MINISTRY OF EDUCATION AND TRAINING MINISTRY OF AGRICULTURE AND RURAL DEVELOPMENT VIET NAM ACADEMY OF AGRICULTURAL SCIENCES MAN HONG PHUOC RESEARCH PRODUTION AN INACTIVATED VACCINE TO PREVENT NERVOUS N[.]
MINISTRY OF EDUCATION AND TRAINING MINISTRY OF AGRICULTURE AND RURAL DEVELOPMENT VIET NAM ACADEMY OF AGRICULTURAL SCIENCES - MAN HONG PHUOC RESEARCH PRODUTION AN INACTIVATED VACCINE TO PREVENT NERVOUS NECROSIS DISEASE IN GROUPER (Epinephelus spp.) Research major: Biotechnology Code: 942 02 01 SUMMARY OF DOCTORAL THESIS IN AGRICULTURE HANOI, 2023 The study was completed at: VIET NAM ACADEMY OF AGRICULTURAL SCIENCES Scientific instructors: Assoc Prof Ph.D Pham Thi Tam Assoc Prof Ph.D Dong Van Quyen Review 1: Assoc Prof Ph.D Vo Thi Bich Thuy Review 2: Assoc Prof Ph.D Kim Van Van Review 3: Assoc Prof Ph.D Nguyen Quang Huy The thesis was defended at the Institute's Thesis Evaluation Council at the Vietnam Academy of Agricultural Sciences Time: , date: The thesis can be found at the library: National Library of Vietnam Library of Vietnam Academy of Agricultural Sciences INTRODUCTION RATIONALE OF THE STUDY The aquaculture industry is considered one of the key economic sectors of Vietnam and has continuously grown in recent years in terms of both area and output Total seafood production in 2022 is estimated at 9,026.3 thousand tons, up 2.7% compared to 2021, of which aquaculture production is estimated at 5,163.7 thousand tons, up 6.3% compared to 2021 However, the aquaculture industry in the world as well as in Vietnam always faces difficulties and challenges, especially in recent years, viral diseases in aquatic animals such as zoonotic diseases grass carp haemorrhage, spring virus disease in carp, grouper Iridovirus disease, infectious pancreatic necrosis, infectious spleen and kidney necrosis, infectious haematopoietic necrosis, viral hematoma causing serious economic losses to aquaculture Viral nervous necrosis (VNN) is detected in most countries around the world, affecting more than 120 marine fish species, many of which are of high economic value The disease has been determined to be caused by a nervous necrosis virus (NNV) Fish suffering from nervous necrosis disease appear with typical symptoms: swimming without orientation, dark body, anorexia, 80-100% of infected fish may die after 3-5 days Diseases in aquaculture tend to increase over the years, with a wide range of infections, high incidence rates, diverse types, and long onset times Aquaculture is an urgent problem Disease control by microbial products, immunostimulants, and vaccines is increasingly being applied in ecological farming models In particular, using vaccines is an effective and safe preventive measure to prevent diseases caused by viruses and bacteria Currently, most commercial aquatic vaccines are still inactivated vaccines because of their safety The virus causes severe neurological necrosis disease in the larval, fry, and fingerling stages with a relative percent survival up to 100%, therefore, the vaccine against nervous necrosis disease is often used for fish by immersion vaccination Stemming from the above theoretical basis and practical needs, the topic: "Research production of inactivated vaccines against nervous necrosis disease for grouper (Epinephelus spp.)" was conducted to create inactivated vaccine against neurodegenerative disease in grouper 2 RESEARCH OBFECTIVE General objective: Study on inactivated vaccine against nervous necrosis disease for grouper from virus isolated in the North, Vietnam Particular objective: Isolation and selection of a virus strain causing nervous necrosis as a parent species for the preparation of a vaccine against nervous necrosis disease for grouper Producing inactivated vaccine against nervous necrosis disease for grouper Develop a process to check vaccine quality SCIENTIFIC AND PRACTICAL SIGNIFICANCE OF THE THESIS 3.1 Significance scientific The thesis has produced an inactivated vaccine to prevent nervous necrosis disease in grouper with the following steps: isolation, selection of seed strains as raw materials for vaccine production, evaluation of the original strains, and virus culture on cells, inactivate the virus, determine the conditions for the production of semi-finished vaccines, and evaluate the quality of the semi-finished vaccines The research results are scientific data, providing more references for the production of inactivated vaccines against diseases for marine fish with high economic value 3.2 Significance practical The thesis has successfully researched the inactivated acacia alum vaccine with safety and efficacy criteria in the prevention of nervous necrosis in grouper Object and scope of research 4.1 Research subjects: Viral strains causing nerve necrosis were isolated from some species of grouper farmed in some provinces in the North 4.2 Research scope: Virus strains that cause neurological necrosis disease were isolated from marine fish cultured in the waters around Cat Ba Island, Lan Ha Bay, Cat Hai (Hai Phong), Van Don, Quang Yen (Quang Ninh), and marine areas Dong Chau (Thai Binh), Hai Thinh, Nghia Hung (Nam Dinh) CONTRIBUTIONS OF THE NEW THESIS The thesis has comprehensively studied the characteristics of the original seed strain for the production of vaccines against nervous necrosis disease in grouper, including purity, protective immunogenicity, and stability Genetics and yield after culture on GS01 cells The thesis has made a colloidal alum inactivated vaccine by TB05 virus isolated in Thai Binh province, alum inactivated vaccine is used for fish by immersion vaccination, 100% safe rate, relative percent survival 75.8% after months LAYOUT OF THE THESIS The thesis consists of: Introduction pages, Overview 27 pages, Objects and research methods 16 pages, Research results 53 pages, Conclusion and recommendations page, 250 references, 22 tables, 18 pictures Chapter DOCUMENTARY OVERVIEW 1.1 Several biological characteristics of grouper Groupers belong to the family Serranidae, subfamily Epinephelinae, genus Epinephelus, English name: groupers There are all 87 species listed in the genus Epinephelus (E.), 63 species of Epinephelus have been discovered in the Indian and Pacific regions alone, grouper is a bottomdwelling fish in coral reefs and rocks Hard, warm waters, distributed mainly in tropical and subtropical seas and