Construction of crisprcas9 vector for silencing cif1 gene of tomato (khóa luận tốt nghiệp)

VIETNAM NATIONAL UNIVERSITY OF AGRICULTURE FACULTY OF BIOTECHNOLOGY UNDERGRADUATE THESIS TITLE CONSTRUCTION OF CRISPR/CAS9 VECTOR FOR SILENCING CIF1 GENE OF TOMATO HANOI – 2021 VIETNAM NATIONAL UNIVERSITY OF AGRICULTURE FACULTY OF BIOTECHNOLOGY UNDERGRADUATE THESIS TITLE CONSTRUCTION OF CRISPR/CAS9 VECTOR FOR SILENCING CIF1 GENE OF TOMATO STUDENT: Nguyen Thi Bich Ngoc MAJOR: Biotechnology SUPERVISORS: Huynh Thi Thu Hue, PhD Institue of Genome Research, VAST Tran Thi Hong Hanh, MSc Vietnam National University of Agriculture HANOI – 2021 COMMITMENT I hereby undertake that this is my research project under the scientific guidance of PhD Huynh Thi Thu Hue and MSc.TranThi Hong Hanh The results and data in this thesis have not been published by anyone in any way This is part of the findings of the Genome Biodiversity Laboratory - Institute of Genome Research I confirm that all information and data from articles and sources of other authors contain full citations and references from official sources I take full responsibility for this guarantee Hanoi Student Nguyen Thi Bich Ngoc i ACKNOWLEDGMENTS First and foremost, I would like to express my deep thanks to PhD Huynh Thi Thu Hue, Assoc Prof Nguyen Xuan Canh, MSc Tran Thi Hong Hanh, who helped me with my graduation thesis They taught me wholeheartedly as well as always created the most favorable conditions for me during the experiments to complete this graduation thesis I would like to express my sincere thanks to the Vietnam National University of Agriculture, the Faculty Board and the teachers in the Faculty of Biotechnology for creating an interesting learning environment and providing me with invaluable knowledge as valuable experiences during the past years During the course of the thesis at the Laboratory of Genome Biodiversity, Institute of Genome Research, Vietnam Academy of Science and Technology (VAST) with the enthusiasm of PhD Huynh Thi Thu Hue and staff of laboratory helped me complete my thesis and draw me a lot of experience They are really dedicated to the profession, devote their best and have inspired me great inspiration in scientific research Once again, I would like to express my deep thanks to the people who helped me to complete my thesis, and the leadership of the Institute of Genome Research for creating conditions for me to work here In the end, it is impossible not to mention my parents I would like to express my deep thanks to my parents who always supported and encouraged me throughout the thesis making process and life in general Once again, I would like to send my sincere thanks to everyone! Student Nguyen Thi Bich Ngoc ii TABLE OF CONTENTS ACKNOWLEDGMENTS ii TABLE OF CONTENTS iii LIST OF TABLES v LIST OF FIGURES vi LIST OF ABBREVIATIONS vii ABSTRACT ix CHAPTER I INTRODUCTION 1.1 Introduction 1.2 Objectives CHAPTER II LITERATURE REVIEW 2.1 General introduction of Tomato 2.1.1 Overview 2.1.2 Taxonomy 2.1.3 Plant characteristics 2.1.4 Tiny-Tim Tomato 2.2 Studies of tomatoes 2.2.1 Researches on disease resistance and yield enhancement 2.2.2 Researches on fruit quality 2.3 CIF1 gene in plants 10 2.4 Biological techniques for gene editing technology 12 2.4.1 ZFNs and TALENs 12 2.4.2 CRISPR/Cas9 14 CHAPTER III MATERIALS AND METHODS 17 3.1 Time and place of study 17 3.2 Materials 17 3.2.1 Leaf samples of Tiny-Tom tomato varieties 17 3.2.2 Vector and primer 17 3.2.3 Strains of bacteria: E.coli and A tumefaciens 18 3.2.4 Chemicals and reagents 18 iii 3.2.5 Equipment 19 3.3 Methods 20 3.3.1 Genome DNA extraction 20 3.3.2 Specific gRNA designing for