S 19 1.5.4 H2S as a neuromodulator 20 1.5.5 H2S in AD 21 1.6 OXIDATIVE STRESS 23 1.6.1 Oxidative balance in the brain 23 1.6.2 Imbalance in the disease state 24 1.6.3 Aβ-induced oxidative stress 25 1.6.4 Antioxidant therapy in AD 29 1.7 INFLAMMATION 31 iv 1.7.1 Inflammation in AD patients 31 1.7.2 Role of inflammation in the brain and disease state 32 1.7.3 Inflammatory mediators in AD 35 1.7.4 Therapeutic efficacy of anti-inflammatory drugs .39 1.8 CELL DEATH MECHANISMS .41 1.8.1 Roles of astrocytes in neuroprotection and defense 41 1.8.2 Apoptosis in glial cells 42 1.8.3 The relationship between autophagy and Aβ 47 CHAPTER 2: AIMS AND OBJECTIVES 52 CHAPTER 3: MATERIALS AND METHODS 54 3.1 EXPERIMENTAL PROTOCOLS 54 3.1.1 In vitro study .54 3.1.2 Part II: Oligomeric Aβ25-35 55 3.1.3 Part III: Fibrillar Aβ25-35 55 3.2 IN VITRO STUDY 56 3.2.1 Thioflavin T fluorescence 56 3.2.2 Coomassie Blue Staining 57 3.2.3 Free radical scavenging 57 3.24 Statistical analysis 58 3.3 CELL CULTURE STUDIES .59 3.3.1 Chemicals 59 3.3.2 Cell culture 59 3.3.3 MTT assay 60 3.3.4 H2S pathway 60 3.3.5 Western blot 61 3.3.6 Reactive oxygen species (ROS) generation 62 3.3.7 Inflammation .64 3.3.8 Cell Death Mechanisms 65 3.3.9 Transmission electron microscopy 67 3.3.10 Statistical analysis 67 v CHAPTER 4: PART I - IN VITRO STUDY .68 4.1 RESULTS 68 4.1.1 Aβ25-35 aggregation with time 68 4.1.2 Aβ25-35 aggregation with temperature .69 4.1.3 Effects of SPRC on Aβ25-35 aggregation 70 4.1.4 Effects of SAC on Aβ25-35 aggregation .72 4.1.5 Effects of sodium hydrosulfide (NaHS) on Aβ25-35 aggregation .74 4.1.6 Comparison of equimolar concentrations of drugs 76 4.1.7 Effects on radical scavenging 78 4.2 DISCUSSION 80 4.2.1 Aβ25-35 aggregates with increasing time and temperature 80 4.2.2 Drug treatments disrupt the formation of Aβ25-35 fibrils 81 4.2.3 SPRC reduces Aβ25-35 aggregation more effectively than SAC 84 4.2.4 NaHS confer a Type II protection against aggregation 85 4.2.5 Free radicals were scavenged by drugs in solution 87 4.3 SIGNIFICANCE OF PART I 80 CHAPTER 5: PART II - OLIGOMERIC Aβ 91 5.1 RESULTS 91 5.1.1 Effects of aggregated Aβ25-35 on cell viability 91 5.1.2 Effects of drug pre-treatment on Aβ-induced cytotoxicity .92 5.1.3 Effects on H2S pathway 95 5.1.4 Effects on oxidative stress 98 5.1.5 Effects on inflammation 104 5.1.6 Effects on cell death mechanisms 108 5.1.7 Effects on cell morphology .115 5.2 DISCUSSION 122 5.2.1 Oligomeric Aβ25-35 is toxic to glial cells 122 5.2.2 Pre-treatment of drugs alleviates Aβ-induced injury mediated by the H2S pathway 122 5.2.3 SPRC and SAC can relieve intracellular ROS 125 5.2.4 SPRC restores SOD levels and activities 127 5.2.5 SPRC possesses anti-inflammatory properties different from SAC .129 5.2.6 G1 progression encouraged by SPRC and SAC .133 vi 5.2.7 SPRC reduces DNA damage 135 5.2.8 The autophagic pathway is halted by SPRC and SAC 136 5.2.9 Pre-treated cells had improved cell ultrastructures 137 CHAPTER 6: PART III - FIBRILLAR Aβ 140 6.1 RESULTS 140 6.1.1 Time dependence of aggregated Aβ25-35 on cell viability .140 6.1.2 Effects of drugs on Aβ-induced cytotoxicity 141 6.1.3 Effects on H2S pathway 144 6.1.4 Effects on ROS generation .147 6.1.5 Effects on inflammation 155 6.1.6 Effects on cell death mechanisms 159 6.1.7 Effects on cell morphology .168 6.2 DISCUSSION 176 6.2.1 Higher incubation temperature encourages the formation of Aβ25-35 fibrils 176 6.2.2 SPRC confers protection after longer pre-treatment at higher dose .178 6.2.3 The H2S pathway mediated the cytoprotection by SPRC .180 6.2.4 More oxidative stress was induced by fibrillar Aβ 183 6.2.5 Drug treatments regulated antioxidant enzyme expressions and activities differently 185 6.2.6 SPRC does not involve the H2S pathway its anti-inflammatory effects 190 6.2.7 Fibrillar Aβ25-35 affects autophagy differently from oligomeric Aβ25-35 194 6.2.8 SPRC modifies the autophagic pathway 195 6.2.9 The