rarely found in temperate seas The suitable temperature for grouper species to grow is 25-30 degree celsius, salinity from 11-41‰ Almost all grouper species are hermaphrodites The gonads were initially undifferentiated, then they were differentiated into ovaries in all individuals After maturing into females, they undergo a sex change into males, transforming the ovaries into testes Natural sex change in grouper species occurs between and 11 months of age, depending on the species Grouper tends to lay eggs in early spring and summer Although some species, such as grouper, breed year-round, most species of grouper breed between January and May 1.2 Epidemiology of nervous necrosis disease in grouper in the world and Vietnam Viral nervous necrosis has been officially reported worldwide, with the exception of South America VNN appeared in Asian countries such as India, Indonesia, China, Japan, Korea, Malaysia, Philippines, Thailand, Vietnam; Oceania such as Australia, Tahiti; Mediterranean region such as France, Greece, Italy, Malta, Portugal, Spain, Tunisia or other countries such as, United Kingdom, Norway, Caribbean Islands and North America In Asia, mass mortality has been recorded in the rearing stages of grouper in Singapore, red-spotted grouper (E akaara) and striped bass (Pseudocaranx dentex) in Japan, and flathead headfish (Mugil cephalus) in China, as well as red snapper (Sciaenops ocellatus) in Israel In North America, VNN has been detected in white seabass (Atractoscion nobilisthe) and Atlantic cod In addition, nervous necrosis disease infects not only marine fish but also many freshwater aquatic animals In Vietnam, some species of grouper infected with nervous necrosis disease have been detected, including: E coioides, E fuscogutatus, E tauvina, E lanceolatus, E malabaricus in Khanh Hoa, E coioides in Cat Ba (Hai Phong) and Cua Hoi (Nghe An) Nervous necrosi disease in grouper in Vietnam was first detected in 2002 in cages at Van Don, Quang Ninh 1.3 An overview of the virus that causes nervous necrosis The causative agent of neuroleptic disease in fish was identified as Betanodavirus, Virus without envelope, spherical, 25-30 nm in diameter, with tetrahedral symmetry, protein coat consisting of 180 proteins with mass 42 kDa The genome of Betanodavirus has a single-stranded, positive-stranded RNA structure consisting of two subunits: The large subunit of the genome contains RNA1 (3.1 kb) and the small subunit of the genome contains RNA2 (1.4 kb), on which RNA2 contains a reading frame open (ORF) for an envelope protein that also contains two highly conserved regions, T2 (870 bp) and T4 (420 bp) The Betanodavirus genus is classified into main genotypes, including: striped flounder nerve necrosis virus (SJNNV), tiger puffer nerve necrosis virus (TPNNV), grouper nerve necrosis virus red spot (RGNNV) and halibut neural necrosis virus (BFNNV) The virus enters host cells by means of horizontal and vertical transmission and produces a full-fledged infection by entering sensitive cells of the central nervous system including the brain and spinal cord life and retina leads to clinical manifestations of fish when infected such as: swimming without orientation, dark body, bulging eyes, curved body 1.4 Overview aquatic vaccines Vaccines in aquaculture are considered an effective preventive measure against many diseases and have recently gained popularity According to the causative agent, aquatic vaccines can be classified into bacterial vaccines, viral vaccines and parasitic vaccines, they can also be classified according to the composition including vaccines monovalent polyvalent or mixed vaccines, or classified by nature such as live attenuated vaccines, inactivated or subunit vaccines, acid vaccines nucleic, recombinant vaccines It should be noted that each vaccine has advantages and disadvantages, and different vaccines need to be developed and used for different pathogens and animals The method of using vaccines in aquaculture is usually administered by injection, immersion vaccine and oral vaccine Each type also has advantages and disadvantages and is suitable for different audiences Chapter MATERIALS, CONTENTS AND METHODS STUDY 2.1 Research Materials 2.1.1 Fish to disease Grouper samples were collected in coastal aquaculture areas around Cat Ba Island, Lan Ha Bay, Cat Hai (Hai Phong), Van Don, Quang Yen (Quang Ninh), Dong Chau (Thailand) waters Binh), the sea area of Hai Thinh, Nghia Hung (Nam Dinh) 2.1.2 Experimental fish The orange-spotted grouper (Epinephelus coioides) 2-2.5 cm long, the tiger grouper (Epinephelus fuscoguttatus) 2-2.5 cm long and the mouse grouper (Cromileptes altivelis) 5.5-6 cm long were provided by the Centre Country Northern seafood varieties, Xuan Dan, Cat Ba, Hai Phong 2.1.3 Cell GS01 cells (grouper spleen cells) were provided by Wageningen University, Netherlands 2.2 Research content 2.2.1 Isolation and selection of a virus strain causing nervous necrosis as a parent species for the preparation of a vaccine against nervous necrosis disease for grouper 2.2.2 Producing inactivated vaccine against nervous necrosis disease for grouper 2.2.3 Develop a process to check vaccine quality 2.3 Location and time of study 2.3.1 Location: The study was carried out at the Microbiology laboratory - Faculty of Biotechnology, Hanoi Open University and the Department of Molecular Microbiology - Institute of Biotechnology, Vietnam Academy of Science and Technology 2.3.2 Research period: From April 2016 to April 2020 2.4 Research methods 2.4.1 Sample collection and processing methods 2.4.2 Virus isolation technique on GS01 susceptible cells 2.4.3 Total RNA extraction technique 2.4.4 Reverse Transcriptase PCR (RT-PCR) 2.4.5 PCR product purification method 2.4.6 Agarose gel electrophoresis 2.4.7 DNA sequencing method 2.4.8 Method to determine TCID50, LD50 of NNV 2.4.9 Determining the conditions for virus propagation 2.4.10 Virus inactivation method 2.4.11 Method of making alum colloidal vaccine 2.4.12 Cell neutralization method 2.4.13 Immunization method 2.4.14 Indirect ELISA reaction 2.4.15 Powerful challenge method 2.4.16 Vaccine safety assessment 2.4.17 Evaluation of vaccine efficacy under experimental conditions 2.4.18 Data processing methods Chapter RESULTS AND DISCUSSION 3.1 Results of isolation and selection of original strains for the production