CIF1 gene 20 3.3.3 Ligation gRNA into pRGEB31 vectors 22 3.3.4 Plasmid transformation into E.coli by heat shock 24 3.3.5 PCR technique check 24 3.3.6 Plasmid extraction 25 3.3.7 Plasmid transformation into A tumefaciens cells by electrical impulses 26 3.3.8 Sanger DNA sequencing 26 CHAPTER IV RESULTS AND DISCUSSION 27 4.1 Total DNA extraction of Tiny-Tom tomato 27 4.2 Exon region amplifying and sequencing 27 4.3 gRNA specific designing to CIF1 gene 29 4.4 Transformation of E.coli strain with gRNA-CRISPR/Cas9 vector 30 4.4.1 Colonies selection containing recombinant plasmids by PCR 30 4.4.2 Sequencing result of CRISPR/CAS9-CIF1 31 4.5 Transformation of A tumefaciens strains with gRNA-CRISPR/Cas9 vector 33 CHAPTER V CONCLUSION AND RECOMMENDATIONS 35 5.1 Conclusion 35 5.2 Recommendations 35 REFERENCES 36 iv LIST OF TABLES Table 3.1 List of primers 18 Table 3.2 Equipments 19 Table 3.3 Composition of PCR reaction 21 Table 3.4 The composition reaction denaturation and renaturation created SlCIF1-G1 and SlCIF1-G2 23 Table 3.5 Components that cut- ligation the vector and heating cycle 23 Table 3.6 Components PCR multiply the CIF1-G1 fragment 24 Table 3.7 Components PCR multiply the CIF1-G2 fragment 25 Table 4.1 The sequence of gRNAs 30 v LIST OF FIGURES Figure 1.1 Tomato (Solanum lycopersicum) Figure 2.2 Tiny-Tim Tomatoes Figure 2.3 CIF1 gene in Tomato 12 Figure 2.4 Mechanism of CRISPR/Cas9 systems 15 Figure 3.1 Schematic structure of pRGEB31 vector 17 Figure 3.2 Thermal cycle 21 Figure 3.3 Schematic of duplication and insertion of gRNA into pRGEB31 vector 22 Figure 3.4 Thermal cycling 25 Figure 4.1 Total DNA of leaf samples 27 Figure 4.2 The optimal PCR reaction for exon of SlCIF1 gene 28 Figure 4.3 Purified PCR products and sequence of exon SlCIF1 29 Figure 4.4 PCR checks for colonies containing structures pRGEB31-CIF1G1, pRGEB31-CIF1G2 31 Figure 4.5 Sequencing gRNA on pRGEB31-CIF1-G2 vector number 1, 2, 4, 32 Figure 4.6 Plasmid extraction and plasmid contains pRGEB31- CIF1-G2 structures in PCR reaction 33 vi LIST OF ABBREVIATIONS Abbreviations Definitions AAT Alpha-1 Antitrypsin bp basepair Cas CRISPR-associated CDS Coding sequence CIF1 Cell wall inhibitor of β-fructosidase CIN Cytoplasmid invertases CWI/CWIN Cell wall invertases CRISPR Clustered Regularly Interspaced Short Palindromic Repeats crRNA CRISPR RNA DBS DNA double-strand break DNA Deoxyribonucleic Acid FIX Factor IX gRNA Guide RNA INVINH Invertase inhibitors iPS Induced pluripotent stem cells MG Mature green PAM Protospacer adjacent motif PB PiggyBac vector PCR Polymerase Chain Reaction R Rip rAAV Recombinant adeno-associated virus RIN Ripening inhibator RNA Ribonucleic Acid RNAi RNA interference Ta Annealing temperature TALEN Transcription ativator-like effector nucleases vii Tm Melting temperature tracrRNA Trans-activating CRISPR RNA VI/VIN Vacuolar inhibitor of β-fructosidase ZFNs Zinc-finger nucleases kb Kilobase mM Milimolar Minute ng Nanogram NCBI National Center for Biotechnology Information nm Nanometer rpm Revolutions per minute µL Microlitre viii Table 3.7 Components PCR multiply the CIF1-G2 fragment Component Volume Dream Tag Master Mix 2X (Thermofisher) 10 µL OsU3-R 0.2 µL CIF1-G2 0.2 µL DNA template (colony) 0.5 µL H2 O 9.1µL Total 20 µL Figure 3.4 Thermal cycling 3.3.6 Plasmid extraction With PCR results of the positive samples, select strains with corresponding insert vectors and cultured in liquid LB medium containing the antibiotic kanamycin at concentration of 50µg/ml and extract plasmid The plasmid extraction procedure is performed according to the following steps: Step 1: To collect the cell residue we suck 1.5 ml of cultured