Tài liệu hạn chế xem trước, để xem đầy đủ mời bạn chọn Tải xuống
1
/ 95 trang
THÔNG TIN TÀI LIỆU
Nội dung
ĐẠI HỌC QUỐC GIA HÀ NỘI TRƢỜNG ĐẠI HỌC KHOA HỌC TỰ NHIÊN - NGUYỄN THỊ HỒNG NHUNG NGHIÊN CỨU ĐẶC TÍNH ENZYME CHITINASE TỪ NẤM SỢI LUẬN VĂN THẠC SĨ KHOA HỌC Hà Nội - 2014 i TIEU LUAN MOI download : skknchat@gmail.com ĐẠI HỌC QUỐC GIA HÀ NỘI TRƢỜNG ĐẠI HỌC KHOA HỌC TỰ NHIÊN - NGUYỄN THỊ HỒNG NHUNG NGHIÊN CỨU ĐẶC TÍNH ENZYME CHITINASE TỪ NẤM SỢI Chuyên ngành: Vi sinh vật học Mã số: 60420107 LUẬN VĂN THẠC SĨ KHOA HỌC NGƢỜI HƢỚNG DẪN KHOA HỌC: PGS TS Dƣơng Văn Hợp PGS TS Bùi Thị Việt Hà Hà Nội - 2014 ii TIEU LUAN MOI download : skknchat@gmail.com LỜI CẢM ƠN Tôi xin bày tỏ lòng biết ơn sâu sắc đến PGS TS Dƣơng Văn Hợp PGS TS Bùi Thị Việt Hà tận tình giúp đỡ, dìu dắt hƣớng dẫn tơi suốt q trình thực luận văn Tơi xin gửi lời cảm ơn tới ThS Lê Thị Hoàng Yến, Ths Nguyễn Anh Tuấn toàn thể cán Bảo tàng giống chuẩn Vi sinh vật (VTCC) Viện Vi sinh vật Công nghệ Sinh học - Đại học Quốc gia Hà Nội tạo điều kiện thuận lợi giúp đỡ tơi q trình hồn thành luận văn Tôi xin chân thành cảm ơn thầy, cô môn Vi sinh vật học, Khoa Sinh học - Đại học Khoa học Tự nhiên, Đại học Quốc gia Hà Nội tận tình hƣớng dẫn bảo cho suốt thời gian qua Cuối tơi xin bày tỏ lịng cảm ơn đến gia đình, bạn bè ngƣời thân giúp đỡ động viên tơi nhiều Với lịng biết ơn sâu sắc xin chân thành cảm ơn tất giúp đỡ quý báo nói Hà Nội, tháng 06 năm 2014 Học viên Nguyễn Thị Hồng Nhung iii TIEU LUAN MOI download : skknchat@gmail.com MỤC LỤC MỞ ĐẦU Chƣơng – TỔNG QUAN TÀI LIỆU 1.1 KHÁI QUÁT CHUNG VỀ CHITIN VÀ CHITOSAN 1.1.1 Chitin 1.1.2 Chitosan 1.2 SẢN XUẤT CHITIN, CHITOSAN VÀ OLIGO CHITOSAN 1.2.1 Sản xuất chitin, chitosan oligo chitosan đƣờng hoá học 1.2.2 Sản xuất chitin, chitosan oligo chitosan đƣờng sinh học 1.3 VAI TRÕ CỦA CHITIN/CHITIN OLIGOSACCARIT 1.3.1 Đối với nông nghiệp 1.3.2 Đối với môi trƣờng 1.3.3 Ứng dụng y học 1.3.4 Trong công nghiệp 1.3.5 Trong thực phẩm 1.4 KHÁI QUÁT VỀ CHITINASE 1.4.1 Định nghĩa chitinase 1.4.2 Những nguồn sản sinh chitinase 1.4.3 Phân loại chitinase 11 1.4.4 Cơ chế tác động loại enzyme chitinase 13 1.4.5 Các đặc tính enzyme chitinase 14 1.5 VAI TRÕ CỦA CHITINASE 17 1.5.1 Trong nông nghiệp 17 iv TIEU LUAN MOI download : skknchat@gmail.com 1.5.2 Trong Y học 18 1.6 MỘT SỐ NGHIÊN CỨU VỀ ENZYME CHITINASE TỪ NẤM SỢI 18 1.6.1 Trên giới 18 1.6.2 Trong nƣớc 20 Chƣơng - ĐỐI TƢỢNG VÀ PHƢƠNG PHÁP NGHIÊN CỨU 22 2.1 ĐỐI TƢỢNG 22 2.2 HÓA CHẤT VÀ THIẾT BỊ DÙNG TRONG NGHIÊN CỨU 22 2.3 MÔI TRƢỜNG 22 2.3.1 Môi trƣờng PDA (Potato Dextro Agar) nuôi cấy giữ giống (g/l) 22 2.3.2 Môi trƣờng LCA (Low Carbon Agar) để phân loại hình thái học (g/l) 23 2.3.3 Mơi trƣờng LB (Luria-Bertani)-agar (g/l) 23 2.3.4 Môi trƣờng lên men dịch thể (g/l) nghiên cứu chitinase 23 2.3.5 Môi trƣờng thử hoạt tính enzyme chitinase đĩa thạch 23 2.4 PHƢƠNG PHÁP NGHIÊN CỨU 23 2.4.1 Phƣơng pháp sàng lọc sơ hoạt tính chitinase chủng nấm