Modulation of nuclear factor b signaling attenuates allergic airway inflammation 3

2 Rationale and objective 75 Rational and objective Globally 300 million people suffer from asthma and the prevalence of asthma still continues to increase (Pawankar et al., 2012) Asthma is a multifactorial disease, involving a complex network of molecular and cellular interaction In addition to genetic predisposition, environmental factors also mediates the initiation and development of asthma (von Mutius, 2009) Current therapies for asthma generally rely on SABAs or LABAs and inhaled corticosteroids Although these current therapies are relatively effective at controlling symptoms, these therapies not change the chronic course of disease In addition, major concerns about the systemic effects of inhaled corticosteroids remains Furthermore, around 15% of asthmatic patients who suffer from uncontrollable asthmatic symptoms fail to respond well to inhaled corticosteroids Currently, there is no established method to prevent asthma Therefore, the major unmet needs of this area include better management of the severe forms of the disease and the developments of curative therapies (Akdis, 2012) Consequently, much research has been done to better understand the pathophysiology of asthma and to explore novel therapies for this asthma One attractive target for therapeutic intervention would be the NF-κB signaling pathway, which plays an important role in Th2-mediated inflammation (Edwards et al., 2009) Thus, the development of specific inhibitors targeting NF-κB signaling pathway is promising for attenuating allergic airway inflammation Nonetheless, direct inhibition of NF-κB may not be a safe approach because NF-κB plays a pivotal role in numerous normal biological functions and pathological conditions Therefore, a safer and yet effective anti-inflammatory approach for attenuation of allergic airway inflammation would be through appropriate and specific inhibition of signaling molecules which regulate the activation of NF-κB (Uwe, 2008) Rip-2 has been shown to mediate the formation of functional IKK complex, which is essential for NF-κB activation; while RPS-3 has been demonstrated to enhance the binding of NF-κB 76 to the κB sites of selected NF-κB targets Fisetin, on the other hand, is a natural product that has been reported to interfere with the activity of NF-κB pathway The objectives of my project are to examine the potential anti-inflammatory effects of Rip-2 siRNA, RPS-3siRNA, and fisetin, a bioactive flavonol in mouse asthma model or TNF-α stimulated lung cell lines and investigate their effects in the regulation of NF-κB pathway Future aims include developing efficacious therapies which are easy to comply with and have minimal systemic side effects 77 Materials and methods 78 3.1 Materials and Reagents Drugs and chemicals used in this Ph.D project are as follows: Bicinchonic acid (BCA) protein assay kit, calf bovine serum (CBS); custom control siRNA; fetal bovine serum (FBS); M-PER Mammalian Protein Extraction Reagent containing phosphatase inhibitor; ONTARGETplus Receptor interacting protein (Rip)-2 small interfering RNA (siRNA); ONTARGETplus Rip-2 siRNA with in vivo processing; ON-TARGETplus Ribosomal protein (RP)S3 siRNA, RestoreTM PLUS western blot stripping buffer; and X Sybrgreen master mix were obtained from Thermo Scientific, Waltham, MA, USA Acetyl-β-methylcholine chloride; aluminium hydroxide (Al(OH)3; bovine serum albumin (BSA); chicken ovalbumin (OVA), dimethyl sulfoxide (DMSO); eosin Y, fisetin; G418; harris hematoxylin solution; 10% neutral buffered formalin; skim milk powder; tissue culture grade 10 X phosphate buffered saline (PBS); tween-20 were obtained from Sigma-Aldrich, St Louis, MO, USA Ammonium chloride (NH4Cl) was obtained from BDH Laboratory Supplies, Poole, England Agarose; alkaline phosphatise (AP) conjugated substrate kit; blotting paper, polyvinylidene difluoride (PVDF) membrane; tetramethylbenzidine (TMB) substrate kit; tetramethylethylenediamine (TEMED); and 3,3’,5,5’- Triton X-100 were obtained from Bio-Rad laboratories, Hercules, CA, USA) NF-κB/Secreted alkaline phosphatase (SEAP) gene reporter assay kit was obtained from Imgenex, San Diego, CA, USA Anti-β-actin monoclonal antibody, anti-mouse Rip-2 monoclonal antibody, anti-human RPS-3 monoclonal antibody were obtained from Abcam, Cambridge, UK Diethylpyrocarbonate (DEPC)-treated water; Dulbecco’s modified Eagle medium (DMEM) with 4.5 g/L glucose; Lipofectamine 2000; optimum I reduced serum medium; Recombinant human tumor necrosis factor (TNF)-α; Roswell Park Memorial Institute (RPMI) Medium; RNAlater; TRIzol; trypan blue were obtained from Invitrogen, Carlsbad, CA, USA Anesthetic mixture (10 µl/g ketamine: medetomidine: H2O = 3:4:3); Sterile NaCl 0.9% were obtained from Animal Holding Unit AHU (NUS, Singapore) Aerosolised isofluorane was obtained from Halocarbon, NJ, USA