cell fluid into 1.5 ml effendorf tube and centrifuge the cell residue at 13.000 rpm for minute, then discard the supernatant Step 2: Add 150 µl Sol I and votex until the residue is dissolved, then add 200 µl Sol II and gently stir 3-5 times, give 150 µl Soll III right after that and leave on stone minutes Centrifuge 12.000 rpm for 15 minutes, then collect the clear solution to transfer to a new tube To purify the DNA, add 50 µl of RNase (0.01 mg / ml) incubated 37°C for hour, then add a mixture of chloroform-isoamylalcohol 25 (Vchloroform: Visoamylalcohol = 24: 1) at a ratio of 1: to volume and to vortex Centrifuge 12.000 rpm for 15 minutes 4°C, then aspirate above phase Step 3: Precipitate DNA with 100% ethanol at the volume ratio of Vethanol: Vsolution = 2: 1, then leave in the cabinet at -20°C for hour and centrifuge 12.000 rpm for 15 minutes at 4°C, remove the precipitate Step 4: Wash the precipitate with 300 µl 70% Eth, votex to dissolve the sediment and centrifuge 10.000 rpm for minutes, remove the precipitate To precipitate using a vacuum evaporator, add water and store at -20°C After that, plasmid extracted electrophoresis check on 1% gel 3.3.7 Plasmid transformation into A tumefaciens cells by electrical impulses A tumefaciens strain EHA105 is used to carry recombinant vectors The electric impulse method is used to transform the recombinant vector into competent bacterial cells Add µl of recombinant vector to 50 ml of competent cell fluid and conduct electric impulse according to the following steps: Step 1: The competent cell from -80°C is removed and thawed on ice for 30 minutes Step 2: Add µl of recombinant vector to 50 l of cell fluid in the competent cell tube and keep on ice for 30 minutes Step 3: Suck the vector mixture and bacteria into the curvet tube Set the machine to 2500V, 200 Ω, 25 mcF Step 4: Add ml of liquid LB and recovery culture at 28°C incubator, shake 200 rpm for hour Step 5: Inoculate on a Petri dish supplemented with 50 µg/ml concentration of antibiotic Kanamycin Incubate at 28°C overnight 3.3.8 Sanger DNA sequencing The amplified product was sequenced by DNA sequencer ABI 3500 system with the Big Dye Terminator kit (ABI Foster City, USA) After that, the nucleotide sequences were analyzed and assembled by BioEdit program 26 CHAPTER IV RESULTS AND DISCUSSION 4.1 Total DNA extraction of Tiny-Tom tomato Total DNA of leaf samples was obtained and checked for the quality by electrophoresis on agarose gel 1% As seen in figure 4.1, the obtained DNA quality were bright and clear, high molecular weight was obserbed without RNA band Obtaining such a high quality product is due to the selection of young leaves for extraction On these leaves, the cell wall has incomplete xylem and phloem, which makes it easier to break down the membrane where the cells are strongly dividing, resulting in high DNA yield After that, the molecular absorbance determination was examined by spectrophotometer The results obtained for OD value (260 / 280nm) was about 1.875, which was relatively significant, could consider as high quality DNA content and ready for downstream experiments Finally, the total DNA product was diluted to proper concentration for PCR reaction with the designed specific primers Figure 4.1 Total DNA of leaf samples 4.2 Exon region amplifying and sequencing Exon amplified experiment of SlCIF1 gene was conducted using suitable diluted DNA template with Sol200E1-F and Sol200E1-R primers The volume of each reaction is modified to 20 µl according to the manufacturer's instruction, containing 0.5 µl the total DNA as the template and other components for the PCR reaction 27 (Table 3.2) The