sợi 23 2.4.2 Phƣơng pháp nuôi cấy nấm sợi sinh tổng hợp chitinase 24 2.4.3 Phƣơng pháp định tính enzyme chitinase 24 2.4.4 Phƣơng pháp định lƣợng chitinase [58 25 2.4.5 Phƣơng pháp sắc ký mỏng (TLC- Thin layer chromatography) 28 2.4.6 Phƣơng pháp xác định khả kháng vi sinh vật 29 2.4.7 Nghiên cứu điều kiện ni cấy thích hợp cho khả sinh tổng hợp chitinase nấm sợi 29 2.4.8 Tinh sơ enzyme chitinase 31 2.4.9 Điện di SDS-PAGE 32 v TIEU LUAN MOI download : skknchat@gmail.com 2.4.10 Xác định hoạt tính chitinase Semi-Native PAGE 33 2.4.11 Xác định số đặc tính enzyme chitinase tinh 34 2.4.12 Phân loại chủng nấm sợi nghiên cứu 35 Chƣơng - KẾT QUẢ VÀ THẢO LUẬN 40 3.1 TUYỂN CHỌN CÁC CHỦNG NẤM SỢI CÓ KHẢ NĂNG PHÂN HỦY CHITIN CAO 40 3.2 KHẢ NĂNG SINH TỔNG HỢP CHITINASE CỦA 44 CHỦNG NẤM SỢI ĐÃ TUYỂN CHỌN 41 3.3 ĐỊNH LƢỢNG CHITINASE 10 CHỦNG NẤM SỢI TUYỂN CHỌN 42 3.4 NGHIÊN CỨU PHÂN LOẠI CHỦNG VN10-1103 43 3.4.1 Đặc điểm hình thái 43 3.4.2 Phân loại dựa phƣơng pháp sinh học phân tử 44 3.5 LỰA CHỌN MỘT SỐ ĐIỀU KIỆN NUÔI CẤY SINH TỔNG HỢP CHITINASE CỦA CHỦNG VN10-1103 45 3.5.1 Lựa chọn môi trƣờng nuôi cấy 45 3.5.2 Lựa chọn pH môi trƣờng 46 3.5.3 Lựa chọn nhiệt độ nuôi cấy 47 3.5.4 Lựa chọn nguồn carbon 49 3.5.5 Nồng độ nguồn carbon phù hợp 50 3.5.6 Lựa chọn nguồn nitơ 51 3.5.7 Ảnh hƣởng nồng độ nitơ 52 3.5.8 Ảnh hƣởng thời gian nuôi cấy 53 3.6 TINH SẠCH SƠ BỘ CHITINASE 54 3.7 NGHIÊN CỨU MỘT SỐ ĐẶC TÍNH CỦA CHITINASE TINH SẠCH 56 vi TIEU LUAN MOI download : skknchat@gmail.com Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung 3.7.1 pH tối ƣu cho hoạt động enzyme 56 3.7.2 Nhiệt độ tối ƣu cho phản ứng enzyme 57 3.7.3 Độ bền nhiệt enzyme 58 3.7.4 Độ bền pH enzyme 59 3.7.5 Ảnh hƣởng ion kim loại 60 3.7.6 Khả phân giải chất enzyme 62 3.7.7 Khả kháng vi sinh vật chế phẩm 62 KẾT LUẬN VÀ KIẾN NGHỊ 64 TÀI LIỆU THAM KHẢO 65 Tài liệu Tiếng Việt 65 Tài liệu tiếng Anh 65 PHỤ LỤC - - vii Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung TIEU LUAN MOI download : skknchat@gmail.com Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung DANH MỤC VIẾT TẮT T n ầy Viết tắt Axit deoxyribonucleic riboxom ADNr Cacboxymethyl cellulose CMC Đối chứng ĐC Môi trƣờng MT1 Internal Transcripbed Spacer ITS Môi trƣờng MT2 Môi trƣờng MT3 Môi trƣờng MT4 Môi trƣờng MT5 Môi trƣờng MT6 N–acetyl- D- glucosamine GlcNAc Optical Density OD Polymerase Chain Reaction PCR (Phản ứng chuỗi trùng hợp) Sodium dodecyl sulfat SDS viii Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung TIEU LUAN MOI download : skknchat@gmail.com Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung DANH MỤC HÌNH ẢNH MINH HỌA Hình Cấu trúc phân tử chitin Hình Cấu trúc phân tử chitosan Hình Cơ chế hoạt động hệ enzyme chitinase Trichoderma 14 Hình Đồ thị chuẩn biểu diễn độ hấp thụ N-acetyl glucosamin bước sóng 500nm 27 Hình Quy trình tinh enzyme chitinase sinh tổng hợp chủng nấm sợi lựa chọn 32 Hình n ng phân giải chất chitin c