Báo cáo khoa học: Inhibition of the D-alanine:D-alanyl carrier protein ligase from Bacillus subtilis increases the bacterium’s susceptibility to antibiotics that target the cell wall potx

Inhibition of the D-alanine:D-alanyl carrier protein ligase from Bacillus subtilis increases the bacterium’s susceptibility to antibiotics that target the cell wall Juergen J. May*, Robert Finking* , †, Frank Wiegeshoff, Thomas T. Weber, Nina Bandur, Ulrich Koert and Mohamed A. Marahiel Philipps-Universita ¨ t Marburg, Fachbereich Chemie ⁄ Biochemie, Marburg, Germany The cell wall of most Gram-positive bacteria is com- posed of a thick peptidoglycan fabric containing, in general, two types of anionic polymers: the lipoteichoic acid (LTA) and wall teichoic acid (WTA) which are in most cases modified with a d-alanyl ester or a glycosyl residue [1,2]. In Bacillus subtilis, and several other Gram-positive bacteria such as Staphylococcus aureus, the dlt operon is responsible for the d-alanylation of lipoteichoic and wall teichoic acid [3,4]. Three functions of the d-alan- ylated LTA have been proposed: (a) modulation of the activity of autolysins; (b) maintenance of cation homeo- stasis and assistance in the assimilation of metal cati- ons for cellular functions; and (c) definition of the electrochemical properties of the cell wall [5]. The dlt operon seems to be widespread among Gram-positive bacteria and comprises five ORFs enco- ding the proteins named DltA–E [1,3,4,6] (Fig. 1). DltA is a distinct protein with a molecular mass of 57 kDa that resembles adenylation domains (A-domains) of nonribosomal peptide synthetases (NRPS). Just as for a classic A-domain, DltA was Keywords D-alanyl ligase; DltA; DltC; antibiotics that target the cell wall; DltA inhibitor Correspondence M. A. Marahiel, Philipps-Universita ¨ t Marburg, Fachbereich Chemie ⁄ Biochemie, Hans-Meerwein-Strasse, D-35032 Marburg, Germany Fax: +49 6421 2822191 Tel: +49 6421 2825722 E-mail: marahiel@chemie.uni-marburg.de *These authors contributed equally to this work †Present address University of Cologne, Institute for Genetics, Zu ¨ lpicher Str. 47, 50674 Cologne, Germany (Received 24 February 2005, revised 26 March 2005, accepted 4 April 2005) doi:10.1111/j.1742-4658.2005.04700.x The surface charge as well as the electrochemical properties and ligand binding abilities of the Gram-positive cell wall is controlled by the d-alanylation of the lipoteichoic acid. The incorporation of d-Ala into lipoteichoic acid requires the d-alanine:d-alanyl carrier protein ligase (DltA) and the carrier protein (DltC). We have heterologously expressed, purified, and assayed the substrate selectivity of the recombinant proteins DltA with its substrate DltC. We found that apo-DltC is recognized by both endogenous 4¢-phosphopantetheinyl transferases AcpS and Sfp. After the biochemical characterization of DltA and DltC, we designed an inhib- itor (d-alanylacyl-sulfamoyl-adenosine), which is able to block the d-Ala adenylation by DltA at a K i value of 232 nm in vitro. We also performed in vivo studies and determined a significant inhibition of growth for differ- ent Bacillus subtilis strains when the inhibitor is used in combination with vancomycin. Abbreviations aaRS, amino-acyl-tRNA-synthetases; AcpS, acyl carrier protein phosphopantetheintransferase; CP, carrier protein; D-aa, D-configured amino acids; D-Abu, D-aminobutyric acid; L-aa, L-configured amino acids; LTA, lipoteichoic acid; NRPS, nonribosomal peptide synthetases; PPTases, phosphopantetheintransferase; Sfp, peptidyl carrier protein phosphopanthetheintransferase; WTA, wall teichoic acid. FEBS Journal 272 (2005) 2993–3003 ª 2005 FEBS 2993 thought to specifically select its cognate amino acid, d-Ala, and to activate it as the corresponding amino- acyl-adenylate [3]. Usually in NRPS systems, l-amino acids (l-aa) or carboxy acids are activated and some- times racemized by modular proteins that comprises epimerization ⁄ racemization domains (E-domain) for subsequent conversion in the corresponding d-form. Also, some cases A-domains accept both enantiomers still having the E-domain but only few d-amino acids (d-aa) activating A-domains are known and none are fully biochemical characterized. The open reading frame dLtC encodes the corresponding d-Ala carrier protein (DltC), which subsequently picks up the activa- ted d-Ala with the enzyme bound cofactor 4¢-phospho- pantetheine that binds the amino acid covalently as thioester [7,8] (Fig. 1). In this state, DltC donates d-Ala to LTA, presumably with the help of DltB. After having