of vaccines against nervous necrosis disease for grouper 3.1.1 Isolation of virus causing nervous necrosis disease from grouper suspected of infection in Northern provinces, Vietnam In total 60 samples of grouper with symptoms of neuroleptic disease were collected from waters around Cat Ba island, Lan Ha bay area, Cat Hai (Hai Phong), Van Don sea area, Quang Yen province Quang Ninh), Dong Chau sea (Thai Binh), Hai Thinh and Nghia Hung (Nam Dinh) Figure 3.1 Samples of grouper suspected of being infected with nervous necrosis disease A: healthy grouper; B and C: sample of grouper suspected of having VNN Table 3.1 Results of screening for T4 gene in fish samples suspected of being infected with NNV Number of samples Positive Location Number of samples positive for T4 gene rate (%) QN 16 50,00 HP 15 40,00 NĐ 14 57,14 TB 15 10 66,67 Total 60 32 53,33 Figure 3.2 Electrophoresis images of RT-PCR products of some samples suspected to be infected with NNV Wells 1-5: samples suspected of NNV infection; M: DNA ladder standard 1kb Screening results by molecular biology from 60 samples of grouper suspected of being infected with nervous necrosis disease, 32 samples found that the gene fragment was 420 bp in size, corresponding to the size of the T4 gene fragment of the virus causing the nervous necrosis disease T4 positive samples were used to isolate the virus on GS01 susceptible cells Viruses multiply in cells and are assessed by cytolytic effects (CPE) Figure 3.3 Image GS01 cell A: GS01 cells have not been infected with the NNV sample B: GS01 cells after 120 hours of infection with NNV Table 3.2 Results of culture of patient samples on GS01 cells Nume rical order Sample symbol Cytopathogenic effect (CPE) over time (hours) 24 48 72 96 120 144 168 192 QN02 _ _ + + + ++ ++ ++++ QN04 _ + + + ++ +++ ++++ ++++ QN05 _ + + + ++ +++ ++++ ++++ QN07 _ + + + ++ ++ ++ +++ QN08 _ _ + + + ++ ++ ++++ QN10 _ + + + ++ +++ ++++ ++++ QN12 _ _ + + + ++ ++ ++++ QN14 _ + + + ++ +++ ++++ ++++ HP02 _ + + + ++ +++ ++++ ++++ 10 HP03 _ _ + + + ++ ++ +++ 11 HP05 _ + + + ++ +++ ++++ ++++ 12 HP06 _ _ + + + ++ ++ +++ 13 HP07 _ _ + + + ++ ++ +++ 14 HP09 _ + + + ++ +++ ++++ ++++ 15 HP12 _ + + + ++ +++ ++++ ++++ 16 HP15 _ _ + + + ++ ++ +++ 17 NĐ01 _ + + + ++ +++ ++++ ++++ 18 NĐ03 _ _ + + + ++ ++ ++ 19 NĐ04 _ _ + + + ++ ++ ++++ 20 NĐ05 _ _ + + + ++ ++ ++ 21 NĐ07 _ + + + ++ ++ +++ ++++ 22 NĐ08 _ + + + ++ ++ +++ ++++ 23 NĐ10 _ + + + ++ +++ ++++ ++++ 24 NĐ12 _ _ + + + ++ +++ +++ 11 HP07 100 100 100 73,3 66,7 53,3 53,3 13,3 13,3 10-6,2 NĐ08 100 100 100 86,7 86,7 66,7 53,3 30 15 10-6,5 NĐ10 100 100 100 93,3 66,7 53,3 30 26,6 13,3 10-5,5 TB05 100 100 100 93,3 93,3 80 66,7 53,3 33,3 10-7,5 TB08 66,7 53,3 30 13,3 6,7 6,7 6,7 0 10-1,5 ĐC 0 0 0 K 0 Note: K not done Results of determination of virus virulence on cultured cells and fish identified samples TB05 and HP02 with strong virulence on cells and fish with TCID50 and LD50 doses of 10-6,8TCID50/mL, respectively and 107,5 LD50/mL, two highly virulent samples, TB05 and HP02, were selected for species identification by molecular biology method The results of species identification of two samples TB05 and HP02 through T4 gene sequencing