c chủng nấm sợi 42 Hình Hình ảnh khuẩn lạc (A) bào tử (B) chủng VN10-1103 44 Hình Sản phẩmPCR ITS –D1D2 ADNr chủng VN10-1103 gel agarose) 44 Hình Cây phát sinh chủng loại chủng VN10-1103 c c lồi có mối quan hệ họ hàng gần, xây dựa vào phân tích trình tự gen ADNr dựa vào trình tự đoạn ITS D1D2 45 Hình 10 Hoạt tính chitinase chủng VN10-1103 ni cấy c c pH môi trường kh c 47 Hình 11 Hoạt tính chitinase chủng VN10-1103 ni cấy c c nhiệt độ kh c 48 Hình 12 n ng sinh chitinase chủng VN10-1103 c c nguồn carbon khác 49 Hình 13 n ng sinh chitinase chủng VN10-1103 nuôi cấy c c nồng độ colloidal chitin khác 51 Hình 14 n ng sinh tổng hợp chitinase chủng VN10-1103 nuôi cấy c c nồng độ cao nấm men kh c 53 Hình 15 n ng sinh tổng hợp chitinase chủng VN10-1103 c c thời gian nuôi cấy 53 Hình 16 Biểu đồ biểu thị c c phân đoạn tinh chitinase VN10-1103 55 ix Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung TIEU LUAN MOI download : skknchat@gmail.com Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung Hình 17 Sản phẩm điện di SDS-PAGE (A) Semi-native PAGE (B) chitinase VN10-1103 56 Hình 18 Ảnh hưởngcủa pH lên hoạt tính chitinase B.bassiana VN10-1103 57 Hình 19 Ảnh hưởng nhiệt độ tới hoạt động chitinase từ B.bassiana VN101103 58 Hình 20 Ảnh hưởng nhiệt độ lên độ bền enzyme chitinase từ B.bassiana VN10-1103 59 Hình 21 Ảnh hưởng pH lên độ bền chitinase B bassiana VN10-1103 60 Hình 22 Ảnh hưởng c c ion kim loại lên hoạt tính chitinase chủng VN101103 61 Hình 23 n ng phân cắt c c chất kh c chitinase sinh tổng hợp chủng VN10-1103 62 Hình 24 n ng kh ng Fusarium oxysporum (A) Shigella flexneri (B) chế phẩm chủng VN10-1103 63 x Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung TIEU LUAN MOI download : skknchat@gmail.com Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung 46 Mukhtar, H and Ikram-Ul-Haq (2008), Production of alkaline protease by Bacillus subtilis and its application as a depilating agent in leather processing”, Pakistan Journal of Botany, 40 (4), pp 1673-1679 47 Muzzarelli Raa, M.C (2009), Chitin and chitosan hydrogels”, Handbook of Hydrocolloids, pp 849-888 48 Natsir, H., A.R Patong, M.T Suhartono, and A Ahmad (2013), Isolation and purification of thermostable chitinase from Bacillus licheniformis Strain HSA3-1a from Sulili Hot Spring in South Sulawesi, Indonesia”, International Journal of Pharma and Bio Sciences,4(3), pp 1252-1259 49 Orikoshi, H., S Nakayama, et al (2005), Roles of four chitinases (chia, chib, chic, and chid) in the chitin degradation system of marine bacterium Alteromonas sp strain O-7”, Application Environment Microbiology,71 (4), pp 1811-1815 50 Pankaj, P., A Deepti, B Tushar, and P Shridhar (2005), Chitinase production by Beauveria felina RD 101: optimization of parameters under solid substrate fermentation conditions”, World Journal of Microbiology and Biotechnology, 21 (1), pp 93-95 51 Park, S.H., J.