amplified process consisted of 38 cycles; annealing temperature was 53-55oC for 25 seconds and extended duration was 40 seconds Electrophorensis results confirmed that the experimental sample was suited for both temperatures PCR products were roundly 600 bp size, equivalent to the theoretical length (Figure 4.2) Also, this outcome demonstrated that the primers designed for exon region amplification are relatively specific Figure 4.2 The optimal PCR reaction for exon of SlCIF1 gene 53, 55: Test priming temperature respectively from 53-55°C, M: Marker 1kb After obtaining the desired exon fragment, because of excess ingredients can interfere the sequencing quality, purification reaction was performed The results of this process are depicted in Figure 4.3-A showing a DNA band at exact position as well as much more clarity band than the PCR This ensured for stable sequencing results 28 CIF1_F CIF1_Ref 10 20 30 40 50 60 | | | | | | | | | | | | ATCMATCCATTTACTATATAAAAAAACATACACACACAC TATACTCCATACAAAGAAA .AC CIF1_F CIF1_Ref 70 80 90 100 110 120 | | | | | | | | | | | | ATCCACATTTAGTTTTAAATTTTCCCAAAAATTTCAAAAATGAAAATTTTGATTTTCCTA CIF1_F CIF1_Ref 130 140 150 160 170 180 | | | | | | | | | | | | ATAATGTTTCTTGCTATGTTGCTAGTAACAAGTGGGAATAATAATCTAGTAGAGACAACA CIF1_F CIF1_Ref 190 200 210 220 230 240 | | | | | | | | | | | | TGCAAGAACACACCAAATTATAATTTGTGTGTGAAAACTTTGTCTTTAGACAAAAGAAGT CIF1_F CIF1_Ref 250 260 270 280 290 300 | | | | | | | | | | | | GAAAAAGCAGGAGATATTACAACATTAGCATTAATTATGGTTGATGCTATTAAATCTAAA CIF1_F CIF1_Ref 310 320 330 340 350 360 | | | | | | | | | | | | GCTAATCAAGCTGCTAATACTATTTCAAAACTTAGGCATTCTAATCCTCCTCAAGCTTGG CIF1_F CIF1_Ref 370 380 390 400 410 420 | | | | | | | | | | | | AAAGATCCTTTGAAGAATTGTGCCTTTTCATATAAGGTAATGTTTATTCGTTCGTCGTTT .G CIF1_F CIF1_Ref 430 440 450 460 470 480 | | | | | | | | | | | | CAATTTGTTTGTCCTAACAAAACTCGACTATGATGAATTAGGATTTTATGTTTATTTTTT CIF1_F CIF1_Ref 490 500 510 520 530 | | | | | | | | | | | CTGTCTCAATTTGCTTGTCTTACTTCTTTTTTTGGCTAAAAGTTTCGACCCTATC A B Figure 4.3 Purified PCR products and sequence of exon SlCIF1 A Results of purification of the PCR product segment of the exon1 gene SlCIF1 of Tiny-Tom tomatoes B Results comparing the amplified sequence with the reference sequence Exon segment was sequenced by Sanger method and aligned with the reference on GenBank database (CIF1_Ref) Sequence reading results obtained a gene fragment with 535bp length, high quality peak, high similarity between the two sequences, only distinct nucleotides at positions 40, 41, 390 The accuracy of this sequence is a prerequisite for proper gRNA design 4.3 gRNA specific designing to CIF1 gene With the sequencing of exon has been completed to design gRNA need to use CRISPR-P version 2.0 tool (http://crispr.hzau.edu.cn/cgi-bin/CRISPR2/CRISPR) was used to design gRNA-spacer sequence Prior for choosing gRNA is high on-target value and none of mis-matching with CDS region of other different genes Besides, the selected sequence has to satisfy the following criteria: GC% content is 40% -60%, priming temperature is 50°C - 65°C, not to form secondary structures with large 29 dissociated energy, and also inability to bind with other genome sequences that may cause undesired mutation outside the coding region of the SlCIF1 gene Table 4.1 The sequence of gRNAs No Name Nucleotide sequence (5'-3') Melting %GC temperature Length (bp) (Tm) CIF1-G1-F GGCACCTATGTTGCTAGTAACAAGT 55 41.7 24 CIF1-G1-R AAACACTTGTTACTAGCAACATAG 51.2 33.3 24 CIF1-G2-F GGCACTAATACTATTTCAAAACTT 49.5 29.2 24 CIF1-G2-R AAACAAGTTTTGAAATAGTATTAG 45.7 20.8 24 After designing with the above tool and obtained a list of design sequences, suitable gRNA pairs