Fetal bovine serum (FBS) was obtained from Hyclone Laboratories, South Logan, Utah, USA) Sodium dodecyl sulfate 79 (SDS) and tris-acetate-EDTA (TAE) were obtained from 1st BASE, Singapore) Anti-mouse IL-13 monoclonal antibody; biotinylated anti-mouse IL-13 antibody; recombinant murine IL13, anti-mouse eotaxin; biotinylated anti-mouse eotaxin; and recombinant mouse eotaxin (R&D Systems, Minneapolis, MN, USA), Avidin-horseradish peroxidise (HRP); biotinylated anti-mouse IgE; biotinylated anti-mouse OptEIA™ mouse IFN-γ set, biotinylated anti-mouse OptEIA™ IgG1; biotinylated antimouse IgG2aOptEIA™ mouse; total IgE set; OptEIA™ mouse IL-4 set; OptEIA™ mouse IL-5 set, OptEIA™ mouse IL-33 set, OptEIA™ human IL6 set; and OptEIA™ human IL-8 set were obtained from BD Biosciences Pharmingen, San Diego, CA, USA Fluoresave was obtained from Calbiochem, Billerica, MA Sodium carbonate (Na2CO3) was obtained from Kanto Chemical, Tokyo, Japan Absolute ethanol; isopropanol; methanol; 1% periodic acid were obtained from Merck, Darmstadt, Germany HistoClear, and Histomount were obtained from National Diagnostics, Atlanta, GA, USA); Avian myeloblastosis virus (AMV) reverse transcriptase; dNTP mix; polymerase chain reaction (PCR) master mix; and ribonuclease inhibitor were obtained from Promega, Madison, WI, USA Anti-IκBα monoclonal antibody; anti-p65 monoclonal antibody were obtained from Cell Signaling Technology, Beverly, MA, USA Enhanced chemiluminescent (ECL) western blotting detection reagents; and hyperfilm were obtained from GE Healthcare, Piscataway, NJ, USA HRP-conjugated anti-mouse Ig; HRP-conjugated anti-rabbit Ig; APconjugated anti-mouse Ig; and AP-conjugated anti-rabbit Ig were obtained from Dako, Glostrup, Denmark Human MUC5AC ELISA Kit was obtained from USCN, Houston, Texas, USA Nuclear extract kit and TransAM™ NF-κB p65 Kit were obtained from ActiveMotif, Carlsbad, CA, USA 80 3.2 siRNA preparation 3.2.1 ON-TARGETplus siRNA without in vivo processing ON-TARGETplus siRNA complementary to mouse Rip-2 or RPS-3 mRNA were purchased from Thermo Scientific (Waltham, MA) Table 3.1 shows the sequences of siRNA used A stock solution of siRNA (20 µM) was prepared by dissolving every nmole of siRNA in 250 µl of x PBS Briefly, the resuspended siRNA was pipette up and down for three to five times Extra care was taken to avoid introduction of bubbles The siRNA was then vortex for 30 mins at room temperature Following that, the dissolved siRNA was aliquoted into small volumes and stored at -30oC The aliquots were limited to freeze-thaw events of no more than five 3.2.2 ON-TARGETplus siRNA with in vivo processing ON-TARGETplus siRNA with in vivo processing complementary to mouse Rip-2 with sequence S2 (Table 3.1) was dissolved in tissue culture grade X PBS (Sigma-Aldrich, St Louis, MO) Every nmole of siRNA was dissolved in 30 µl of tissue culture grade X PBS Following steps taken to dissolve the siRNA is similar to that listed for ON-TARGETplus siRNA without in vivo processing 3.3 siRNA transfection The mouse macrophage cell line RAW264.7, mouse fibroblast cell line NIH/3T3 (American Type Culture Collection, Rockville, MD) and NF-κB/ secreted alkaline phosphatase (SEAP) human embryonic kidney (HEK)293 cell line (IImgenex, San Diego, CA) were maintained in Dulbecco's modified Eagle medium (DMEM) with 4.5 g/L glucose (Invitrogen, Carlsbad, CA) In order to maintain the selection of SEAP transfected HEK293, selection agent G418 (Invitrogen, Carlsbad, CA) was added to the maintaining medium The human bronchial epithelial cell line BEAS2B and human pulmonary mucoepidermoid carcinoma cell line NCI- 81 siRNA Sequence Mouse Rip-2 Sequence (S1) Mouse Rip-2 Sequence (S2) Mouse Rip-2 Sequence (S3) Human RPS-3 Control 5’-GCUCGACAGUGAAAGAAAU-3’ 5’-ACGAGAAGCCGAAAUA UUA-3’ 5’-CAAAUUUCCCUCAGAAUAA-3’ 5’-UAGUUAACAGGGUCUCCGCUU-3’ 5’-UUCUCCGAACGUGUCACGU-3’ Table 3.1: Sequences of siRNA 82 292 (American Type Culture Collection, Rockville, MD) were maintained in RPMI (SigmaAldrich, St Louis, MO) These cell lines were seeded at 60 to 70 % confluency in antibioticsfree media one day before transfection During transfection, the cells were maintained in GIBCO ™ optimum I reduced serum medium (Invitrogen, Carlsbad, CA) The cells were then transfected with 100 nM siRNA or negative siRNA control – h at 37°C in OptiMEM (Invitrogen, Carlsbad, CA) containing Lipofectamine 2000 (Invitrogen, Carlsbad, CA) After transfection, the cells were allowed to recover in complete DMEM or RPMI for 18, 42, or 66 h before they were analysed for Rip-2, IL-6, IL-8, MUC5AC, and TSLP mRNA and their protein expression NCI-H292 is a human pulmonary mucoepidermoid carcinoma cell line This cell line produces MUC2, MUC4 and MUC5AC, which is a major component of mucin that contributes to the viscosity of mucous Mucin protein synthesis by H292 can be stimulated by TNF-α or EGF Therefore, NCI-H292 is commonly used to study