plant gene transfer and expression protocols

CHAPTER 1 Tools for Expressing Foreign Genes in Plants Franqois Guerineau 1. Introduction Since the first reports of tobacco transformation experiments in 1983, a number of fundamental processes, such as gene expression, cell metabolism, or plant development, are being studied using gene transfer experiments. The spectrum of plant species amenable to transformation is continuously widening. This is partly because of the refinement of tissue culture techniques and also because of the development of more and more diverse tools for gene transfer and expression. In this chapter, I will give a list of plasmid constructs containing various components use- ful for expressing foreign genes in plants: expression cassettes into which genes of interest can easily be inserted, assayable reporter genes that allow accurate quantification of gene expression, selectable marker genes for the selection of transformants, and plant promoters to achieve more specific patterns of gene expression. 2. Expression Cassettes Efficient expression of foreign genes in transformed plants requires that they are placed under control of a promoter that is active in plant cells. Typical bacterial promoters are not functional in plant cells owing to important differences in the transcription machineries in the two types of organisms. Polyadenylation is also a very important determinant of gene expression. In eukaryotes, mRNAs are polyadenylated in the nuclei before being exported into the cytosol where they are translated. An From Methods m Molecular Biology, Vol 49’ Plant Gene Transfer and Express/on Protocols Edlted by H Jones Humana Press Inc , Totowa, NJ 1 2 Guerineau expression cassette will provide a promoter active in plant cells, a polylinker into which a coding sequence can be inserted, and a poly- adenylation sequence located downstream of the polylinker. The vectors of all the cassettes described here are small, high-copy number, pBR322 or pUC-derived plasmids encoding ampicillin resistance. 2.1. CaMV 355 Promoter-Based Cassettes A widely used promoter for expressing foreign genes in plant cells is the promoter directing the synthesis of the cauliflower mosaic virus (CaMV) 35s RNA. This promoter achieves a high level of transcription in nearly all plant tissues. The 35s promoter possesses a transcriptional enhancer located upstream of the TATA box. The duplication of the enhancer results in a higher level of transcription (I). Most of the expres- sion cassettes available contain the 35s promoter linked to the CaMV polyadenylation sequence. All these cassettes differ in their restriction sites upstream and downstream of the promoter and polyadenylation sequences. Also, different strains of CaMV have been used for their construction, the major difference being the presence or absence of an EcoRV restriction site between the enhancer sequence and the TATA box. Translation initiation is highly dependent on the sequence surround- ing the ATG initiator codon. Some cassettes provide an optimized trans- lation initiator codon context downstream of the promoter sequence and upstream of the polylinker, for the construction of translational fusions. 2.1.1. For Transcriptional Fusions In the cassettes shown in Fig. 1, no ATG sequence is present between the transcription start and the polylinker sequence. Translation initiation will normally occur at the first ATG codon found in the sequence inserted in the polylinker. As it has been shown that the presence of multiple restriction sites in the untranslated region of mR.NAs decreases gene expression (6), the cloning strategy should ensure that as few sites as possible remain upstream of the coding sequence. 