reached its target location, d-Ala is incor- porated into LTA by action of DltD [5,6,9] (Fig. 1). This protein possesses a membrane anchor and has been proposed to link d-Ala with LTA or WTA [9]. As a consequence, LTA and WTA is almost com- pletely alanylated, which reduces or eliminates the neg- ative surface charge of the bacterial membrane. Reductions in the d-alanyl content of the cell wall influences directly the autolysis mechanism [2,10,11] and renders bacteria sensitive to so-called host defense peptides as well as other intrinsic antibiotic substances [4]. In addition, the ability of Gram-positive bacteria to produce biofilms is abolished [12,13]. Despite the fact that d-alanylation is not necessary for viability and thus at first sight seems to be dispen- sable, various mutants exhibit a wide array of pharma- cological phenotypes. Insertional inactivation of the dlt operon in Staphylococcus aureus and Staphylococcus xylosus leads to enhanced susceptibility of cells to posi- tively charged antimicrobial peptides. In case of Staphylococcus aureus, it was shown that the bacterium can be efficiently killed by human neutrophils and is no longer able to successfully infect mice in contrast to wild type [14]. A clear correlation between the d-alany- lation of LTA and virulence has been established recently also for Streptococcus agalactiae and Listeria monocygotes [15–17]. In Bacillus subtilis, insertional inactivation of the genes of the dlt operon results in an increased rate of autolysis but the strain shows no aberrant morphology, cell growth or basic metabolism [11]. Lactobacillus rhamnosus, on the other hand, exhibits additional defects in cell separation during proliferation. Thus, the d-alanyl esters of LTA appear to play a variety of roles in Gram-positive organisms, which prompted us to design an inhibitor to specific- ally restrain the d-alanylation of the WTA and LTA in Gram-positive bacteria. The pharmacological relevance of the dlt operon seems obvious in light of these findings; a total Fig. 1. D-Ala-biosynthesis gene clusters from B. subtilis and their corresponding domain organization of NRPS-like proteins. (A) Genes are depicted as arrows, proteins as circles. The numbers indicate the aa of the corresponding protein. (B) Reaction catalysed by the proteins DltA and DltC. A, Adenylation domain; CP, carrier protein; Ato, alditol; P, phosphate; DltA–E: proteins involved. Characterization and inhibition of the Dlt system J. J. May et al. 2994 FEBS Journal 272 (2005) 2993–3003 ª 2005 FEBS restriction on the synthesis of biofilms as well as the increased sensitivity to cationic antibiotics and a decrease in virulence would aid in the successful treat- ment of pathogenic bacteria either with the inhibitor alone or in combination with common antibiotics. Recent results extracted from two crystal structures of NRPS-A-domains, PheA [18] and DhbE [19] yielded deep insight into the reaction mechanism for the activa- tion of amino-acid substrates as their corresponding adenylate and demonstrated the high functional analogy of the reaction to amino-acyl-tRNA-synthetases (aaRS) [20]. Despite the fact that these proteins are structurally unrelated [20] the functional analogy inspired us to design an inhibitor, which should efficiently block the aminoacyl adenylation step catalyzed by DltA. The design of the inhibitor was encouraged by the known inhibitors of aaRS [21–25]. These inhibitors were 5¢-O-[N-(aminoacyl)-sulfamoyl] adenosine molecules which are nonhydrolysable analogues of amino acyl adenylates. The concept of these inhibitors was adapted to the NRPS-system to inhibit the A-domains PheA and LeuA [26]. In the following work, we describe the clo- ning and purification of the two proteins DltA and DltC from B. subtilis as well as their biochemical characteri- zation. We have characterized and tested a synthesized d-Ala sulfamoyl adenylate analog in vitro and in vivo and show the efficiency of this molecule in blocking DltA activity in vitro and in vivo. Results Overproduction and purification of DltA and DltC Both proteins were produced as C-terminal His 6 tag fusion proteins and purified by Ni 2+ ⁄ nitrilotriacetic acid-affinity chromatography followed by gel filtration. SDS ⁄ PAGE analysis (not shown) revealed two bands (monomer and putative dimer) in the case of DltC. These two states of the protein result from partial apo- to holo conversion (about 51% holo-form as judged from HPLC analysis) by an E. coli PPTase and prob- ably subsequent dimerization via disulfide bridges as previously reported [8]. DltA and DltC were obtained with a purity > 99% with 20 and 30 mgÆL )1 of cell culture, respectively. Post-translational modification of DltC by AcpS and Sfp The prerequisite for the enzymatic action of DltA on its natural protein partner, DltC, is the modification of this carrier protein (CP) to the active holo-form. To assess the affiliation of DltC with primary or secon- dary metabolism of B. subtilis, kinetics of the modifica- tion with both PPTases (AcpS, the PPTase of primary metabolism and Sfp, the PPTase of secondary metabo- lism) were measured. For this purpose, an HPLC assay was carried out. The ratio of apo- to holo-DltC after heterologous production in E. coli was 48.5–51.5%. For the determination of kinetic constants, the apo- DltC concentration was varied while the CoA concen- tration was kept constant. Kinetic constants were determined through a Michaelis–Menten fit of the data sets (Fig. 2). In the case of AcpS, the K m value for apo-DltC concentrations between 1 and 76 lm was 8.73 ± 0.73 lm with a k cat of 169 ± 4 min )1 . Kinetic constants for Sfp with the apo-DltC concentration ran- ging from 1 to 102 lm were K m ¼ 50.40 ± 5.3 and k cat ¼ 287 ± 16 min )1 . The resulting catalytic efficien- cies for these reactions are 3.23 · 10 5 m )1 Æs )1 and 9.94 · 10 4 m )1 Æs )1 for AcpS and Sfp, respectively. Thus, although the K m of Sfp is almost six times as 0 20 40 60 80 100 120 0 20 40 60 80 100 120 140 160 180 200 k cat 287 ± 16 min -1 K M 50.4 ± 5.3 µM V [1/min] [DCP] [µM] 0 20 40 60 80 100 120 140 160 0 20 40 60 80 100 120 140 160 A B V [1/min] [DCP] [µM] k cat 169.5 ± 4.6 min -1 K M 17.14 ± 1.5 µM Fig. 2. Determination of kinetic constants of B. subtilis Sfp and Acps with apo-DltC as substrate. (A) Reaction mixtures were incu- bated for 10 min (5.6 n M AcpS) and 30 min (11 nM Sfp). A hyper- bolic Michaelis–Menten function was used to fit the kinetic data. The kinetic constants toward the carrier proteins are indicated. (B) Plot of velocity of AcpS against apo-DltC concentration between 1 and 150 l M. Kinetic data for Sfp with apo-DltC-concentrations between 1 and 102 l M. J. J. May et al. Characterization and inhibition of the Dlt system FEBS Journal 272 (2005) 2993–3003 ª 2005 FEBS 2995 high as that of AcpS, the catalytic efficiency is only diminished by a factor of 3.4 making the assignment of DltC to primary or secondary metabolism difficult. This is the first time that AcpS as well as Sfp exhibit a similar catalytic efficiency with the same CP. Substrate specificity and biochemical characterization of DltA The substrate selectivity of DltA toward all proteino- genic amino acids in addition to d-Ala and several other d-amino acids was determined. Until now, no d-aa activating A-domain had been characterized. All A-domains described so far are unable to activate solely a d-aa but activate carboxy acids or l-aa, which are subsequently racemized to their corresponding d-enantiomer with the help of an E-domain. As deduced from the protein product and the selectivity conferring residues of the active site [33], DltA activa- ted solely d-Ala with a slight side-specificity for d-Abu (Fig. 3). The K m value of DltA for d-Ala was subse- quently determined by varying the d-Ala concentration between 1 and 1000 lm. The resulting K m of 13.62 ± 4.18 lm (Fig. 3) is well in the range of the K m of other A-domains for their cognate l-aa [35–37]. Modification of DltC and ACP by DltA Holo-DltC is the natural protein partner of DltA. Nevertheless, it was shown for Lactobacillus rhamnosus that the holo-ACP of fatty acid synthase is also modified by DltA [9]. To assay this finding, the con- centration of d-Ala was kept constant while the con- centration of the CPs was varied. DltA exhibits a K m of 8.04 ± 1.73 lm and a k cat of 48949 ± 5983Æmin )1 for holo-DltC concentrations between 0.12 and 10.05 lm. However, this reaction suffers from severe substrate inhibition if the holo-DltC concentration is raised above 15 lm. Nevertheless, the k cat ⁄ K m of this reaction with a value of 1.01 · 10 8 m )1 Æs )1 demon- strates that the reaction is in fact only limited by diffu- sion. The situation is quite different with ACP of fatty acid synthase, which was not expected to be a natural substrate of DltA. A qualitative assay showed that DltA does indeed modify ACP but our attempt to determine the catalytic constants of this reaction failed. Not only was the amount of ACP needed to reach sat- isfactory values of modification about three times as high as in the case of DltC, saturation was not reached even at 