signaling pathway involved in mucus hypersecretion (Lora et al., 2005; Zhen et al., 2007) and is consequently used in this study On the other hand, BEAS2B is a human bronchial epithelial cell line that is developed by transformation of normal human bronchial epithelial cells The transformation involved adenovirus 12-simian virus 40 hybrid virus (Ad12SV40) BEAS-2B form tight junctions but retain the ability to undergo squamous differentiation in response to serum BEAS-2B cells have been used to study pulmonary inflammatory response in a large number of studies (Verstraelen et al., 2008) Therefore, BEAS-2B was used in this study 3.4 Mouse asthma model and treatments Female BALB/c mice, 6-8 wk of age (Interfauna, East Yorkshire, UK) used in this project were ordered from centre for animal resources and housed in plastic cages (maximum mice/cage) in Animal Holding Unit in the National University of Singapore (NUS) according to the spirit of Good Laboratory Practice Animal experiments were performed according to the Institutional Guidelines for Animal Care and Use Committee of the NUS Briefly, animal 83 rooms were regulated by automatic timers to provide cycles with 12-14 h of light and 10-12 h of dark The temperature in the animal room ranged from 18 °C to 26 °C with an average temperature of 22 °C Standard diets generally contained 4-5 % fat and 14% protein A minimum of days of acclimatization were given to the mice to adapt to their new surroundings Cage bedding was changed thrice a week Mice were sensitized with 20 µg OVA and mg Al(OH)3 in 0.1 ml saline intraperitoneally on day and day 14 For OVA Challenge, 0.15 g of OVA was dissolved in 15 ml of saline to be aerosolized by a DeVilbiss Ultra-Neb Large-Volume Ultrasonic Nebulizer (Sunrise Medical Respiratory Products, Somerset, PA) (Figure 3.2) Mice were then challenged with 1% OVA aerosol for 30 in a chamber on days 22, 23 and 24 (Figure 3.2) Average OVA aerosol particle size was less than µm Saline aerosol was used as a negative control Female BALB/c mouse was used because airway inflammation and AHR are easily induced in this mouse strain Furthermore, female mice displayed higher serum IgE level and are more susceptible to airway inflammation than male mice (Melgert et al., 2005) Also, OVA rather than HDM model was used at the point of study because of the following reasons: (1) OVA does not occur as an allergen naturally, so it is easy to prevent the mice from OVA exposure prior to sensitisation; (2) OVA model is more well-characterised than HDM model in terms of the participation of various leukocytes; and (3) OVA model allows the sensitisation period and activation of inflammatory response to be completely discerned (Blanchet et al., 2012; Brewer et al., 1999) Nonetheless, given the model’s growing popularity, it is likely that the detailed knowledge of the immunopathology induced by HDM will soon become equivalent to that of the OVA model (Blanchet et al., 2012) ON-TARGETplus Rip-2 siRNA or control siRNA were prepared as mentioned in section 3.2.2 For drug treatment, Rip-2 siRNA also diluted to nM using 1X PBS (tissue culture grade) The mice were anesthetized with aerosolised isofluorane (Halocarbon, NJ, USA) before Rip-2 siRNA (1 and nmol) or control siRNA in 30 µl 1X PBS was administered 84 H&E staining was performed to measure the severity of cell infiltration For H&E staining, slides were deparaffinized with HistoClear for 10 and rehydrated in a serial concentrations of ethanol (100% 90% 70% water) for each The sections were then stained with Harris haematoxylin for min, then washed in the distilled water, and differentiated in 0.1 % acid alcohol solution for 30 sec The sections were washed with tap water for and counter stained with Eosin for minute Finally, the sections were dehydrated in serial concentrations of ethanol solutions (70% 90% 100%) for 30 sec each before they were immersed in HistoClear for 10 minute Evaluation of inflammation around peribronchial and perivascular areas was semi-quantitatively performed in a single-blind manner as previously described (Myou et al., 2003) A subjective scale (0 - 4) was assigned as follows: 0: no inflammatory cells; 1: occasional cuffing with few inflammatory cells; 2: most bronchi or vessels surrounded by a thin layer of inflammatory cells; 3: most bronchi or vessels surrounded by a thick layer (2 - cells layer deep) of inflammatory cells; 4: most of bronchi or vessels surrounded by a thicker layer (more than cells layer deep) of inflammatory cells Periodic acid-fluorescence Schiff staining (PAFS) was performed to determine the extent of mucus production PAFS allows visualization of mucus through covalent bonding of sulfited acriflavine to mucin glycoconjugates Mucin granules emit red fluorescence when excited at 380-580 nm and observed at 600-650 nm using a confocal microscope (Leica TCS SP5, Leica Microsystems, Deerfield, IL, USA) Noncovalent