ultrastructural changes were restored after drug treatments 197 CHAPTER 7: CONCLUSIONS 199 7.1 SIGNIFICANT CONTRIBUTIONS .199 7.2 FUTURE WORK .203 References .205 vii ABSTRACT Alzheimer’s disease (AD) is a neurodegenerative disease characterized by widespread extracellular deposits of amyloid-beta (Aβ) protein in the brain Amongst which, the Aβ25-35 peptide is the shortest fragment which retains the toxicity of the full-length protein In this study, this peptide was found to aggregate in a time- and temperature-dependent manner This aggregation can be slowed with the co-incubation of S-propargyl-cysteine (SPRC), S-allylcysteine (SAC) or sodium hydrosulfide (NaHS) in the solution, accompanied with decreased sizes of the Aβ aggregates Aβ radicalizes in solution to cause detrimental damage even outside cells SPRC can scavenge free radicals better than SAC, but less competent than NaHS The triple bond in SPRC is more nucleophilic than SAC that can react with the lone pair of electrons in free radicals Oligomeric or fibrillar Aβ25-35 were added to the C6 glioma cell line and the cell viabilities were compromised The decline in cell viability was more obvious when treated with fibrillar Aβ25-35, which acted on exacerbating oxidative stress by increasing H2O2 levels, inflammation and disruption of the autophagic activation Moreover, the aggregated Aβ decreased the H2S levels produced and the expression of cystathione-β synthase (CBS) in the cells Pre-treatments of SPRC and SAC both restored the Aβ-induced reductions in cell viabilities, but the doses required to restore the cell viabilities were higher in damage by Aβ fibrils SPRC mimicked the protection by SAC on glioma cells through its antioxidant nature, particularly targeting superoxide dismutase (SOD) and glutathione peroxidase (GPx) in both forms of Aβ injuries SPRC also decreases pro-inflammatory IL-1β and increases antiinflammatory IL-10 to reduce the inflammatory responses evoked by Aβ25-35 though differently from SAC SPRC reduces DNA fragmentation and reverses autophagic activation that preserves cellular integrity in a similar manner to SAC These protective effects of SPRC can be due its cysteine backbone similar to SAC and its endogenous H2S-producing nature When compared to viii AIMS AND OBJECTIVES Lastly, the responses of SPRC in the presence of different forms of Aβ25-35 are compared with the effects of SAC 53 MATERIALS AND METHODS CHAPTER 3: MATERIALS AND METHODS 3.1 Experimental Protocols 3.1.1 In vitro study The in vitro study was carried out in four parts For the first part, the time-dependent aggregation of Aβ25-35 was investigated Aβ25-35 was dissolved to a final concentration of 50 µM and incubated at 37°C The change in thioflavin T fluorescence and electrophoretic migration after incubation for h, 24 h, 48 h, 72 h and 96 h were then carried out The second part investigates the temperature-dependent aggregation of Aβ25-35 The Aβ was incubated for 96h at 4°C, 25°C and 37°C Tests tracking the aggregation and sizes of aggregated products were subsequently carried out The third part elucidates the effects of drug addition on the aggregation of Aβ25-35 Different doses of the various drugs, SPRC, SAC and NaHS were added with Aβ25-35 at h and the fluorescence was tracked over 96 hours A final dose of 50 µM for all drugs was chosen and subsequently separated by electrophoresis The fourth part looks into the oxidative potential of Aβ25-35 and the antioxidant properties of the drugs The antioxidant properties of the various drugs on aggregated Aβ were examined with different doses and compared with Vitamin C as a control 54 MATERIALS AND METHODS 3.1.2 Part II: Oligomeric Aβ25-35 In this study, Aβ was aggregated for 24 hours at 4°C to achieve the oligomeric form before adding to the cells (Figure 9) C6 glioma cells are plated to a density of 2.5 x104 cells/ cm2 and allowed to grow overnight to achieve an 80% confluence