2.1.2. For Translational Fusions The optimal sequence for translation initiation in mammalian cells is CCACCATGG (7). The consensus sequence around the ATG initiator codons of plant genes was established as AACAATGG (8). A recent comparison of the effect of these two consensus sequences placed upstream of the P-glucuronidase gene (gus) in plant protoplasts has Genes for Transformation 3 35s CaMV Poly A 039kb 072kb pJlT62 35s 35s CaMV poly A 073kb 072kb pJIT60 355 09 kb rbcS poly A 07 kb 35s 042 kb CaMV PW A PRT, o, 02kb Fig. 1. Maps of CaMV 35s promoter-based expression cassettes for tran- scriptional fusions. pJIT62 (Guerineau, unpublished), pDH5 1 (2), pJIT60 (3), pKYLX6 (4), pRTlO1 (5). 4 Guerineau shown that they were equally effective in increasing gene expression (3). This is presumably because of the fact that gus is a bacterial gene and does not possess an ATG context optimal for translation initiation in plant cells. The cassettes shown in Fig. 2 contain a translation initiator codon upstream of their polylinker. Insertion of a coding sequence in the polylinker, in frame with the cassette ATG triplet, will result in a transla- tional fusion. Consequently, the protein synthesized in the transformed cells will possess a short N-terminal extension. It is essential to know whether or not such an extension will affect the activity or the stability of the protein. If so, the benefit of enhanced translation initiation would be lost and it would be more beneficial to use a transcriptional fusion. 2.1.3. For Targeting Foreign Proteins to Chloroplasts Whereas most of the biosynthetic pathways in the plant cell are found in the chloroplasts, very few of the enzymes required are encoded by the chloroplast genome. Most are nuclear-encoded and are imported mto the chloroplasts by a transit peptide present at their N-terminus (see Chapter 30). It has been shown that fusion of the ribulose bisphosphate carboxy- lase (RUBISCO) small subunit transit peptide sequence to a foreign pro- tein results in the import of the fusion protein into the chloroplast stroma where the mature protein is released after cleavage from the transit pep- tide (10). The expression cassette pJIT117 (11) contains the sequence of the RUBISCO transit peptide attached to the CaMV 35s promoter with a duplicated enhancer (Fig. 3). This cassette was tested using p-glucu- ronidase: 17.4% of the GUS activity in protoplasts incubated with the hybrid construct was found in the chloroplast fraction (11). The presence of the 23 first amino acids of mature RUBISCO downstream of the transit pep- tide would greatly enhance the targeting efficiency (IO), but the foreign pro- tein would then be released m the stroma as a fusion protein, which is not suitable for all proteins. The pJIT117 cassette has also been used for importing the bacterial dihydropteroate synthase mto chloroplasts (12). 2.2. Plant Promoter-Based Cassettes The expression of the RUBISCO small subunit gene (rbcs) is regu- lated by light and is tissue-specific (see Section 5.4.1.). The expression cassette pKYLX3 (4) contains the pea &S-E9 promoter and poly- adenylation sequences (Fig. 4). This cassette was able to direct the expression of the chloramphenicol acetyltransferase gene (cat,) in tobacco calli (4). Genes for Transformation 5 BamHl Smal EcoRl pJIT74 ACAGCCCAAGCATGGAGAACCGACCTGCAGGTCGACGGATCCCCGGGAATTC Sstl Kpnl 35s 0 39 kb CaMV poly A 0 72 kb +1 Hindlll Sal1 BamHl Smal EcoRl pJITI 14 ACAGCCCAAGCTTAACA ATG GCG TGC AGG TCG ACG GAT CCC CGG GAA TTC +I Hindlll Ncol Sal1 BamHl Smal EcoRl pJITl63 355 35s CAMV poly A 0 73 kb 0 72 kb +l Xhol Apal Ncol Sst I Kpnl Smal BamHl Xbal pRTlO0 ACCTCGAGGGCCCATGGGCGAGCTCGGTACCCGGGGATCCTCTAGA +l Xhol Ball Ncol Sst1 Kpnl Smal BamHl Xbal pRTl03 ACCTCGAGTGGCCACCATGGGCGAGCTCGGTACCCGGGGATCCTCTAGA +l Xhol Ball Ncol Sstt Kpnl EcoRl BamHl Xbal pRT 104 ACCTCGAGTGGCCACCATGGGCGAGCTCGGTACCCCCGAATTCGGGGGGATCCTCTAGA \ / 35s 0 42 kb CaMV poly A 02 kb Fig. 2. Maps of CaMV 3% promoter-based expression cassettes for transla- tional fusions. pJIT74 (9), pJIT114 andpJIT163 (3), pRTlO0, pRT103, pRT104 (5). The translation imtlatlon codons are shown in bold characters. The tran- scription Initiation sites are indicated by +l above the sequences. 