linkage of acriflavine to nucleic acid, nuclei and cytoplasm results in green fluorescence when excited at 380-500 nm and observed at 450475 nm (Evans et al., 2009) Briefly, the slides were deparaffinized with HistoClear for 10 and rehydrated in a serial concentrations of ethanol (100% 90% 70% deionised water) and each for The sections were immersed in % periodic acid (Merck, Darmstadt, Germany) for 10 then thrice in distilled water for The subsequent steps were carried out in the dark The sections were treated with Schiff reagent for 20 min, and then washed in running tap water for before being dipped in % acid alcohol for 89 twice, which is the differentiation step After differentiation, the sections were washed in running tap water again for Finally, the sections were dehydrated in serial concentrations of ethanol solutions (70% 90% 100%) for 30 sec each before they were immersed in HistoClear for 10 The slides were left to dry in the dark before they were mounted with Fluoresave (Calbiochem, Billerica, MA) Mucus production by goblet cells in the airway epithelium was assessed blinded and scored based on a point grading system (Tanaka et al., 2001) According to the percentage of area covered by mucus within the bronchi rings, score (0-4) were assigned: 0, no goblet cells; 75% This same scoring system was adopted from the H&E staining In both H&E and PAFS staining, bronchioles with the maximum internal diameter twice the minimum internal diameter were excluded from the analysis The scoring for inflammatory cell infiltration and mucus secretion was performed in – preparations of each mouse The mean scores were calculated from – mice per treatment group 3.8 AHR measurement In this project, AHR was measured in mouse asthma model The mouse asthma model of allergen-induced AHR is widely used because the immunology of the mice is well described and many immunological tools and genetically altered strains are available The methods to assess AHR in mice vary There are two commonly used approaches —non-invasively, by barometric plethysmography of unrestrained mice; or invasively, by measuring lung resistance in anesthetized, trachesotomized mice The latter method was used in this project because it imposes no stress on the anesthetized mouse and the inhalation exposure is focused to the lungs Furthermore, it establishes gold standard parameters Also the invasive method provides a direct measurement of the changes in pulmonary resistance (Rl) and dynamic compliance (Cydn) in response to increasing concentration of inhaled methacholine Rl measures the resistance pressure in airway divided 90 by the flow; Cydn measures the volume changes to the concomitant elastic recoil pressure changes between end inspiration and expiration (Busse, 2010) To measure of AHR, Buxco’s modular system was used in our study Mouse AHR was assessed by measuring the changes of two parameters — airway resistance (Rl) and dynamic compliance (Cdyn) — in response to increasing concentration of nebulized methacholine (0.5-8.0 mg/ml; Sigma-Aldrich, St Louis, MO) recorded using a whole-body plethysmograph chamber (Buxco, Sharon, CT) RI (∆P/V) is defined as the pressure driving respiration divided by air flow; while Cdyn (∆V/∆P) is defined as the distensibility of the lung during a change in volume relative to an applied change in pressure Figure 1.10 shows the setup of the apparatus in the experiment AHR was measured 24 h after the last saline or OVA challenge Mice were anaesthetized by an intraperitoneal injection of 200 µl of an anesthetic mixture (ketamine: medetomidine: H2O = 3: 4: 33, Parnell, Alexandria NSW, Australia & Pfizer, Auckland, New Zealand) After the mice have been anesthetized, tracheotomy was performed where a small transverse incision was made on the exposed trachea The mouse was placed on a warming bed in the whole body plethysmograph chamber and the trachea was connected to a Y shape cannular and attached to a pneumotach, ventilator, and nebuliser Mice were challenged with aerosolised methacholine for Methacholine was prepared by dissolving acetyl-β-methylcholine (Sigma-Aldrich, St Louis, MO) in 1X PBS Bronchoconstriction was recorded for an additional for every increasing dose of methacholine Results were expressed as a percentage of the respective basal values in response to X PBS 91 Figure 3.3 Invasive system (Taken from Cheng, 2011) (A) Whole body plethysmograph; (B) Ventilator for supplying air to the tracheostomized mouse and for acquiring data; and (C) Nebulizer for aerosolizing methacholine to the mouse in the plethysmograph 92 3.9 Lymphocyte antigen recall experiments Thoracic lymph nodes (3-4 nodes per mouse) were extracted from the mice (n = per group) The isolated lymph nodes were passed through cell strainers to prepare a single-cell suspension The single cell suspension was then cultured at x 106 cells/ml in RPMI 1640 medium supplemented