Cells were then randomly assigned to a treatment group The culture medium was removed and exchanged with serum-free medium for one hour The cells were then pre-treated with the respective drugs for twelve hours before treatment with the aggregated Aβ for 24 hours Aβ aggregated at 4° for 24 h C 24 h C6 cells 1h 12 h 24 h Seeded and cultured Replaced with SFM Pretreatment Aβ treatment Figure 9: Experimental protocol for Part II: Oligomeric Aβ25-35 3.1.3 Part III: Fibrillar Aβ25-35 In this study, Aβ was aggregated at 37°C for 24 hours to achieve the fibrillar form before adding to the cells Cells are grown and randomly assigned as in Part II However, the cells were pre-treated with the respective drugs for 24 hours and treating with the aggregated Aβ for the subsequent 16 hours (Figure 10) Aβ aggregated at 37° for 24 h C 24 h C6 cells 1h 24 h 16 h Seeded and cultured Replaced with SFM Pre-treatment Aβ treatment Figure 10: Experimental protocol for Part III: Fibrillar Aβ25-35 55 MATERIALS AND METHODS 3.2 In Vitro Study 3.2.1 Thioflavin T fluorescence Thioflavin T (Sigma-Aldrich) is used in the fluorometric determination of amyloid fibrils in vitro In the absence of amyloid fibrils, the dye fluoresced faintly at the excitation and emission maxima of 350 nm and 438 nm respectively The dye fluoresced brightly at excitation and emission maxima of 450 nm and 482 nm respectively in the presence of fibrils A 100X stock solution of Aβ25-35 (GL Biochem) is added to 50 mM Tris buffer (pH 7.4) to make a final concentration of 50 µM Thioflavin T is dissolved in distilled water as a 1000X stock and added to the Aβ solution to make a final concentration of µM 200 µl of the Aβ solution is evenly distributed into each well on a 96-well plate Different concentrations of drugs are dissolved in distilled water as a 100X stock and distributed to the wells to make a final concentration of µM, 10 µM, 50 µM or 100 µM Distilled water is used for the control group and temperaturedependent study The plate is covered with Clingwrap film to prevent evaporation during incubation and reading The change in fluorescence is tracked every two hours for 96 hours using the Varioskan Flash fluorescence reader The readings are expressed as a ratio of the 0-hour reading and plotted against time For the temperature-dependent study, the fluorescence for 50 µM Aβ solution is read at 0-hour first before incubating at 4°C, 25°C or 37°C for 96 hours separately At the end of the 96-hour incubation, the change in fluorescence is read again for each temperature The readings are expressed as change in fluorescence (reading at h - reading at 96 h) and plotted against temperature of incubation 56 MATERIALS AND METHODS 3.2.2 Coomassie Blue Staining The different-sized aggregation products are separated using SDS-PAGE and stained with Bio-safe Coomassie Stain (Bio-Rad Laboratories) to visualize the bands 30 µl of 50 µM Aβ25-35 dissolved in distilled water is incubated for 96 hours at 37°C For the temperaturedependent study, the Aβ solution is incubated at different temperatures for 96 hours At the end of the incubation, 2X colourless loading dye is added to each tube and mixed well The total volume of 60 µl is loaded into each well of a 15% tricine resolving gel with a 4% stacking gel The proteins are resolved in 1X Tris-Tricine buffer (1st Base) at 120V for one hour The stacking and resolving gels are stained with Coomassie stain for one hour and washed with distilled water overnight Heavy-weight aggregated products cannot enter the stacking gel and can be seen stained in the well of the stacking gel The products stained with Coomassie blue hence represent the monomers that are small enough to enter the stacking gel and resolved 3.2.3 Free radical scavenging The antioxidant abilities of the various drugs can be elucidated using the ABTS (2,2'azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) assay In the presence