with RNA2 sequences of nerve necrosis virus strains were published on Genebank This result allows to conclude that TB05 and HP02 samples are nervous necrosis virus Table 3.5 Compare the similarity of the T4 gene sequences of HP02 and TB05 samples with those of GenBank Percentage of sequences compared to GenBank (%) Similarit y (%) KU705815.1 Mouse grouper nervous necrosis virus isolate VI37 segment ARN2, complete sequence 87 99,19 MG874758.1 Epinephelus coioides nervous necrosis virus isolate HN1 segment ARN2, complete sequence 87 98,64 AF283554.1 Yellow grouper nervous necrosis virus major coat protein gene, partial cds 87 98,64 Code GenBank Strain name and sequencing gene Samples TB05 12 MF144241.1 Einephelus coioides nervous necrosis virus strain KS1 segment ARN2, complete sequence 87 98,37 KY930894.1 Betanodavirus sp strain KS1 segment ARN2 capsid protein mARN, complete cds 87 98,37 KU705815.1 Mouse grouper nervous necrosis virus isolate VI37 segment ARN2, complete sequence 92 98,47 MG874758.1 Epinephelus coioides nervous necrosis virus isolate HN1 segment ARN2, complete sequence 92 97,95 MF144241.1 Einephelus coioides nervous necrosis virus strain KS1 segment ARN2, complete sequence 90 98,18 KY930894.1 Betanodavirus sp strain KS1 segment ARN2 capsid protein mARN, complete cds 90 98,18 Samples HP02 3.1.3 Results of selection of parent strains for the preparation of vaccines against nervous necrosis disease in grouper The effectiveness of the vaccine depends on the quality of the parent strain with the following characteristics: antigenic representation, effectiveness in stimulating protective antibodies, purity level, propagation efficiency on susceptible cells, stable in ability to stimulate protective antibody production and heredity Table 3.6 Antigen neutralizing antibody titers of isolates Virus symbol Neutralizing antibody titre HP02 TB05 Virus symbol Neutralizing antibody titre HP02 TB05 13 QN02 256 512 NĐ01 64 128 QN04 128 256 NĐ02 64 128 QN05 128 256 NĐ03 128 QN07 256 128 NĐ04 128 256 QN08 128 128 NĐ05 64 256 QN10 256 512 NĐ08 256 512 QN12 128 128 NĐ10 64 128 QN14 128 128 NĐ12 128 HP02 256 512 TB02 128 HP03 128 512 TB03 128 HP05 128 128 TB05 256 512 HP06 32 128 TB07 128 HP07 256 128 TB08 512 HP09 64 128 TB10 64 128 HP12 64 128 TB11 128 HP15 64 256 TB13 64 128 Table 3.7 Purity test results of the original variety Evaluation environment Test times Followup time (days) NNV TB05 Casecontrol Master seed PPLO (pleuropn Summary eumonialike organism) Blood agar (plate) Mushro om agar (plate) Meat soup (tube) - - - - qualified - - - - qualified - - - - qualified - - - - - Notes: - negative 14 Table 3.8 Results of determination of virus titers of the original strain Master Number Virus Infectious Viral titer Mean viral seed of tests dilution (TCID50/mL) dose titer (mL) (TCID50/mL) NNV TB05 Casecontrol 10-6,7 10-1 – 10-8 0,1 10-1 – 10-8 0,1 10-6,9 10-1 – 10-8 0,1 10-6,8 10-1 – 10-8 buffer PBS 0,1 buffer PBS negative 10-6,8 negative Table 3.9 Results of testing the stability of strain NNV TB05 Master seed NNV TB05 Case-control Transplantation time Viral titer (TCID50/mL) 10-6,8 10-6,7 10-6,8 10-6,9 10-6,8 10-6,8 10-6,9 106,8 10-6,7 10 10-6,8 negative Master seed viral titer (TCID50/mL) 10-6,8 negative 15 Figure 3.4 Electrophoresis results on 1% agarose gel M: standard DNA scale kb; 1-10: PCR products amplify virus samples in 10 generations of culture; 11: negative control; 12: PCR product amplifies TB05 virus sample | | | | | | | | | | | | .