with mM L-glutamine, 100 IU/ml antibiotics, 25 mM HEPES buffer, and 10 % fetal calf serum (FCS) The cultured cells were stimulated with or without 200 µg/ml OVA; Con-A (10 µg/ml) was set as a positive control Concanavalin A is known for its ability to stimulate mouse T-cell and cause T-cells to release an array of cytokines and chemokines Concanavalin A serves as a positive control to check that the T-cells are viable and capable of secreting cytokines Supernatant from parallel triplicate cultures were harvested 72 h after OVA stimulation for cytokine analysis 3.10 Enzyme-linked immunosorbent assay (ELISA) 3.10.1 Cytokines and chemokine levels in BALF or cell culture supernatant Levels of mouse IL-4, IL-5, IL-13, IL-33, IFN-γ, and eotaxin in the BALF supernatant and levels of human IL-6 and IL-8 from cell culture supernatant were measured by ELISA (BD Biosciences Pharmingen, San Diego, CA, USA for mouse IL-4, mouse IL-5, mouse IL-33, human IL-6, and human IL-8; R&D Systems, Minneapolis, MN, USA for mouse IL-13, mouse eotaxin, and mouse IFN-γ) according to the manufacturer’s instructions Briefly, 50 µl of diluted capture antibody (diluted to the appropriated concentration in relevant coating buffer) was coated onto every well of the ELISA plate (NUNC, Denmark) The plate was sealed with parafilm and incubated overnight at 4°C After the antibody has been coated onto the wells of the plate, the coating buffer was aspirated and the plate was washed with wash buffer (PBS with 0.05% Tween-20) to remove unbound antibody The plate was then blocked with 200 µl assay diluent buffer (1X PBS with 10% heat inactivated FBS) for h After h, the plate was washed and 50 µl of standards or BALF samples were added and incubated for h at room temperature After incubation, the plate was washed and incubated with biotinylated detection antibodies and streptavidin-HRP conjugates for another one to h 93 Subsequently, HRP substrate solution was added to every well of the washed plate and incubated for another 30 in the dark The reaction between HRP and HRP substrate was stopped by adding 50µl of M H2SO4 Finally, the plate was read at 450 nm (reference filter 570 nm) using an automatic microplate reader (Sunrise Tecan, Austria) The detection limits were pg / ml for 1L-4 and IL-5; 15.6 pg/ml for IL-12, IL-13, and IFN-γ; and pg/ml of eotaxin 3.10.2 Immunoglobulin (Ig) levels in serum Cardiac puncture was performed to collect blood from the mouse 24 h after the last OVA or saline challenge Blood collected was left at clot for 3h at room temperature In order to harvest the serum, the blood was subjected to centrifugation at 3000 rpm for at oC Serum was harvested from the top layer of the supernatant and stored at -80 oC for further analysis Serum level of total IgE, OVA-specific IgE, OVA-specific IgG1 and OVA-specific IgG2a were assayed using ELISA kits (BD Biosciences Pharmingen, San Diego, CA, USA total IgE; R&D Systems, Minneapolis, MN, USA OVA-specific IgE, IgG, and IgG2a) ELISA plates were incubated with IgE capture antibody or 20µg/ml OVA coating buffer (OVA-specific ELISA) The steps that follow were similar as that for cytokine ELISA The detection limit was ng/ml for total IgE 3.10.3 MUC5AC level in cell lysate RPS-3 siRNA transfected NCI-H292 and BEAS-2B were stimulated with 50 ng/ml of TNF-α for 24 h, as performed by Lora et al., 2005, and harvested using lysis buffer M-PER Mammalian Protein Extraction Reagent The protein harvested was quantified using bicinchoninic acid (BCA) protein assay kit Levels of human MUC5AC in the cells were measured by ELISA (USCN, Houston, Texas, USA) according to the manufacturer’s instructions Antibody specific to MUC5AC was already coated on the microtiter plate provided in the kit 100 µl of standards or 50 µg of proteins per cell lysate were added to the appropriate microtiter plate wells and topped up to 100 µl with assay diluent then incubated for h Following that, biotin-conjugated antibody preparation specific for MUC5AC and 94 Avidin conjugated to Horseradish Peroxidase (HRP) were added to each microplate well and incubated After incubation, TMB substrate solution was added to each well Only wells that contain MUC5AC turn blue The amount of MUC5AC present was proportional to the intensity of the blue The enzyme-substrate reaction was terminated by the addition of stop solution The color change was measured spectrophotometrically at a wavelength of 450 The concentration of MUC5AC in the samples was then determined by comparing the O.D of the samples to the standard curve 3.11 RNA harvest and mRNA expression quantification 3.11.1 Storage of lung samples Lung samples from mice were extracted 24 h after the last OVA or saline aerosol challenge The lung samples were kept in RNAlater (Invitrogen, Carlsbad, CA), which is an aqueous tissue storage solution that rapidly permeates the tissues and preserves the RNA integrity of the tissues