6 Guerineau sst1 Kpnl Kpnl Xhol 35s 35s TP Poly A pJITll7 073 kb 02 kb 0 72 kb 7 'TGc*TGCCTGCAGGTCGaCtGaTcCCcGGGnATTCC \ Fig. 3. Map of the expression cassette pJIT117 (12) for targeting foreign proteins to chloroplasts. TP, RUBISCO transit pepttde sequence. The nucle- otide sequence around the first codon of the mature RUBISCO (shown in bold) is indicated. pKYLX3 rbcS I I kb rbcs p01y A 07 kb pMA406 2019E 3 3 kb nos P~IYA 025kb Fig. 4. Maps of two plant promoter-containing expression cassettes. pKYLX3 (#), pMA406 (13). rbcS, RUBISCO small subunit; nos, nopaline synthase. Genes for Transformation 7 The expression of the soybean Gmhspl7.5-E gene (also known as 2019E) is heat-inducible. When a 2019E-gus gene fusion was electro- porated into protoplasts, GUS activity was 10 times higher in protoplasts subjected to a heat shock at 40°C than in protoplasts treated at 29°C (13). The level of expression appeared to be higher than that given by the CaMV 35s promoter. The expression cassette pMA406 contains the 2019E pro- moter linked to the polyadenylation sequence of the nopaline synthase (nos) gene from Agrobacterium tumefaciens (Fig. 4). 3. Reporter Genes Many studies on plant promoters and on the regulation of gene expres- sion have been made possible by the use of reporter genes. Their main scope is to provide an easy way of assessing gene expression. These genes encode for products which can be quantified using simple bio- chemical assays. Protocols for the assays are given in Section 3. of this book. Another use for these genes is the detection of transformation events during gene transfer experiments. The expression of a reporter gene can be easily detected in transformants, avoiding the need for more time-consuming characterization. 3.1. The /SGlucuronidase Gene The P-glucuronidase gene (vidA or gus), which originates from E. coli (14), is the most widely used reporter gene in plant molecular biology. Accurate fluorimetric assays or precise histochemical localization of GUS in transgenic tissues are possible (15) (see Chapter 10). Another interesting property of the enzyme is its ability to tolerate N-terminal extensions (15). Plasmids pBIl0 l- l ,-2,-3 provide the three different frames for translational fusions (Fig. 5). Plasmid pJIT166 contains the gus gene inserted in the expression cassette pJIT163 (3) (Fig. 5). A high GUS activity was recorded in tobacco protoplasts transfected with this plasmid (3). The GenBank and EMBL database accession number for the nucleotide sequence of the gus gene is Ml4641. 3.2. The Firefly Luciferase Gene The only known substrates for firefly luciferase are ATP and D-luciferin. The extreme specificity of this luminescent reaction is an interesting fea- ture of this reporter gene/assay system. The nucleotide sequence of a luciferase cDNA has been reported (I 6) (accession number M 15077). A 8 Guerineau - GUS B / \ HindIll Sall BamHl Smal 35s 35s GUS CaMV poly A oJIT166 Fig. 5. Maps of the P-glucuronidase (gus) coding sequence in pBIlOl.1, 2, .3 (15), and pJIT166 (3). The nucleotlde sequence preceding thegus translation initiation triplet (shown in bold) is indicated. There are no sites for A@, BglII, CZaI, EcoRI, HpaI, K’nI, NcoI, SeaI, SpeI, SstII, StuI, StyI, Hz01 in or flanking the gus coding sequence in the pBI10 1 plasmids. high level of luciferase activity was detected in plants transformed with a 35S-Euc construct (17). Plasmid pJIT27 (18) contains the Zuc coding sequence and pDRlOO-derived plasmids (19) offer other restriction sites for the construction of translational fusions (Fig. 6). 