were selected (table 4.1) These gRNAs are in the open reading frame of exon on the SlCIF1 gene The CIF1-G1 sequence had a high on-target index (0.61) and there was no mismatching with another gene The CIF1-G2 sequence, on the other hand, had an average on-target index (0.4453) However, this sequence still satisfies the criteria for choosing appropriate gRNA for this study 4.4 Transformation of E.coli strain with gRNA-CRISPR/Cas9 vector After attaching double gRNAs into the vector, the recombinant vectors were transfomed into E coli cells Competent DH10b line was used to carry the vectors due to Ca2+ ions Those cations cover negative charges on the DNA molecules, thus enhance the cell membrane penetration The ligation product is mixed with competent cell, cultured and transformed into the bacteria The E coli cells were then inoculated on Petri dishes containing LB medium and Kanamycin antibiotic for about day The results obtained a number of small round colonies, milky white, mucous surface However, these colonies were not certained about the successfully transformed possibility, thus PCR rechecking was necesscery 4.4.1 Colonies selection containing recombinant plasmids by PCR In order to select successfully transformed colonies, sampling of each colony carrying PCR should be taken The structure of the gRNA, which had been inserted into the vector pRGEB31, was amplified by the forward gRNA (CIF1-G1-F) or gRNA (CIF1-G2-F) gRNA oligo and the OsU3-R1 reverse primer The insert- 30 carrying structures were named as pRGEB31-G1 and pRGEB31-G2 From the vectorcarrying colonies that were selected on the dish containing the antibiotic kanamycin, the structures carrying the insert would have a positive reaction After that, the colonies containing the vector carrying the insert CIF1-G1, CIF1-G2 were screened Figure 4.4 PCR checks for colonies containing structures pRGEB31-CIF1G1, pRGEB31-CIF1G2 (-): negative control is PCR without sample  A: Electrophoresis of colony PCR results containing pRGEB31-G1 structures - Mk: Marker 1kb - The strains of bacteria to filter carry vector are numbered 1-5 and used as template for PCR to check vecor bearing CIF1-G1 insert  B: Electrophoresis test for colony PCR results containing pRGEB31-G2 structures - Mk: Marker 1kb - The vector screening bacteria strains are numbered from 1-5 and used as template for PCR to check the vecor carrying the insert CIF1-G2 The electrophoresis results showed that there were colonies pRGEB31-G1 (3, 4, 5), and colonies pRGEB31-G2 (1, 2, 4, 5) for clear band and approximate size with theory (230 bp) From these results, selective colonies qualify for sequencing to verify the gene fragment attached 4.4.2 Sequencing result of CRISPR/CAS9-CIF1 Selected colonies were rechecked by sequencing for accurate certainty OsU3F primer was used to sequence colonies carrying pRGEB31-CIF1- G1 plasmid (number 3, 4, 5) However, the results contained noisy peak which could lead to 31 inaccurately read Also, the gRNA segment obtained in the sequencing results was incorrect, compared to the study designed Therefore, this outcome from pRGEB31CIF1- G1 vector was not used for other analyses Similar to the above, colonies pRGEB31- CIF1-G2 (1, 2, 4, 5) were sequenced with OsU3-F primer, resulted in colonies 1, and resulting in the correct insert design, while colony number carried the insertion sequence incorrectly with the design (Table 4.1) The results showed that colonies 1, and showed the correct insert design, while colony carried the insert sequence incorrectly designed (Fig 4.5 A) Although the PCR reaction indicated that colony had a positive result with correct size, the