The lung samples were kept at oC overnight to allow the RNAlater to permeate into the lung tissues After that the samples were kept at -80 oC for long term storage 3.11.2 Preparation of lung samples for RNA harvest In order to isolate RNA from frozen lung tissues were thawed and removed from the RNAlater with a pair of clean forceps The lung tissues were homogenized in Trizol reagent (Invitrogen, Carlsbad, CA) The lung tissues were disrupted with a homogenizer (SilentCrusher M, Heidolph Elektro GmbH & Co, Kelheim, German) To reduce degradation of RNA during homogenization, lung tissues were kept in ice bath throughout the process The homogenate was centrifuged at high speed 12,000g for 10 at oC to spin down the unwanted membranes and cell components The supernatant was transferred to a fresh tube for subsequent RNA harvest 3.11.3 Preparation of cell culture samples for RNA harvest Cells were cultured on 6-wells plate were washed with ice cold PBS twice ml of TRIzol (Invitrogen, Carlsbad, CA) was added to flush the adherent cells, which would be dislodged 95 from the wells by TRIzol Dislodged cells were transferred to a fresh tube for further analysis The samples were stored in -80 oC freezer for long term storage 3.11.4 RNA harvest Samples in TRIzol reagent were placed at room temperature for This incubation allowed for complete dissociation of proteins Chloroform was then added and the sample was shook vigorously The samples were then incubated at room temperature and subjected to centrifugation Following centrifugation, the cleared supernatant from every sample was transferred to another 1.5 ml tube Isopropanol was added to the supernatant, resulting in precipitation of RNA The precipitated RNA was washed using 75 % absolute ethanol The ethanol was removed and the RNA pellet was dissolved in nuclease-free water RNA concentration was measured using a nanodrop ND-1000 spectrophotometer (Thermo Fisher Scientific Inc, Waltham, MA, USA) In order to ensure that the RNA extracted were of sufficient purity, the A260/A280 (DNA/protein) and A260/A230 (DNA/Organic contaminants) ratio were recorded Ratios between 1.9 and 2.0 suggest an acceptable level of purity of the RNA extracted 3.11.5 Reverse transcription (RT) - polymerase chain reaction (PCR) Using oligodT (Promega, Fitchburg, WI) as the primer and AMV reverse transcriptase (Promega, Fitchburg, WI), µg of RNA was transcribed into cDNA The transcription was performed using a multiwell thermal cycle (GeneAmp PCR system 2700, Applied Biosystems, Foster City, CA) 3.11.6 Realtime(RT)-PCR Real time PCR was performed using ABI 7500 cycler in a 20 µl reaction volume system containing the following: 1µl cDNA (1µg), 10 µl X Sybrgreen master mix (Thermo Fisher Scientific Inc, Waltham, MA), µl forward primer (10 µM), µl reverse primer (10 µM), and µl nuclease-free water Table 3.2 shows the sequences of the primers 3.11.7 Semi-quantitative-PCR Synthesized cDNA was used as a template for PCR amplification PCR amplification were performed using µl cDNA template in a 25 µl reaction volume containing the following: 1) 96 µl of cDNA (1 µg/µl); 12.5 µl 2X PCR master mix (50 units/ml TaqDNA polymerase, 400 µM dATP, 400µM dCTP, 400 µM dTTP, and mM MgCl2) (Promega, Fitchburg, WI), 9.5 µl nuclease-free water (Promega, Fitchburg, WI), 1µl forward primer (10 µM) (1st Base, Singapore) and µl reverse primer (10 µM) (1st Base, Singapore) µl of PCR-amplified product was added to µl of 10 X DNA tracking dye Samples were loaded onto % agarose gel with GelGreen staining and were subjected electrophoresis performed at 100 V for approximately 30 Bands were visualised using the ultraviolet transillumination β-actin, which is a housekeeping gene, was used as an internal control to normalise for variations in loading and sample concentrations Table 3.2 shows the sequences of the primers 3.12 Immunoblotting 3.12.1 Lung protein extraction In order to extract proteins from lung samples, the lung lobes were cut into small pieces, placed in lysis buffer M-PER Mammalian Protein Extraction Reagent containing phophatase inhibitor (Thermo Scientific, Waltham, MA) , then homogenised using a homogeniser (SilentCrusher M, Heidolph Elektro GmbH & Co, Kelheim, German) Lung tissue lysates were then incubated on ice for at least 30 Total protein concentrations were determined using bicinchoninic acid (BCA) protein assay kit (Thermo Fisher Scientific Inc, Waltham, MA, USA) 3.12.2 Tissue protein nuclear extraction Nuclear proteins from lung tissues were extracted using Active Motif nuclear protein extraction kit (Active Motif, Carlsbad, CA) Extraction process was carried out according to protocol stated in the extraction kit Briefly, the lung tissues were homogenised in 1X Hypotonic Buffer supplemented with DTT and Detergent The homogenised tissues were incubated on ice for 15 After incubation, the tissues were centrifuged for 10 The supernatants, which