of potassium persulfate, ABTS (Sigma-Aldrich) is converted into a radical cation that absorbs light at 734 nm Upon the addition of antioxidants, the green ABTS solution is converted back to the colourless neutral form that may be tracked by a UV spectrophotometer (Shimadzu) Drugs are pre-diluted to a 100X stock in distilled water 10 µl of pre-diluted drugs were added to 990 µl of ABTS radical solution to obtain final concentrations ranging from µM to 1000 µM Vitamin C is used as a standard to compare between the antioxidant capacities After a three-minute incubation, the 57 MATERIALS AND METHODS absorbance is read at 734 nm The Trolox equivalent antioxidant capacity (TEAC) is calculated by the following formula: TEAC = (AbsABTS- Absdrug- Abssample blank) / (AbsABTS - AbsStandard) 3.2.4 Statistical analysis Data are presented as the mean ± SEM obtained from multiple experiments Differences between mean values of multiple groups were analyzed by one-way analysis of variance (ANOVA) followed by Bonferroni’s test performed using SPSS 11.5 Statistical significance was considered at p less than 0.05 58 MATERIALS AND METHODS 3.3 Cell culture studies 3.3.1 Chemicals All chemicals were bought from Sigma-Aldrich Co (St Louis, USA) unless otherwise stated SPRC was synthesized as previously described (38) and SAC was purchased from Kasei Kogyo Co Ltd (Tokyo, Japan) Both drugs were dissolved fresh in serum-free medium (SFM) as 100X stock solutions and added to the cells to obtain the final concentrations of µM for Part II and 10 µM for Part III Sodium hydrosulfide (NaHS) was dissolved as a 100X stock solution in SFM immediately before addition to the cells to obtain a final concentration of 10 µM in Part III Aβ25-35 peptides (GL Biochem, Shanghai, China) were dissolved in distilled water as 100X stock solutions and incubated in 4°C or 37°C for 24 hours to attain the aggregated state Aggregated Aβ was vortexed thoroughly and added to the cells to a final concentration of µM All antibodies were obtained from Santa Cruz Biotechnology Inc., USA unless otherwise stated 3.3.2 Cell culture The C6 astroglioma cell line (American Type Culture Collection #CCL-107) was a generous gift from Professor Peter Wong (National University of Singapore) The cells were routinely grown in Dulbecco’s modified Eagle’s medium (Gibco, Grand Island, NY, U.S.A) supplemented with 10% fetal bovine serum (Hyclone, Irvine, CA, U.S.A.), 1% 10,000 units/ ml penicillin and 10,000 µg/ml streptomycin mixture (Gibco, Grand Island, New York) The cells were maintained in a humidified environment at 37°C, 5% CO2 and 95% air, sub-cultured in a 1:4 ratio every two days 59 MATERIALS AND METHODS 3.3.3 MTT assay C6 cells were plated at a density of 7000 cells per well in a 96-well plate (Nunc A/S, Roskilde, Denmark) Measurement of cellular 3-[4,5-dimethylthiazol-2-yl]-2,5diphenyltetrazolium bromide (MTT) (Merck, Darmstadt, Germany) reduction was carried out Following the appropriate incubation time with the peptide, MTT was added to a final concentration of 0.5 mg/ml, and incubation was continued for a further hours at 37°C Dimethyl sulfoxide was then added and mixed thoroughly before colorimetric determination of MTT reduction was made at 570 nm using the microplate reader (TECAN, Männedorf, Switzerland) Cell viability was expressed as % control group ± standard error of means (S.E.M) 3.3.4 H2S pathway 3.3.4.1 Measurement of H2S Concentration in Culture Medium H2S concentrations were measured in the culture medium as described previously (297) Briefly, the cells were plated at a density of x 105 cells in a 60 mm-wide coated petri dish (Becton-Dickinson, San Jose, CA, U.S.A) 500 µl of cell culture medium was collected and used for the assay immediately after the appropriate incubation periods and the assay was carried out immediately The absorbance of the resulting solution at 670 nm was measured with a spectrophotometer (TECAN, Männedorf, Switzerland) in a 96-well plate All samples were assayed in triplicate and the concentrations of the solutions were calculated against a calibration curve using sodium hydrosulfide (3.125 - 250 µM) Results of the H2S concentration in the culture medium are shown as fold increase ± SE compared to the control group 60 MATERIALS AND METHODS 3.3.4.2 Treatment with CBS inhibitor The CBS inhibitor aminooxyacetate acid (AOAA) was dissolved fresh in SFM and sequentially diluted The AOAA solutions were prepared as a 100X stock solution and added to the cells to obtain the required concentrations The effects of AOAA on cell viability were elucidated using the MTT assay 3.3.5 Western blot Total cell lysates were extracted from 1.5 x 106 cells per group using 200 µl of CellLytic Buffer and 1% protease inhibitor The supernatant was collected after centrifugation at 14,000 g for ten minutes and protein concentrations were quantified using the QuickStart Bradford Dye (Bio-Rad Laboratories, Hercules, CA, U.S.A) by spectrophotometric measurement at 595 nm To detect protein levels, 20 µg of total cell lysates from each group were subjected to SDS-PAGE analysis with 12.5% (wt/v) acrylamide gel and transferred onto a polyvinylidene fluoride membrane (Pall Corporation, Ann Arbor, MI, U.S.A) The non-specific proteins on the membranes were blocked in 5% albumin bovine serum or 3% non-fat dry milk dissolved in phosphate-buffered saline and 0.1% Tween-20 for one hour at room temperature Immunoblotting was then performed overnight in 4°C using the different antibodies: i) β – tubulin (1:1000, Sigma-Aldrich Co.); ii) Rabbit anti-rat CBS antibody (generated in our own lab); iii) Superoxide dismutase (SOD) (1:500); iv) Catalase (1:500); v) Glutathione peroxidase (GPx) (1:500); vi) PARP1/2 (1:1000); vii) Pro-caspase (1:1000); viii) LC3 (1: 500, Cell Signaling Technologies, MA, U.S.A) The membranes were then incubated with the appropriate secondary horseradish peroxidase-conjugated anti-mouse IgG antibody (1:10000) and anti-rabbit IgG antibody (1:10000).The membranes were done in triplicates and visualized using an enhanced 61 MATERIALS AND METHODS chemiluminescent system (Pierce, Rockford, IL, U.S.A) and developed on X-ray films (Pierce, Rockford, IL, U.S.A) Expression of the different proteins was then quantified using the QuantityOne software (Bio-Rad Laboratories, Hercules, CA, U.S.A) 3.3.6 Reactive oxygen species (ROS) generation 3.3.6.1 Measurement of ROS production The rate of ROS production was measured in triplicates by a fluorescence assay using 2’,7’-dichlorofluorescein-diacetate (DCFH-DA) (Invitrogen, Oregon, U.S.A) as a probe µl of 50 mg/ml DCFH-DA freshly dissolved in SFM was added to each well in a 96-well plate and incubated for one hour After which, the fluorescence intensity was measured per minute for a total of ten minutes at 485 nm excitation and 530 nm emission using a microplate reader (TECAN, Männedorf, Switzerland) Results were expressed as percentage rate of ROS production (Relative Fluorescence Units/min) ± S.E.M, as compared to the control group 3.3.6.2 Fluorescence emission by dihydroethidium ROS production was visualized using fluorescence emission by dihydroethidium (DHE) Briefly, cells were plated at a density of x 105 cells in a glass-base 35 mm-wide petri dish (Nunc A/S, Roskilde, Denmark) DHE solution was added to the cells after the treatment periods to a final concentration of µM and incubated for one hour The cells were washed and immediately visualized with a confocal microscope (Olympus Fluoview FV1000, UK) The images were taken randomly in triplicates and were further analyzed using the ImageJ software (National Institutes of Health, U.S.A) to quantify the fluorescence The results were expressed as fold difference of RFU compared to control ± S.E.M 62 MATERIALS AND METHODS 3.3.6.3 Measurement of SOD activity Total SOD activity was assayed according