| | f1 AGTGAGACACCTGAAGAGACCACCGCTCCCATCATGACACAAGGTTCCCTGTACAACGATTCCCTTTCCA f2 AGTGAGACACCTGAAGAGACCACCGCTCCCATCATGACACAAGGTTCCCTGTACAACGATTCCCTTTCCA f3 AGTGAGACACCTGAAGAGACCACCGCTCCCATCATGACACAAGGTTCCCTGTACAACGATTCCCTTTCCA f4 AGTGAGACACCTGAAGAGACCACCGCTCCCATCATGACACAAGGTTCCCTGTACAACGATTCCCTTTCCA f5 AGTGAGACACCTGAAGAGACCACCGCTCCCATCATGACACAAGGTTCCCTGTACAACGATTCCCTTTCCA f6 AGTGAGACACCTGAAGAGACCACCGCTCCCATCATGACACAAGGTTCCCTGTACAACGATTCCCTTTCCA f7 AGTGAGACACCTGAAGAGACCACCGCTCCCATCATGACACAAGGTTCCCTGTACAACGATTCCCTTTCCA f8 AGTGAGACACCTGAAGAGACCACCGCTCCCATCATGACACAAGGTTCCCTGTACAACGATTCCCTTTCCA f9 AGTGAGACACCTGAAGAGACCACCGCTCCCATCATGACACAAGGTTCCCTGTACAACGATTCCCTTTCCA f10AGTGAGACACCTGAAGAGACCACCGCTCCCATCATGACACAAGGTTCCCTGTACAACGATTCCCTTTCCA 80 90 100 110 120 130 140 | | | | | | | | | | | | | | f1 CAAATGACTTCAAGTCCATCCTCCTAGGATCCACGCCACTGGATATTGCCCCTGATGGAGCAGTCTTCCA f2 CAAATGACTTCAAGTCCATCCTCCTAGGATCCACGCCACTGGATATTGCCCCTGATGGAGCAGTCTTCCA f3 CAAATGACTTCAAGTCCATCCTCCTAGGATCCACGCCACTGGATATTGCCCCTGATGGAGCAGTCTTCCA f4 CAAATGACTTCAAGTCCATCCTCCTAGGATCCACGCCACTGGATATTGCCCCTGATGGAGCAGTCTTCCA f5 CAAATGACTTCAAGTCCATCCTCCTAGGATCCACGCCACTGGATATTGCCCCTGATGGAGCAGTCTTCCA f6 CAAATGACTTCAAGTCCATCCTCCTAGGATCCACGCCACTGGATATTGCCCCTGATGGAGCAGTCTTCCA f7 CAAATGACTTCAAGTCCATCCTCCTAGGATCCACGCCACTGGATATTGCCCCTGATGGAGCAGTCTTCCA 16 f8 CAAATGACTTCAAGTCCATCCTCCTAGGATCCACGCCACTGGATATTGCCCCTGATGGAGCAGTCTTCCA f9 CAAATGACTTCAAGTCCATCCTCCTAGGATCCACGCCACTGGATATTGCCCCTGATGGAGCAGTCTTCCA f10CAAATGACTTCAAGTCCATCCTCCTAGGATCCACGCCACTGGATATTGCCCCTGATGGAGCAGTCTTCCA 150 160 170 180 190 200 210 | | | | | | | | | | | | | | f1 GCTGGACCGTCCGCTGTCCATCGACTACAGCCTTGGAACTGGAGATGTTGATCGTGCTGTTTATTGGCAC f2 GCTGGACCGTCCGCTGTCCATCGACTACAGCCTTGGAACTGGAGATGTTGATCGTGCTGTTTATTGGCAC f3 GCTGGACCGTCCGCTGTCCATCGACTACAGCCTTGGAACTGGAGATGTTGATCGTGCTGTTTATTGGCAC f4 GCTGGACCGTCCGCTGTCCATCGACTACAGCCTTGGAACTGGAGATGTTGATCGTGCTGTTTATTGGCAC f5 GCTGGACCGTCCGCTGTCCATCGACTACAGCCTTGGAACTGGAGATGTTGATCGTGCTGTTTATTGGCAC f6 GCTGGACCGTCCGCTGTCCATCGACTACAGCCTTGGAACTGGAGATGTTGATCGTGCTGTTTATTGGCAC f7 GCTGGACCGTCCGCTGTCCATCGACTACAGCCTTGGAACTGGAGATGTTGATCGTGCTGTTTATTGGCAC f8 GCTGGACCGTCCGCTGTCCATCGACTACAGCCTTGGAACTGGAGATGTTGATCGTGCTGTTTATTGGCAC f9 GCTGGACCGTCCGCTGTCCATCGACTACAGCCTTGGAACTGGAGATGTTGATCGTGCTGTTTATTGGCAC f10GCTGGACCGTCCGCTGTCCATCGACTACAGCCTTGGAACTGGAGATGTTGATCGTGCTGTTTATTGGCAC 220 230 240 250 260 270 280 | | | | | | | | | | | | | | f1 CTCAAGAAGTTTGCTGGAAATGCTGGCACACCTGCAGGCTGGTTTCGCTGGGGCATCTGGGACAACTTCA f2 CTCAAGAAGTTTGCTGGAAATGCTGGCACACCTGCAGGCTGGTTTCGCTGGGGCATCTGGGACAACTTCA f3 CTCAAGAAGTTTGCTGGAAATGCTGGCACACCTGCAGGCTGGTTTCGCTGGGGCATCTGGGACAACTTCA f4 CTCAAGAAGTTTGCTGGAAATGCTGGCACACCTGCAGGCTGGTTTCGCTGGGGCATCTGGGACAACTTCA f5 CTCAAGAAGTTTGCTGGAAATGCTGGCACACCTGCAGGCTGGTTTCGCTGGGGCATCTGGGACAACTTCA f6 CTCAAGAAGTTTGCTGGAAATGCTGGCACACCTGCAGGCTGGTTTCGCTGGGGCATCTGGGACAACTTCA f7 CTCAAGAAGTTTGCTGGAAATGCTGGCACACCTGCAGGCTGGTTTCGCTGGGGCATCTGGGACAACTTCA