contain the cytoplasmic proteins, were collected in a fresh eppendoff tube However, at that point, the pellet still contained cytoplasmic protein Therefore, the pellet was subjected to another round of resuspension and centrifugation The supernatant, which still 97 contained cytoplasmic protein, was pooled with the cytoplasmic protein collected earlier The remaining pellet was resuspend in lysis buffer to lyse the nucleus The lysed nucleus was centrifuged to remove any debris Finally, the supernatant that contained the nuclear protein was harvested and stored at -80 OC for further analysis The protein concentration in the nuclear extract was determined using BCA protein assay kit 3.12.3 Cell line protein extraction In order to extract proteins from cell lines, the cells were incubated for at least 30 at oC in the same lysis buffer used for lung samples Incubation allowed for cells to be lysed and proteins to be released After lung tissue were homogenised or the cells were lysed, they were subjected to centrifugation (12,000 rpm, 15 min) Supernatant containing the protein was harvested and total protein concentrations were determined using bicinchoninic acid (BCA) protein assay kit (Thermo Fisher Scientific Inc, Waltham, MA) 3.12.4 Immunoblot 30 µg of protein extracted were subjected to 10 % SDS-PAGE in a Trans-Blot tank (Bio-Rad Laboratories, Hercules, CA) and transferred to PVDF membrane tank (Bio-Rad Laboratories, Hercules, CA) The membrane with the transferred protein was subsequently blocked in % skim milk (Sigma-Aldrich, St Louis, MO) in Tween-Tris-buffer saline (TTBS) for at least h at room temperature The blocked membrane was then probed with various primary antibodies in % skim milk (Sigma-Aldrich, St Louis, MO) in TTBS overnight at oC Following that, the membrane was washed with TTBS to remove unbound primary antibodies before secondary antibody was added Secondary antibody probes for the presence of primary antibody The membrane was developed on hyperfilms using ECL reagents (HRP) (Thermo Fisher Scientific Inc, Waltham, MA, USA) or Alkaline Phosphatase (AP) reagents (Bio-Rad Laboratories, Hercules, CA, USA) β-actin or Tata-Binding Protein (TBP) was used as a loading control 3.13 NF-κB transactivation assay (TransAM) 98 p65 DNA-binding activity was assessed by TransAM™ NF-κB p65 transcriptional factor assay kit (Active Motif, Carlsbad, CA), which comes with a 96-well plate coated with immobilized oligonucleotide containing the NF-κB consensus DNA binding sequence (5’GGGACTTTCC-3’) Briefly, 10 µg of nuclear protein or total protein from every sample was added to separate wells of the plate The protein was incubated in the well for h Primary antibody specific for p65 was then added and incubated Subsequently, HRP-conjugated secondary antibody specific to p65 antibody was added to each well Following that, developing solution was added to allow for colorimetric reaction to occur To inhibit the colorimetric reaction, stop solution was added The plate was read at 450 nm with reference wavelength of 655nm The reading was done using a microplate reader (Sunrise Tecan, Austria) 3.14 NF-κB reporter gene assay κ 3.14.1 NF-κB luciferase gene reporter assay Normal human bronchial cells (NHBE) (Lonza, Walkersville, MD, USA) were cultured in optimised bronchial epithelial bullet kit medium supplemented with the following: bovine pituitary extract ( ml), insulin (0.5 ml), hydrocortisone (0.5 ml), GA-1000 (0.5 ml), retinoic acid (0.5 ml), transferring (0.5 ml), triiodothytonine (0.5 ml), epinephrine (0.5 ml), and human EGF (0.5 ml) Cell of passage number ranging between three and six were seeded onto 6-wells plate at 1.0 X 105 cells/well Using Lipofectamine, the cells were transfected with NFκB responsive elements linked to luciferase reporter gene The transfected cells were pretreated with fisetin (10 µM, 25 µM, or 50 µM), 0.01% DMSO or plasmid expressing dominant negative IκB for h before stimulation with nM TNF-α for 24 h Cells were lysed in luciferase lysis buffer The luciferase activity was quantified using a luminometer and normalized to β-galactosidase activity as previously described (Goh et al., 2012) All luciferase experiments were repeated thrice TNF-α was used as a stimulant in the in vitro studies to study NF-κB signaling pathway because this stimulant has been implicated in the pathophysiologic mechanism of several 99 chronic inflammatory diseases including asthma In the airway of asthmatic patients, TNF-α mRNA and protein levels were found to be increased (Newton et al., 2007a) In addition, the administration of inhaled recombinant TNF-α to normal subjects results in development of AHR and airway neutrophilia (Babu et al., 2011) TNF-α can be produced by diverse immune and structural cells — macrophages, lymphocytes, fibroblast, and keratinocytes — in response to inflammation TNF-α released binds to TNF-α receptor (TNFR)-1 and