-H Lee, and H.K Lee (2000), Purification and Characterization of Chitinase from a Marine Bacterium, Vibrio sp 98CJ11027”, The Journal of Microbiology, 38 (4), pp 224-229 52 Pinnamaneni, R., K P., and S.R K.R.S (2010), Cloning and Expression of Bbchit1 gene of Beauveria bassiana ”, The Open Entomology Journal, 4, pp 30-35 53 Priya.C.S, Jagannathan.N, and Kalaichelvan.P.T (2011), Production of chitinase by Streptomyces hygroscopicus VMCH2 by optimisation of cultural conditions”, International Journal of Pharma and Bio Sciences,2(2), pp 210-219 54 Punja, Z.K and Y.-Y Zhang (1993), Plant Chitinases and Their Roles in Resistance to Fungal Diseases”, 25 (4), pp 526-540 70 Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung TIEU LUAN MOI download : skknchat@gmail.com Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung 55 Rinaudo, M (2006), Chitin and chitosan: Properties and applications”, Progress in Polymer Science, 31 (7), pp 603-632 56 Shahidi, F., J.K.V Arachchi, and Y.-J Jeon (1999), Food applications of chitin and chitosans”, Trends in Food Science & Technology, 10 (2), pp 3751 57 Sharaf, E.F., A.E.-A.Q El-Sarrany, and M El-Deeb (2012 ), Biorecycling of shrimp shell by Trichoderma viride for production of antifungal chitinase”, African Journal of Microbiology Research,6(21), pp 4538-4545 58 Svedese, V.M., P.V Tiago, J.D.P Bezerra, L.M Paiva, E.Á.D.L.A Lima, and A.L.F Porto (2013), Pathogenicity of Beauveria bassiana and production of cuticle-degrading enzymes in the presence of Diatraea saccharalis cuticle”, African Journal of Biotechnology,12 (46), pp 64916497 59 Taechowisan, T., J.F Peberdy, and S Lumyong1 (2003), Chitinase production by endophytic Streptomyces aureofaciens CMUAc130 and its antagonism against phytopathogenic fungi”, Annals of Microbiology, 53 (4), pp 447-461 60 V., S.P and C M (1998), Utilization of prawn waste for chitinase production by the marine fungus Beauveria bassiana by solid state fermentation”, World Journal of Microbiology and Biotechnology, 14 (5), pp 655-660 61 Wang, S., T Liang, B Lin, C Wang, P Wu, and J Liu (2010), Purification and characterization of chitinase from a new species strain Pseudomonas sp TKU008.” Journal of Microbiology and Biotechnology, 20 (6), pp 10011005 62 Wang, S.L and W.T Chang (1997), Purification and characterization of two bifunctional chitinases/lysozymes extracellularly produced by Pseudomonas aeruginosa K-187 in a shrimp and crab shell powder medium”, Applied and Environment Microbiology, 63 (2), pp 380-386 71 Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung TIEU LUAN MOI download : skknchat@gmail.com Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung 63 White, T J., T Bruns, S Lee, and J W Taylor (1990), Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics”, PCR Protocols: A Guide to Methods and Applications, pp 315-322 64 Xia, W., P Liu, J Zhang, and J Chen (2010), Biological activities of chitosan and