f8 CTCAAGAAGTTTGCTGGAAATGCTGGCACACCTGCAGGCTGGTTTCGCTGGGGCATCTGGGACAACTTCA f9 CTCAAGAAGTTTGCTGGAAATGCTGGCACACCTGCAGGCTGGTTTCGCTGGGGCATCTGGGACAACTTCA f10CTCAAGAAGTTTGCTGGAAATGCTGGCACACCTGCAGGCTGGTTTCGCTGGGGCATCTGGGACAACTTCA 290 300 310 320 330 340 350 17 | | | | | | | | | | | | | | f1 ATAAGACGTTCACAGATGGCGTTGCCTACTACTCTGATGAGCAGCCCCGTCAAATCCTGCTGCCTGTTGG f2 ATAAGACGTTCACAGATGGCGTTGCCTACTACTCTGATGAGCAGCCCCGTCAAATCCTGCTGCCTGTTGG f3 ATAAGACGTTCACAGATGGCGTTGCCTACTACTCTGATGAGCAGCCCCGTCAAATCCTGCTGCCTGTTGG f4 ATAAGACGTTCACAGATGGCGTTGCCTACTACTCTGATGAGCAGCCCCGTCAAATCCTGCTGCCTGTTGG f5 ATAAGACGTTCACAGATGGCGTTGCCTACTACTCTGATGAGCAGCCCCGTCAAATCCTGCTGCCTGTTGG f6 ATAAGACGTTCACAGATGGCGTTGCCTACTACTCTGATGAGCAGCCCCGTCAAATCCTGCTGCCTGTTGG f7 ATAAGACGTTCACAGATGGCGTTGCCTACTACTCTGATGAGCAGCCCCGTCAAATCCTGCTGCCTGTTGG f8 ATAAGACGTTCACAGATGGCGTTGCCTACTACTCTGATGAGCAGCCCCGTCAAATCCTGCTGCCTGTTGG f9 ATAAGACGTTCACAGATGGCGTTGCCTACTACTCTGATGAGCAGCCCCGTCAAATCCTGCTGCCTGTTGG f10ATAAGACGTTCACAGATGGCGTTGCCTACTACTCTGATGAGCAGCCCCGTCAAATCCTGCTGCCTGTTGG 360 370 380 390 400 410 420 | | | | | | | | | | | | | | f1 CACTGTCTTCACCCGTGTTGATGGTTGGGGCGGAGGTAGCCTGACGTCACAGGTCTTCGAAGGGGAGGGG f2 CACTGTCTTCACCCGTGTTGATGGTTGGGGCGGAGGTAGCCTGACGTCACAGGTCTTCGAAGGGGAGGGG f3 CACTGTCTTCACCCGTGTTGATGGTTGGGGCGGAGGTAGCCTGACGTCACAGGTCTTCGAAGGGGAGGGG f4 CACTGTCTTCACCCGTGTTGATGGTTGGGGCGGAGGTAGCCTGACGTCACAGGTCTTCGAAGGGGAGGGG f5 CACTGTCTTCACCCGTGTTGATGGTTGGGGCGGAGGTAGCCTGACGTCACAGGTCTTCGAAGGGGAGGGG f6 CACTGTCTTCACCCGTGTTGATGGTTGGGGCGGAGGTAGCCTGACGTCACAGGTCTTCGAAGGGGAGGGG f7 CACTGTCTTCACCCGTGTTGATGGTTGGGGCGGAGGTAGCCTGACGTCACAGGTCTTCGAAGGGGAGGGG f8 CACTGTCTTCACCCGTGTTGATGGTTGGGGCGGAGGTAGCCTGACGTCACAGGTCTTCGAAGGGGAGGGG f9 CACTGTCTTCACCCGTGTTGATGGTTGGGGCGGAGGTAGCCTGACGTCACAGGTCTTCGAAGGGGAGGGG f10CACTGTCTTCACCCGTGTTGATGGTTGGGGCGGAGGTAGCCTGACGTCACAGGTCTTCGAAGGGGAGGGG Figure 3.5 Comparison of T4 gene sequences of 10 generations of viruses From the obtained results, this study isolated and selected the original strain TB05 from NNV strains isolated from patient samples with nervous necrosis disease in grouper cultured in the North, Vietnam 3.2 Results of making inactivated alum colloidal vaccine to prevent neuronecrosis disease for grouper on laboratory scale 3.2.1 Determine the multiplicity of infection (MOI) in susceptible cells and the appropriate time to harvest the virus 18 The NNV TB05 strain with TCID50= 10-6,8/mL was infected with GS01 cells, with infectious doses (MOI) of 0,1; 0,01 and 0,001, the culture temperature was 250C Figure 3.6 The results of determining the infectious dose (MOI), statistical significance is done by comparing the value of each MOI value with the value of MOI 0.1 The average value of three independent tests is shown An asterisk indicates a significant difference: (**p ≤ 0.001) Figure 3.7 Status of cell cultures of the nervous necrosis virus in different tracking times A: uninfected cells; B: 3rd day after infection; C: 4th day after infection; D: 5th day after infection From the results obtained in the experiment, it can be concluded that the MOI value of 0.01 is suitable for virus propagation, the suitable virus harvesting time is days after infection