activates several intracellular signal transduction cascades, including NF-κB pathway Activation of NF-κB signaling pathway results in the transcription of pro-inflammatory genes that are associated with asthma, such as IL-6, IL-8, TSLP, and MUC5AC (Edwards et al., 2009) 3.14.2 NF-κB/Secreted alkaline phosphatase (SEAP) reporter gene assay RPS-3 siRNA transfected NF-κB/SEAP stable HEK 293 cell line (Imgenex, San Diego, CA) were stimulated with 50 ng/ml TNF-α for 24 h (Lora et al., 2005) Briefly, a NF-κB response element was linked SEAP in a plasmid The plasmid was transfected into HEK293 cell line Activation of NF-κB signaling would result in the transcription of SEAP This gene reporter assay allows NF-κB to function as a regulatory element in the assay Cell culture supernatant, was added to microtiter plate and incubated at 65 oC for 30 This incubation inactivates any endogenous alkaline phosphatise and allow for acute quantification of SEAP Following the incubation, SEAP substrate was added and incubated at room temperature for about 30 The plate was read at 450 nm (reference filter 570 nm) using an automatic microplate reader (Sunrise Tecan Austria) 3.15 Band intensity analysis The optical density of semi-quantitative PCR bands and immunoblot bands was analysed using ImageJ, which is a public domain Java image processing program The relative optical density is an indication of the relative amounts of mRNA or protein To calculate the relative optical density, the optical density of each sample was divided by the optical density of the sample’s βactin or TBP 100 3.16 Statistical analysis All data are presented as means ± S.E.M One-way ANOVA, followed by Dunnett’s test or Student’s T-test were performed to determine if there were significant differences between different groups Dunnett’s T test and Student’s T- test results were analysed using SPSS15 for windows (SPSS Inc, Chicago, IL, USA) The critical level for significance was set P < 0.05 101 Target product Accession ID Primer Sequences (5’ 3’) Length Human IL-6 GI:224831235 Human IL-8 GI:15488984 Human MUC5AC GI:397139397 Human RPS-3 GI:386869502 Human TSLP GI:190886447 Mouse AMCase GI:27754135 Mouse ICAM-1 GI:30172560 Mouse IL-17 GI:142367609 Mouse IL-33 GI:257900494 Mouse iNOS GI:146134510 Mouse MUC5AC GI:114431223 Mouse RANTES GI:164698427 Mouse Rip-2 GI:142347210 Mouse TLR-3 GI:45429998 Mouse TNF-α GI:133892368 Mouse TSLP GI:283945612 Mouse VCAM-1 GI:145386540 Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward GGCACTGGCAGAAAACAACC GCAAGTCTCCTCATTGAATCC GAATGGGTTTGCTAGAATGTGATA CAGACTAGGGTTGCCAGATTTAAC CAGCACAACCCCTGTTTCAAA GCGCACAGAGGATGACAGT GCTGAAGATGGCTACTCTGGAG ACAGCAGTCAGTTCCCGAATCC TATGAGTGCGACCAAAAGTACCG GGGATTGAAGGTTAGGCTCTGG TGGGTTCTGGGCCTACTATG GCTTGACAATGCTGCTGGTA CGCTGTGCTTTGAGAACTGTG ATACACGGTGATGGTAGCGG GACCAGGATCTCTTGCTGGA GAACTCTCCACCGCAATGA CGGATCCACTTCACTTTTAACACAGTC GAGATCTTTAGATTTTCGAGAGCTTA GTTCTCAGCCCAACAATACAAGA GTGGACGGGTCGATGTCAC GGACTTCAATATCCAGCTACGC CAGCTCAACAACTAGGCCATC TTTGCCTACCTCTCCCTCG CGACTGCAAGATTGGAGCACT CCATCCCGTACCACAAGCTC GCAGGATGCGGAATCTCAAT GTTGTAACCTGGATGCCTAAGAC GGCCTCTGTCAAGTTGGTGA CCAGTGTGGGAAGCTGTCTT AAGCAAAAGAGGAGGCAACA ACTGCAACTTCACGTCAATTACG TTGCTCGAACTTAGCCCCTTT CCAGCACTCCGTGAAGATCC 102 85 References (Gaughwin et al., 2011) (Lindenthal and Klinkert, 2002) 99 (Wang and Seed, 2003) 128 (Wan et al., 2007) 97 (Wang and Seed 2003) 483 (Bao et al., 2009) 62 (Wang and Seed 2003) 143 (Faust et al., 2009) 479 (Humphreys et al., 2008) 127 (Wang and Seed 2003) 94 (Wang and Seed 2003) 85 (Wang and Seed 2003) 142 (Wang and Seed 2003) 198 (Wang and Seed 2003) 100 (Wang and Seed 2003) 89 (Wang and Seed 2003) 42 (Wang and Seed 2003) GI:142347793 Mouse YM-1 GI:254281347 Mouse YM-2 GI:22123907 Mouse Znhit GI:703109 Human and mouse β-actin GI:6671508 Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward CTGGTCTGGGAAGGCATACA GTACAAGCTGGTTCTGCTTACT GTTGGAGGCAATCTCGGAAA CTGGAATTGGTGCCCCTACA CAAGCATGGTGGTTTTACAGGA CAGAACCGTCAGACATTCATTA ATGGTCCTTCCAGTAGGTAATA TTGCCCGACTTGCCGCGTCGTGCCCTA CCTAAACAGCAGTCTGCAAACTCC TCATGAAGTGTGACGTTGACATCCGT Reverse Mouse YKL-40 CCTAGAAGCATTTGCGGTGCACGATG Table 3.2 Primer Sets for RT-PCR 103 277 (Bao et al., 2009) 625 (Bao et al., 2007) 429 (Cheng et al., 2011) 360 (Iwahashi et al., 2002) 285 (Bao et al., 2009) ... attenuation of allergic airway inflammation would be through appropriate and specific inhibition of signaling molecules which regulate the activation of NF-? ?B (Uwe, 2008) Rip-2 has been shown... that, the membrane was washed with TTBS to remove unbound primary antibodies before secondary antibody was added Secondary antibody probes for the presence of primary antibody The membrane was developed... GI:14 236 7609 Mouse IL -33 GI:257900494 Mouse iNOS GI:146 134 510 Mouse MUC5AC GI:114 431 2 23 Mouse RANTES GI:164698427 Mouse Rip-2 GI:14 234 7210 Mouse TLR -3 GI:45429998 Mouse TNF-α GI: 133 89 236 8 Mouse