chitooligosaccharides”, Food Hydrocolloids, pp 1-10 65 Zeki, N.H and S.N Muslim (2010), Purification, characterization and antifungal activity of chitinase from Serratia marcescens isolated from Fresh Vegetables ”, Ibn Al-Haitham Journal for Pure and Applied Science, 23 (1), pp 7-23 66 Zeng, D., J Wu, and J.F Kennedy (2008), Application of a chitosan flocculant to water treatment”, Carbohydrate Polymers, 71 (1), pp 135-139 72 Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung TIEU LUAN MOI download : skknchat@gmail.com Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung PHỤ LỤC Trình tự gen oạn ITS thuộc ADNr c a ch ng VN10-1103: CTTCTAAGAATTAGAACACCGCAAGAAATTGATATATTATTTGATT CCAAATCCCTGTATTTTTGATTTTTAGACCCAATTGGCCCCCCCATA TTTGGGGGGCATCCTTTTTAAGGTTCTTTCAACCCTCGAACTCCCCG GGGAGAGGTCGGTTTGGGGACCGGAAGACACCCGCGGCCCTTAAA AGGAGGGCGGCCCTTCCGGGGGACCTTTGCGTAGTAAACAGTTCGC ACCGGAACCCGGACGGGGCCACGCCGTAAAACACCCAACTTTCTG AACGTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTTAAGCAT ACGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAG TCGTCTTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAAT GAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCACCGACCGATCC TGATGTTCTCGGATGGATTTGAGTAAGAGCATACGGGGCCGGACCC GAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAAC TCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCGAATCGATCGTCAA ATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG GTTTCCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGAACTCAGTTTT ATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCGCTATATTGCC TTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTG ATTGAACGTGGGCATTCGAATGTATCAACAACTAGTGGCCATGTT Trình tự gen phần D1D2 c a ADNr 28S c a ch ng VN10-1103: TCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAAC GGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTCAG GGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTC CGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTAT GGTCGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAG TTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTA AATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAG -1- Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung TIEU LUAN MOI download : skknchat@gmail.com Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung ATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGT TGAAAGGGAAGCGCCTATGACCAGACTTGCGCCCGGTGAATCACC CAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGT TCAGCGCGGGGGAGAAAGGCTTCGGGAATGTGGCTCCCTCGGGAG TGTTATAGCCCGCTGCGTAATGCCCTGCGCCGGACTGAGGTACGCG CATTGCAAGGATGCTGG Hoạt tính enzyme chitinase c a 438 ch ng nấm sợi Bảng 12 Sàng lọc sơ hoạt tính chitinase 438 chủng nấm sợi Số thứ tự T n ch ng KT vòng Số thứ tự T n ch ng KT vòng VN10-1001 0,3 33 VN10-1036 0,5 VN10-1002 1,2 34 VN10-1037 0,4 VN10-1003 0,5 35 VN10-1038 1,6 VN10-1004 0,8 36 VN10-1039 2,2 VN10-1005 2,1 37 VN10-1040 0,6 VN10-1006 0,3 38 VN10-1042 