to the method as previously described (298) Briefly, total proteins were extracted and SOD activity was assayed by the inhibition of pyrogallol autoxidation, measured spectrophotometrically using a microplate reader at 420 nm (TECAN, Männedorf, Switzerland) Results were expressed as percentage of the amount of protein needed to result in 50% inhibition of pyrogallol ± S.E.M, as compared to the control group 3.3.6.4 Measurement of catalase activity Total catalase activity was assayed according to the method previously described (299) Briefly, total proteins were extracted and catalase activity was assayed by the decomposition of H2O2 The rate of decomposition of H2O2 was measured spectrophotometrically using a microplate reader at 230 nm (Thermo Scientific Varioskan Flash, Waltham, U.S.A) One unit of catalase activity is defined as mmol of H2O2 decomposed per minute Catalase Activity (U/mg) = [ ∆A230 / E ] ÷ [ TP × 10 ] where E = millimolar extinction coefficient of H2O2 (mM-1cm-1) = 0.071 and TP = total protein concentration (µg/µL) Results were expressed as percentage of catalase activity ± S.E.M, as compared to the control group 3.3.6.5 Measurement of glutathione peroxidase activity Total glutathione peroxidase activity was assayed according to the method previously described (300) Briefly, total proteins were extracted and glutathione peroxidase activity was assayed by monitoring the oxidation of NADPH The change was monitored spectophotometrically using a microplate reader at 340 nm (TECAN, Männedorf, Switzerland) 63 MATERIALS AND METHODS Results were expressed as the amount of NADPH oxidized per mg protein (µmol NADPH/min/mg protein) ± S.E.M 3.3.7 Inflammation 3.3.7.1 Real-time PCR Total RNA from cultured C6 glioma cells was isolated by using Trizol reagent (Invitrogen, Oregon, U.S.A) according to the manufacturer’s instructions RNA was quantified spectrophotometrically by measuring the optical density of samples at 260/280 nm using the Nanodrop Spectrophotometer µg of RNA was reverse-transcribed and then subsequently amplified in a one-step process using the Quantitect SYBR Green RT-PCR Kit (Qiagen Singapore) on a Corbett Lightcycler system Expressions of IL-1β, IL-6, IL-10 and TNF-α were determined and the relative differences in expression between groups were expressed using cycle time (Ct) values as follows: the Ct values of the gene of interest were first normalized with GAPDH of the same sample, and then the relative differences between control and treatment groups were calculated and expressed as relative increases ± S.E.M, setting the control as 100% Three duplicates were performed The primers used for real-time PCR were as previously reported and shown in Table Gene Primer GAPDH Forward 5’- CACCTCTCAAGCAGAGCACAG -3’ Reverse 5’- GGGTTCCATGGTGAAGTCAAC -3’ Forward 5’- CACCTCTCAAGCAGAGCACAG -3’ Reverse 5’- GGGTTCCATGGTGAAGTCAAC -3’ IL-1β Sequence Source Neuroscience Letters 2006; 398:28–33 J Cereb Blood Flow Metab 2002 Sep; 22 (9):1068-79 64 MATERIALS AND METHODS IL-6 5’- GGCAACTGGCTGGAAGTCTCT -3’ Forward 5’- GGTTGCCAAGCCTTATCGGA- 3’ Reverse 5’- ACCTGCTCCACTGCCTTGCT- 3’ Forward 5’- CCAGGAGAAAGTCAGCCTCCT- 3’ Reverse TNF-α 5’- CGAAGTCAACTCCATCTGCC -3’ Reverse IL-10 Forward 5’- TCATACCAGGGCTTGAGCTCA- 3’ J Neurosci 2004; 24 (39) :8595-605 Cytokine 1999; 11 (4):305-12 J Cereb Blood Flow Metab 2002; 22 (9):1068-79 Table 2: Primer sequences for various inflammatory genes used in RT-PCR The sources of the sequences were also cited in the rightmost column 3.3.7.2 Enzyme-linked immunosorbent assay (ELISA) Levels of inflammatory factors secreted into the cell culture media were analysed by ELISA Culture media of each treatment group was collected after treatment periods, pooled and subsequently concentrated using the MivecDuo Concentrator before carrying out the assay The levels of IL-1β, IL-6, IL-10 and TNF-α were measured using commercially available kits (R&D