results after sequencing did not match the design insert This can be explained by the similar size of the PCR results, so when comparing with the marker, there is no difference but only estimate the accuracy of the multiplied length From the results of sequencing, colonies pRGEB31-CIF1-G2 (1, 2, 5) were obtained exactly These strains of recombinant bacteria were stored in glycerol 30% at -80°C, to ensure quality for transformation into A tumefaciens A B Figure 4.5 Sequencing gRNA on pRGEB31-CIF1-G2 vector number 1, 2, 4, A Sequencing gRNA on pRGEB31-CIF1-G2 vector number B Sequencing gRNA on pRGEB31-CIF1-G2 vector number 1, 2, 32 4.5 Transformation of A tumefaciens strains with gRNA-CRISPR/Cas9 vector With the designed vector containing the defined insertion sequence, pRGEB31G2 vector was transformed into A tumefaciens strain EHA105 Plasmid pRGEB31-G2 clone was transformed into cell A tumefaciens EHA105 transformed by the method of transforming electrical impulses at 2.5 kv, 25 μF and 200Ω using a 0.2 cm cuvette After electrical impulse, 950 µl of liquid LB was added and cultured for hour at 37oC All cells were spread inoculated on LB agar medium supplemented with 50 µg/µl kanamycin and kept overnight at 28°C A B Figure 4.6 Plasmid extraction and plasmid contains pRGEB31- CIF1-G2 structures in PCR reaction (-)Water control, MK: marker 1kb A The result plasmids extraction contain pRGEB31-CIF1-G2 structure B Electrophoresis test for colony PCR results containing pRGEB31-CIF1-G2 structures After the kanamycin antibiotic screening, the result of transformation of vector pRGEB31-G2 into A tumefaciens EHA105 obtained colonies However, during the liquid culture process to separate the plasmid, the cultured colony number was unsuccessful, leaving only colonies 1, 2, After extracting those colonies, clear 33 bands were observed without much degradation In general, the electrophoresis band is larger than marker (10kb) because recombinant pRGEB31 vectors containing gRNA fragment is over 15kb in lenght To accurately test the tranformation of plasmid pRGEB31-G2, PCR was performed on the colonies This PCR reaction used OsU3-R primer and reverse oligo fragment of gRNA (CIF1-G2-F) The gel electrophoresis results illustrated clear bands representing plasmids with equal size of about 300bp, similar to the expected PCR products Initial outcomes showed successful transformation of plasmid pRGEB31-G2 into A tumefaciens strain EHA105 Therefore, it is possible to plant transformation into Tiny-Tom tomato 34 CHAPTER V CONCLUSION AND RECOMMENDATIONS 5.1 Conclusion - Sequencing exon1 region of SlCIF1 gene of Tiny-Tim tomatoes, the results showed that there were 03 distinct nucleotides compared to the reference sequence on the database - Created vector pRGEB31 carrying insert CIF1-G2 with the correct sequence as designed - Created a strain of E coli DH10B and A tumefaciens EHA105 bacteria carrying recombinant vector pRGEB31-CIF1-G2 5.2 Recommendations - Transgenic would carry out on tomatoes like Tiny-Tom with bacteria strains carrying recombinant vector pRGEB31-G2 - Functional assessment of SlCIF1 gene and apply results to similar experiments 35 REFERENCES Amor Y., Haigler C., Johnson S., Wainscott M & Delmer D (1995) A membrane-associated form of sucrose synthase and its potential role in synthesis of cellulose and callose in plants Proc Natl Acad Sci U.S.A 92, 9353-7 Gebhardt C., Ritter E., Barone A., Debener T., Walkemeier B., Schachtschabel U., Kaufmann H., Thompson R D., Bonierbale M W., Ganal M W., Tanksley S D.