3.3. The Chloramphenicol Acetyltransferase Gene The most commonly used chloramphenicol acetyltransferase gene (cat) originates from transposon Tn9 (20). It has been widely used as a reporter gene in mammalian cells and to a lesser extent in plants, owing to the occurrence of the more versatile gus gene/assay system. Plasmids pJIT23, pJIT24, pJIT25 (Guerineau, unpublished), and pJIT26 (9) carry the cat coding sequence in different contexts (Fig. 7). Accession num- Genes for Transformation 9 pJlT27 AGGCCTATG Hlndlll Pstl Sal1 AAGCTTGGGCTGCAGGTCGACCGGTAAAATG pDRlO0 POSY A AAGCTTGGGCTGCAGGTCGACCATG pDRlO1 AAGCTTGGGCTGCAGGTCGACCTG pDR102 AAGCTTGGGCTGCAGGTCGACCG pDRl03 Fig. 6. Maps of the luctferase (luc) coding sequence in pJIT27 (18) and in pDR plasmids (19). The nucleottde sequences upstream of the luctferase first codon (shown in bold) are indicated. There are no sites for ApaI, BgnI, HpaI, MZuI, NcoI, ScaI, S’eI, SstII, StyI, X401 m or flanking the luc coding sequence in pJIT27. bers for the cat nucleotide sequence are VO0622 and JO 184 1 in the EMBL and GenBank databases, respectively. 3.4. Other Reporter Genes The 1ac.Z gene encoding P-galactosidase (P-GAL) in E. coli has been expressed in tobacco crown gall tissues (‘21). An increase in P-GAL activity up to 20-fold could be detected in some of the transformants. However, the presence of a high endogenous P-GAL activity in plant cells makes this gene inconvenient for sensitive quantification of gene expression. The expression of the neomycin phosphotransferase (nptIl) (see Chapter 12) and phosphinothricin acetyltransferase (bar) genes can also be quantified using radiochemtcal assays (22,23). 4. Selectable Marker Genes A selectable marker gene is used to recover transformants after a gene transfer experiment. It encodes a protein that confers on transformed cells 10 Guerineau - CAT ) pJIT26 AGGCCTAGCTTGCGAGATTTTCAGGAGCTAAGGAAGCTAAAATG EcoRl Sstl HIndIll Stul EcoRl - CAT ) EcoRl - CAT ) EcoRl - CAT ) Hindlll pJIT23 WI EcoRl pJIT24 Sstl EcoRl pJIT25 Fig. 7. Maps of the chloramphenicol acetyltransferase gene (cat) m pJIT23, 24, 25 (Guerineau, unpublished) and pJIT26 (9). The nucleotide sequence pre- ceding the translation initiation triplet (shown in bold) is indicated. There are no sites for A+, BgZII, ClaI, EcoRV, H’aI, MZuI, S’eI, &II, 301 m or flank- ing the cat coding sequence m pJIT26. the ability to grow on media containing a compound toxic for untrans- formed cells. Transformants will emerge from the mass of untrans- formed tissue because of the advantage given by the expression of the resistance gene. The gene product of a selectable marker gene can be a detoxifying enzyme able to degrade the selective agent. Alterna- tively, it can be a mutated target for the toxic compound. The intro- duced gene will encode for an enzyme insensitive to inhibition by the selective agent. This enzyme will replace the defective native enzyme in the transformed cells. [...]... Hildebrand, D F , and Hunt, A G (1987) Design and construction of a versatile system for the expression of’foreign genes m plants Gene 61, l-l 1 5 Topfer; R., Matzeit, V., Gronenborn, B., Schell, J., and Stembiss, H H (1987) A set of plant expression vectors for transcriptional and translational fusions Nucleic Acids qes 15, 5890 6 Jones, J D G , Dunsmuir, P., and Bedbrook, J (1985) High level expression. .. phosphotransferase gene m maize plants Plant Mol Btol 18, 189-200 33 Gritz, L and Davtes, J (1983) Plasmid-encoded hygromycin B resistance* the sequence of hygromycm B phosphotransferase gene and its expression in Escherzchza colz and Saccharomyces cerevhae Gene 25, 179-l 88 34 Jones,’ J D G., Svab, Z , Harper, E C., Hurwitz, C D , and Mahga, P (1987) A dommant nuclear streptomycin reststance marker for plant cell... Foreign gene expression in plants, m Plant Molecular BtoloeA Practical Approach (Shaw, C H , ed ), IRL, Oxford, pp 131-160 3 Leemans, J., Shaw, C H., Deblaere, R., De Greve, H , Hernalsttens, J.