0,3 VN10-1007 0,8 39 VN10-1043 1,6 VN10-1008 1,0 40 VN10-1045 1,9 VN10-1009 41 VN10-1046 0,7 10 VN10-1010 0,5 42 VN10-1047 0,9 11 VN10-1011 43 VN10-1048 0,7 12 VN10-1012 0,4 44 VN10-1050 1,3 13 VN10-1013 45 VN10-1051 1,4 14 VN10-1016 46 VN10-1052 15 VN10-1017 1,5 47 VN10-1053 0,5 -2- Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung TIEU LUAN MOI download : skknchat@gmail.com Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung 16 VN10-1018 48 VN10-1054 0,6 17 VN10-1019 2,1 49 VN10-1056 0,9 18 VN10-1020 50 VN10-1057 1,6 19 VN10-1021 51 VN10-1058 1,4 20 VN10-1022 0,5 52 VN10-1059 0,9 21 VN10-1023 0,4 53 VN10-1060 22 VN10-1024 54 VN10-1061 0,3 23 VN10-1025 2,5 55 VN10-1063 0,4 24 VN10-1026 0,7 56 VN10-1064 0,8 25 VN10-1027 57 VN10-1065 0,3 26 VN10-1028 1,6 58 VN10-1066 0,8 27 VN10-1029 59 VN10-1067 0,3 28 VN10-1030 1,8 60 VN10-1068 0,4 29 VN10-1032 0,9 61 VN10-1069 1,6 30 VN10-1033 0,3 62 VN10-1070 0,5 31 VN10-1034 0,5 63 VN10-1071 0,5 32 VN10-1035 64 VN10-1073 0,6 Số thứ tự T n ch ng KT vòng Số thứ tự Tên chủng KT vòng 65 VN10-1074 0,8 101 VN10-1116 0,3 66 VN10-1075 0,9 102 VN10-1117 0,8 67 VN10-1076 0,8 103 VN10-1118 0,6 68 VN10-1077 0,4 104 VN10-1119 1,3 -3- Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung TIEU LUAN MOI download : skknchat@gmail.com Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung 69 VN10-1078 0,9 105 VN10-1120 0,4 70 VN10-1079 0,5 106 VN10-1121 1,6 71 VN10-1081 107 VN10-1122 72 VN10-1082 1,3 108 VN10-1123 0,3 73 VN10-1083 0,4 109 VN10-1124 0,3 74 VN10-1084 110 VN10-1125 0,8 75 VN10-1085 1,5 111 VN10-1126 0,8 76 VN10-1086 0,9 112 VN10-1127 0,6 77 VN10-1087 1,1 113 VN10-1128 0,6 78 VN10-1089 0,7 114 VN10-1129 79 VN10-1090 1,3 115 VN10-1130 0,8 80 VN10-1092 116 VN10-1132 81 VN10-1094 1,3 117 VN10-1133 0,5 82 VN10-1096 0,3 118 VN10-1134 83 VN10-1097 0,3 119 VN10-1135 0,8 84 VN10-1098 0,5 120 VN10-1136 1,6 85 VN10-1099 1,1 121 VN10-1137 1,5 86 VN10-1100 0,4 122 VN10-1138 1,6 87 VN10-1101 0,6 123 VN10-1139 88 VN10-1102 1,3 124 VN10-1140 89 VN10-1103 2,7 125 VN10-1141 0,4 90 VN10-1104 0,8 126 VN10-1142 1,1 -4- Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung TIEU LUAN MOI download : skknchat@gmail.com Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung 91 VN10-1105 1,2 127 VN10-1143 0,8 92 VN10-1106 1,8 128 VN10-1144 0,8 93 VN10-1107 129 VN10-1145 94 VN10-1108 0,6 130 VN10-1146 0,4 95 VN10-1109 131 VN10-1147 1,1 96 VN10-1110 0,6 132 VN10-1148 0,9 97 VN10-1111 133 VN10-1150 98 VN10-1113 0,5 134 VN10-1151 0,5 99 VN10-1114 0,6 135 VN10-1152 100 VN10-1115 0,7 136 VN10-1153 0,8 Số thứ tự T n ch ng KT vòng Số thứ tự T n ch ng KT vòng 137 VN10-1154 0,9 172 VN10-1195 0,3 138 VN10-1155 0,8 173 VN10-1196 0,3 139 VN10-1156 174 VN10-1197 140 VN10-1157 0,6 175 VN10-1199 1,3 141 VN10-1158 176 VN10-1200 1,5 142 VN10-1159 177 VN10-1201 2,2 143 VN10-1161 0,4 178 VN10-1202 0,3 144 VN10-1162 0,5 179 VN10-1204 1,1 145 VN10-1163 0,6 