Systems, Minneapolis, U.S.A) according to the manufacturer’s instructions Final results were expressed as pg of cytokine/ mL media ± S.E.M 3.3.8 Cell Death Mechanisms 3.3.8.1 TUNEL Staining TUNEL staining was carried out using the DeadEnd Fluorometric TUNEL System (Promega, Wisconsin, U.S.A), according to the protocol provided by the manufacturer Briefly, cells were grown in a 4-well chamber slide (Thermo Fisher Scientific, Waltham, U.S.A) or with a coverslip (22 mm x 22 mm) implanted in a 35mm-petri dish (BD, New Jersey, U.S.A) The media was removed after treatment time points and washed twice with phosphate buffer The 65 MATERIALS AND METHODS cells were fixed with 4% paraformaldehyde followed by a cell permeabilization step using 0.2% Triton-X-100 After which, the cells were incubated with the labeled nucleotides and terminal deoxynucleotidyl transferase mix at 37°C for at least one hour The reaction was stopped by 2X SSC buffer provided in the kit and mounted with µM DAPI solution The slides were analysed immediately using confocal microscopy (Olympus Fluoview FV1000, UK) The images were taken randomly in triplicates and were further analyzed using the ImageJ software (National Institutes of Health, U.S.A) to quantify the fluorescence The results were expressed as green/blue fluorescence compared to control ± S.E.M 3.3.8.2 Acridine Orange Staining Cells were cultured in 4-well chamber slides and treated as described The cells were washed twice by PBS before incubating with 500 µl of Buffer A (20mM citrate phosphate, 0.1 mM EDTA, 0.2M sucrose, 0.1% Triton X-100) for ten minutes The cells were then stained at room temperature with acridine orange solution diluted with 500µl Buffer B (10 mM citrate phosphate, 0.1 M sodium chloride) to a final concentration of µg/ml After incubation for ten minutes in the dark, the cells were observed and photographed by confocal microscopy (Olympus Fluoview FV1000, UK) The images were taken randomly in triplicates and were further analyzed using the ImageJ software (National Institutes of Health, U.S.A) to quantify the orange and green fluorescence The results were expressed as proportion of orange/green fluorescence ± S.E.M 66 MATERIALS AND METHODS 3.3.9 Transmission electron microscopy Samples were fixed in 2.5% glutaraldehyde in 0.1 mM PBS at 4°C for hour before osmication with 1% osmium tetroxide, pH7.4 for one hour Subsequently the samples were dehydrated through an ascending series of ethanol at room temperature Infiltration with acetone and resin were carried out and the samples were embedded in resin polymerised at 60°C for 24 hours Samples were cut by an ultra-microtome (Leica Microsystems, GmbH Wetzlar, Germany), mounted on formvar-coated copper grids and doubly stained with uranyl acetate and lead citrate The grids were then viewed in a Philips CM120 BioTWIN transmission electron microscope (Philips) 3.3.10 Statistical analysis Data were presented as the mean ± S.E.M obtained from multiple experiments Differences between mean values of multiple groups were analyzed by one-way analysis of variance (ANOVA) followed by Bonferroni’s test performed using SPSS 11.5 Differences compared to the control groups only were carried out using Student’s t-test using Microsoft Excel Statistical significance was considered at p less than 0.05 67 ... neuro-inflammation SPRC repressed LPS -induced increase in mRNA and protein expressions of APP, as well as hippocampal Aβ levels Moreover, SPRC administration also decreased TNF-α levels and expressions... drugs on DNA fragmentation using TUNEL staining Figure 37 : Effects of pre-treatment of drugs on PARP and pro-caspase expressions in cell lysates Figure 38 : Effects of pre-treatment of drugs on. .. Effects of pre-treatment of drugs on DNA fragmentation using TUNEL staining Figure 60: Effects of pre-treatment of drugs on PARP and pro-caspase expressions in cell lysates Figure 61: Effects of pre-treatment