-P, van Montagu, M., and Schell, J (198 1) Site-specific mutagenesis of Agrobactertum Ti-plasmids and transfer of genes to plant cells J MoZ AppZ Genet 1, 149-164 4 Ditta, G , Stanfield, S , Corbm, D., and Helmski,... D R , and DeLuca, M (1985) Cloning of firefly luclferase cDNA and the expression of active luclferase m Eschemhza colz Proc Nat1 Acad Scz USA 82,787&7873 17 Ow., D W , Wood, K V., DeLuca, M , de Wet, J R , Helmski, D R , and Howell, S H (1986) Transient and stable expression of the firefly luctferase gene m plant cells and transgemc plants Science 234, 856-859 18 Mullmeaux, P M., Guermeau, F., and Accotto,... D , Hohn, T., and Potrykus, I (1986) Expression m plants of two ‘bacterial antibiotic resistance genes after protoplast transformation with a new plant expression vector Nucleic Aczds Res 14,5857-5868 3 Guermeau, F., Lucy, A, and Mullineaux, P (1992) Effect of two consensus sequences preceding the translation initiator codon on gene expression m plant protoplasts Plant Mel Biol 18, 815-818 4 Schardl,... Petunia epsps gene (50) 17 Genes for Transformation Expression of a Klebsiella ozaenae nitrilase gene in transgenic tobacco plants resulted in an increased level of tolerance to the herbicide bromoxynil (511, Similarly, expression in transgenic plants of an Alcaligenes eutrophus gene encoding a 2,4-dichlorophenoxyacetate monooxygenase enzyme (DPAM) led to the production of transgenic plants tolerant... populations for regulatory mutants 5 Plant Promoters The number of plant genes isolated and characterized has dramatically increased in the last few years The availability of transformation techniques has made it possible to study gene expression in transgenic plants The use of fusions between promoters and reporter genes has allowed a detailed monitoring of the activity of numerous plant promoters Some promoters... coding sequence, and the hybrid construct was introduced into Petunia plants It appearedthat expression of the hybrid gene occurred in various pigmented and unpigmented cell types of the flower stem, corolla, ovary, anthers, and seedcoat (73) Previous gene fusion and deletion experiments had shown that 800-bp of promoter sequence were more efficient at directing the expression of the cat gene in transgenic... Structural homologies of genes and proteins J Bzol Chem 261,9228-9238 79 Twell, D , Yamaguchi, J., and McCornnck, S (1990) Pollen-specific gene expression m transgenic plants coordinate regulatton of two different tomato gene promoters during mtcrosporogenesis Development 109,705-713 80 Twell, D., Yamaguchi, J , Wmg, R A., Ushtba, J , and McCormick, S (1991) Promoter analysis of genes that are coordinately... expression site; and The Ibft (LB) and right border (RB) from the Ti-plasmld T-DNA, positioned to define a pseudo T-DNA containing the plant selectable marker and tlje MCS Detailed maps and descriptions of the various expression cassettes, selectable markers, and reporter gene sequences are given in Chapter 1 of this volume (see also refs 1,2) Chimeric gene constructs can be readily introduced by standard molecular . marker genes for the selection of transformants, and plant promoters to achieve more specific patterns of gene expression. 2. Expression Cassettes Efficient expression of foreign genes in. expressing foreign genes in plants: expression cassettes into which genes of interest can easily be inserted, assayable reporter genes that allow accurate quantification of gene expression, selectable. activity in plant cells makes this gene inconvenient for sensitive quantification of gene expression. The expression of the neomycin phosphotransferase (nptIl) (see Chapter 12) and phosphinothricin