180 VN10-1205 0,4 146 VN10-1164 1,1 181 VN10-1207 0,5 147 VN10-1165 1,1 182 VN10-1208 -5- Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung TIEU LUAN MOI download : skknchat@gmail.com Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung 148 VN10-1166 183 VN10-1209 149 VN10-1167 0,7 184 VN10-1210 1,4 150 VN10-1168 0,5 185 VN10-1211 151 VN10-1169 0,6 186 VN10-1212 1,2 152 VN10-1172 1,3 187 VN10-1213 153 VN10-1173 188 VN10-1214 1,7 154 VN10-1174 1,7 189 VN10-1215 1,4 155 VN10-1175 190 VN10-1216 156 VN10-1176 1,1 191 VN10-1217 157 VN10-1179 0,6 192 VN10-1218 158 VN10-1180 2,3 193 VN10-1219 159 VN10-1181 1,3 194 VN10-1220 160 VN10-1182 1,1 195 VN10-1221 0,6 161 VN10-1183 0,8 196 VN10-1222 162 VN10-1184 0,4 197 VN10-1223 1,2 163 VN10-1185 0,8 198 VN10-1224 0,5 164 VN10-1186 199 VN10-1226 0,6 165 VN10-1187 1,1 200 VN10-1227 0,4 166 VN10-1188 0,7 201 VN10-1228 0,4 167 VN10-1189 1,1 202 VN10-1229 0,7 168 VN10-1191 0,3 203 VN10-1230 0,6 169 VN10-1192 204 VN10-1231 0,3 -6- Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung TIEU LUAN MOI download : skknchat@gmail.com Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung 170 VN10-1193 0,9 205 VN10-1232 1,7 171 VN10-1194 1,3 206 VN10-1233 0,5 Số thứ tự T n ch ng KT vòng Số thứ tự T n ch ng KT vòng 207 VN10-1234 0,4 242 VN10-1273 208 VN10-1235 243 VN10-1274 209 VN10-1236 244 VN10-1275 1,4 210 VN10-1239 1,8 245 VN10-1276 211 VN10-1240 1,6 246 VN10-1277 212 VN10-1241 247 VN10-1278 1,4 213 VN10-1242 0,7 248 VN10-1279 1,6 214 VN10-1243 1,3 249 VN10-1280 215 VN10-1244 250 VN10-1281 216 VN10-1245 251 VN10-1282 1,2 217 VN10-1246 252 VN10-1285 0,8 218 VN10-1247 0,7 253 VN10-1286 219 VN10-1248 1,6 254 VN10-1287 220 VN10-1249 0,9 255 VN10-1288 221 VN10-1250 2,1 256 VN10-1289 2,3 222 VN10-1251 1,6 257 VN10-1290 223 VN10-1252 258 VN10-1291 0,3 224 VN10-1253 1,1 259 VN10-1292 0,4 -7- Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung TIEU LUAN MOI download : skknchat@gmail.com Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung 225 VN10-1254 0,4 260 VN10-1293 0,6 226 VN10-1255 1,5 261 VN10-1295 0,7 227 VN10-1256 262 VN10-1296 0,3 228 VN10-1257 0,9 263 VN10-1297 0,5 229 VN10-1258 1,5 264 VN10-1298 0,6 230 VN10-1259 1,9 265 VN10-1299 0,7 231 VN10-1260 0,9 266 VN10-1300 232 VN10-1261 267 VN10-1301 1,3 233 VN10-1262 1,1 268 VN10-1302 1,3 234 VN10-1263 1,4 269 VN10-1303 1,5 235 VN10-1265 270 VN10-1304 0,8 236 VN10-1267 271 VN10-1305 237 VN10-1268 272 VN10-1306 238 VN10-1269 273 VN10-1307 0,8 239 VN10-1270 2,3 274 VN10-1308 1,7 240 VN10-1271 0,4 275 VN10-1309 0,5 241 VN10-1272 0,9 276 VN10-1310 0,8 Số thứ tự T n ch ng KT vòng Số thứ tự T n ch ng KT vòng 277 VN10-1311 0,6 312 VN10-1353 278 VN10-1312 0,4 313 VN10-1354 0,4 279 VN10-1313 0,5 314 VN10-1355 2,1 280 VN10-1314 0,3 315 VN10-1356 0,3 -8- Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung TIEU LUAN MOI download : skknchat@gmail.com Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung 281 VN10-1315 1,2 316 VN10-1357 0,4 282 VN10-1316 1,3 317 VN10-1359 0,5 283 VN10-1317 0,4 318 VN10-1360 1,8 284 VN10-1319 0,3 319 VN10-1361 1,1 285 VN10-1320 0,6 320 VN10-1362 0,6 286 VN10-1322 0,5 321 VN10-1363 287 VN10-1323 0,4 322 VN10-1364 0,4 288 VN10-1324 0,3 323 VN10-1366 1,2 289 VN10-1325 1,7 324 VN10-1367 1,3 290 VN10-1326 325 VN10-1368 0,3 291 VN10-1327 0,7 326 VN10-1369 0,4 292 VN10-1328 327 VN10-1370 0,5 293 VN10-1329 328 VN10-1371 0,6 294 VN10-1331 0,7 329 VN10-1372 0,9 295 VN10-1332 0,6 330 VN10-1373 296 VN10-1333 0,8 331 VN10-1374 0,8 297 VN10-1334 332 VN10-1376 298 VN10-1336 1,9 333 VN10-1377 0,8 299 VN10-1337 0,7 334 VN10-1378 300 VN10-1338 2,1 335 VN10-1379 0,7 301 VN10-1340 2,0 336 VN10-1380 2,1 302 VN10-1343 0,5 337 VN10-1381 1,4 -9- Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung TIEU LUAN MOI download : skknchat@gmail.com Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung 303 VN10-1344 1,4 338 VN10-1382 0,5 304 VN10-1345 1,2 339 VN10-1383 1,1 305 VN10-1346 340 VN10-1384 0,8 306 VN10-1347 1,1 341 VN10-1385 0,4 307 VN10-1348 0,7 342 VN10-1386 308 VN10-1349 0,6 343 VN10-1387 0,3 309 VN10-1350 344 VN10-1388 0,5 310 VN10-1351 0,3 345 VN10-1389 311 VN10-1352 0,8 346 VN10-1390 Số thứ tự Tên chủng KT vòng Số thứ tự Tên chủng KT vòng 347 VN10-1392 0,6 382 VN10-1435 0,7 348 VN10-1394 1,1 383 VN10-1436 0,6 349 VN10-1395 384 VN10-1437 1,4 350 VN10-1397 1,3 385 VN10-1439 0,5 351 VN10-1398 1,6 386 VN10-1440 0,9 352 VN10-1400 387 VN10-1441 0,4 353 VN10-1401 1,5 388 VN10-1442 1,3 354 VN10-1402 0,4 389 VN10-1443 0,3 355 VN10-1403 0,5 390 VN10-1444 1,1 356 VN10-1404 391 VN10-1445 0,5 357 VN10-1405 1,6 392 VN10-1447 0,4 358 VN10-1406 0,3 393 VN10-1448 0,3 - 10 - Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung TIEU LUAN MOI download : skknchat@gmail.com Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung 359 VN10-1407 394 VN10-1449 1,6 360 VN10-1408 0,6 395 VN10-1450 1,6 361 VN10-1410 0,7 396 VN10-1451 1,5 362 VN10-1411 0,6 397 VN10-1452 0,4 363 VN10-1412 398 VN10-1455 0,5 364 VN10-1413 0,5 399 VN10-1456 1,8 365 VN10-1415 1,2 400 VN10-1457 0,8 366 VN10-1417 0,4 401 VN10-1458 0,8 367 VN10-1418 1,5 402 VN10-1459 1,8 368 VN10-1421 403 VN10-1460 369 VN10-1422 0,3 404 VN10-1461 2,1 370 VN10-1423 0,3 405 VN10-1463 371 VN10-1424 1,1 406 VN10-1464 372 VN10-1425 1,6 407 VN10-1465 0,6 373 VN10-1426 1,1 408 VN10-1466 1,6 374 VN10-1427 409 VN10-1467 375 VN10-1428 410 VN10-1468 0,5 376 VN10-1429 0,5 411 VN10-1469 0,4 377 VN10-1430 1,3 412 VN10-1470 378 VN10-1431 413 VN10-1471 0,6 379 VN10-1432 1,1 414 VN10-1472 0,7 380 VN10-1433 0,8 415 VN10-1473 0,3 - 11 - Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung TIEU LUAN MOI download : skknchat@gmail.com Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung Luan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhungLuan.van.thac.si.khoa.hoc.nguyen.thi.hong.nhung