& Salamini F (1991) RFLP maps of potato and their alignment with the homologous tomato genome Theoretical and Applied Genetics 83/1: 49-57 Chetelat R.T & Ji Y (2006) Cytogenetics and evolution in: Razdan, M and A.K Matoo (eds.), Genetics Improvement of Solanaceous Crops Vol 2: Tomato, Science Publishers, New Dehli, India Chlamydomonas reinhardtii Pratheesh, Shonima, Jiji Thomas, Abraham and Muraleedhara Kurup Advances (2012) Study on efficacy of different Agrobacterium tumefaciens strains in genetic transformation of microalga Applied Science Research (5): 2679-2686 Davies C & Robinson SP (1996) Sugar accumulation in grape berries Cloning of two putative vacuolar invertase cDNAs and their expression in grapevine tissues Plant Physio Dilip R P & Feng C (2010) Genomics of Fungal Disease Resistance in Tomato Curr Genomics 11(1):30–39 Doudna JA & Charpentier E (2014) Genome editing The new frontier of genome engineering with CRISPR-Cas9 Science 346(6213): 1258096 F Ann Ran, Patrick D Hsu, Jason Wright, Vineeta Agarwala, David A Scott & Feng Zhang (2013) Genome engineering using the CRISPR-Cas9 system Nature protocols 8(11):2281-2308 FAOSTAT (2017) “Production–Crops–rea harvested/ Production quantity– Tomatoes–2014”, FAO Statistics online database, Food and Agriculture Organization, Rome 10 Fyodor D Urnov, Edward J Rebar, Michael C Holmes, H Steve Zhang & Philip D Gregory (2010) Genome editing with engineered zinc finger nucleases Nature Reviews Genetics (11): 636–646 11 George T.Tzotzos, Graham P.Head & RogerHull (2009) Setting the Context: Agriculture and Genetic Modification, Chapter 36 12 Gomes A & Korf B (2018) Genetic testing techniques Pediatric Cancer Genetics :47–64 13 Guozheng Qin, Zhu Zhu, Weihao Wang, Jianghua Cai, Yong Chen, Li Li, Shiping Tian (2016) A Tomato Vacuolar Invertase Inhibitor Mediates Sucrose Metabolism and Influences Fruit Ripening Plant Physiol 172(3): 1596–1611 14 Hillary, V E (2020) Genome Engineering via CRISPR-Cas9 System Plant Biotechnol 12(8):1006-14 15 Hiroshi Ezura, Tohru Ariizumi, Jordi Garcia-Mas, Jocelyn Rose: Functional Genomics and Biotechnology in Solanaceae and Cucurbitaceae Crops 16 Jang JC & Sheen J (1994) Sugar sensing in higher plants Plant Cell (6):1665–79 17 Ji Y & Scott J.W (2006) Tomato in: Singh, R.J (ed.), Genetic Resources, Chromosome Engineering, and Crop Improvement Series IV: Vegetable Crops, CRC Press, Boca Raton, Florida 59-113 18 Jin Y., Ni D & Ruan Y (2009) Posttranslational elevation of cell wall invertase activity by silencing its inhibitor in tomato delays leaf senescence and increases seed weight and fruit hexose level Plant Cell (21):2072-89 19 Kabin Xie, Bastian Minkenberg & Yinong Yang (2014) Targeted Gene Mutation in Rice Using a CRISPR-Cas9 System Bio-protocol 4(17) 20 Karin Ljung (2013) Auxin metabolism and homeostasis during plant development Development (140): 943-950 21 Klann E.M Hall B & Bennett A.B (1996) Antisense acid invertase (TIV1) gene alters soluble sugar composition and size in transgenic tomato fruit Plant Physiol (112):1321 22 Klee H & Giovannoni J (2011) Genetics and control of tomato fruit ripening and quality attributes Annu Rev Genet (45):41-59 23 Li J., Wu L., Foster R & Ruan Y (2017) Molecular regulation of sucrose catabolism and sugar transport for development, defence and phloem function J Integr Plant Biol (59): 322-335 24 Luo, Jie Zhou, Jing Jing, Zhang & Jin Zhi (2018) Aux/IAA gene family in plants: Molecular structure, regulation, and function Int J Mol Sci Jan 16;19(1):259 25 M.M.Saker, H.S.Salama, M.Salama, A.El-Banna & N.M.Abdel Ghany (2011) Production of transgenic tomato plants expressing Cry 2Ab gene for the control of some lepidopterous insects endemic in Egypt Journal of Genetic Engineering and Biotechnology (9):149-155 37 26 Marintcheva & Boriana (2018) Harnessing the power of viruses Viral Tools for Genome Manipulations In Vivo: 69–102 27 Nicolas Ranc, Stéphane Muños, Sylvain Santoni & Mathilde Causse (2008) A clarified position for Solanum lycopersicon var cerasiforme in the evolutionary history of tomatoes (Solanaceae) Biomedcentral Plant Biology 8: 130 pages 28 Nonaka S & Ezura H (2016) Functional genomics and biotechnology in Solanaceae and cucurbitaceae crops Biotechnology in Agriculture and Forestry (70):221–238 29 Nuez F (2001) El Cultivo del Tomate, Ediciones Mundi-Prensa, Madrid, 793 30 OECD (2017) Safety Assessment of Transgenic Organisms in the Environment, Volume 7: OECD Consensus Documents, Harmonisation of Regulatory Oversight in Biotechnology, OECD Publishing, Paris Chapter 31 Oyama K; Nunez-Farfan J; Fornoni, J; Marquez-Guzman J; Garzon-Tiznado, JA; Sánchez-Pena, P & Hernández-Verdugo S (2004) Sources of resistance to whitefly (Bemisia ssp.) in wild populations of S lycopersicum var cerasiforme (Dunal) Spooner G.J Anderson et R.K Jansen in Northwestern Mexico Genetic Resources and Crop Evolution (53): 711-719 32 Pattanayak V (2014) The Use of CRISPR/Cas9, ZFNs, and TALENs in 33 34 35 36 Generating Site-Specific Genome Alterations Methods in Enzymology, (546):47– 78 Qin G Zhu, Z Wang, W Cai, J Chen Y., Li L & Tian S (2016) A tomato vacuolar invertase inhibitor mediates sucrosemetabolism and influences fruit ripening Plant Physiol Rick C.M (1978) The tomato Scientific American (239): 77-87 Ruan Y Jin, Y Yang, Y Li, G & Boyer J (2010) Sugar input, metabolism, and signaling mediated by invertase: roles in development, yield potential, and response to drought and heat Mol Plant (3):942-55 Seisuke Kimura & Neelima Sinha (2008) Tomato (Solanum lycopersicum): A Model Fruit-Bearing Crop Cold Spring Harbor Protocols (12) 37 Smeekens S & Rook F (1997) Sugar-sensing and sugar-mediated signal transduction in plants Plant Physiol (115):7–13 38 Sturm A (1999) Invertases Primary structures, functions, and roles in plant development and sucrose partitioning Plant Physiol (121):1-8 38 39 Su, T Wolf, S Han, M Zhao, H Wei, H Greiner, S & Rausch, T (2016) Reassessment of an Arabidopsis cell wall invertase inhibitor AtCIF1 reveals its role in seed germination and early seedling growth Plant Mol Biol (90):137-55 40 Vaughan, J.G and C.A Geissler (1997) The new Oxford book of food plants, oxford University press 41 Wan-Chi Lin, Ching-Fang Lu, Jia-Wei Wu, Ming-Lung Cheng, Yu-Mei Lin, Ning-Sun Yang, Lowell Black, Sylvia K Green, Jaw-Fen Wang & Chiu-Ping Cheng (2004) Transgenic tomato plants expressing the Arabidopsis NPR1 gene display enhanced resistance to a spectrum of fungal and bacterial diseases Transgenic Research (13):567–581 42 Xie, K Minkenberg, B & Yang, Y (2014) Targeted Gene Mutation in Rice Using a CRISPR-Cas9 System Bio-protocol 4(17):1225 43 Yelle, S Chetelat, R Dorais, M Deverna, J and Bennett, A (1991) Sink metabolism in tomato fruit: IV genetic and biochemical analysis of sucrose accumulation Plant Physiol 44 Zanor, M Osorio, S Nunes-Nesi, A Carrari, F Lohse, M Usadel, B Kühn, C Bleiss, W Giavalisco, P Willmitzer, L Sulpice, R Zhou, Y & Fernie A (2009) RNA interference of LIN5 in tomato confirms its role in controlling Brix content, uncovers the influence of sugars on the levels of fruit hormones, and demonstrates the importance of sucrose cleavage for normal fruit development and fertility Plant Physiol (150):1204-18 45 Zhang, N Jiang, J Yang, Y & Wang Z (2015) Functional characterization of an invertase inhibitor gene involved in sucrose metabolism in tomato fruit J Zhejiang Univ Sci, (16): 845-56 39