120 lm holo-ACP. The apparent K m deter- mined in this way lies in the mm range, which indicates that ACP is modified in vivo to a significantly lesser extend than is DltC. Inhibition of DltA by 5¢-O-[N-( D-alanyl)- sulfamoyl]adenosine (5) in vitro and its effect on cell growth To test the quality of inhibition by 5, the K i was deter- mined. For this purpose, the concentration of 5 was varied while the concentration of the substrate amino acid, d-Ala, was held constant. Three different sets of data points were collected for three different concen- trations of d-Ala, namely 0.5, 1 and 2 K m . The concen- tration of the inhibitor was plotted against the 1 ⁄ cpm from the ATP ⁄ PP i exchange assays in Dixon plots [38] (Fig. 4). The intersect of the three straight lines yields a K i of 232 nm which is almost 60-fold lower than the 0 50K 100K 150K 200K 250K neg. beta Ala Sarcosin L-Ala L-Arg L-Gly L-Pro L-Asn L-Gln L-Phe L-Asp D-Glu D-Trp D-Abu D-Asp D-Pro D-Val D-Phe D-Leu D-Cys D-Tyr D-Orn D-Allo-Ile D-Ala 0 200 400 600 800 1000 0 20K 40K 60K 80K 100K 120K 140K 160K 180K 200K K M =13.6 ± 4.1 CPM [d-Ala] [µM] Fig. 3. Amino-acid-dependent ATP ⁄ PPi exchange for DltA. To determine the sub- strate selectivity of DltA, assays were performed with all 20 proteinogenic amino acids in addition to several D-aa and sarco- sin. Only some representative amino acids and the substrate acids D-Ala and D-Abu are shown. The highest activity was set to 100%; in this case, it corresponds to 36 m M label exchanged by 500 nM DltA with 0.5 m MD-Ala in 5 min. Inset: kinetic deter- mination of the K m and k cat values. Characterization and inhibition of the Dlt system J. J. May et al. 2996 FEBS Journal 272 (2005) 2993–3003 ª 2005 FEBS K m value of DltA for d-Ala and makes 5 suitable as an inhibitor. To test if the inhibitor 5 was able to penetrate the cell wall to reach its target DltA, we investigated chan- ges in the growth rates of the Gram positive wild type strains B. subtilis JH642 and the the B. subtilis DltA-deletion mutant. This DltA-mutant was used to exclude the possibility that 5 may act as an inhibitor in pathways other than that of DltA. We also test the susceptibility of these strains to a combination of 5 and vancomycin and observed as shown in Fig. 5 a total growth inhibition of wild type strain when vanco- mycin and 5 were used, whereas treatment of wild type cells (B. subtilis JH642) with vancomycin alone without 5 shows after an initial cell inhibition a total recovery of cell growth after 10 h. No such a recovery after 30 h was observed for the DltA mutant when 5 and vancomycin were used simultaneously (Fig. 5). Discussion The biosynthesis of d-alanyl-lipoteichoic acid requires four proteins that are encoded by the dlt operon [5]. The synthesis starts with the selection of the d-Ala by the 57 kDa d-Ala-d-Ala carrier protein ligase (DltA). Following activation by DltA, d-Ala is trans- ferred to the 10 kDa d-alanyl carrier protein DltC which can donate d-Ala to lipoteichoic acids with the help of DltB and DltD to mediate the surface charge of the bacterium (Fig. 1). We have cloned the first two proteins (DltA and DltC) that are involved in the d-alanylation of the Gram-positive cell wall. Pro- duction of the proteins in E. coli works well and the two proteins catalyzes the expected reactions. DltA selectively activates d-Ala with only slight side speci- ficity for the nonproteinogenic amino acid d-Abu (Fig. 3). This is remarkable, as until now no A-domain with a d-aa as the sole substrate has been biochemically characterized. Especially the fact that the enzyme does not activate l-Ala corroborates the finding that A-domains as well as aaRS discriminate not only against different amino acid but also against enantiomers [39]. Determination of the substrate selectivity of A-domains can either be accomplished by ATP ⁄ PP i exchange assays or by analysis of the selectivity-conferring residues guided by the nonribo- somal code of NRPS A-domains [19,33]. Both studies led independently to the determination of d-Ala selectivity for DltA, further substantiating the nonribosomal code. Because Gram-positive bacteria -300 -200-200 -100 00 100 200200 300 400400 -6 -6 1,2x10 -5 1,6x10 -5 2,0x10 -5 2,4x10 -5 K M /2 K M 2 K M 1/V [1/CPM] [I] [nM] 8,0x10 4,0x10 Fig. 4. Dixon plot of inhibition studies with DltA and 5. The concen- tration of the inhibitors was varied as follows: 50, 100, 200, 300 and 400 n M. The D-Ala concentration was as indicated in the plot. 0.01 0.1 1 10 Time (h) D 600 0.01 0.1 1 10 Time (h) D 600 JH642∆DltA +V/+I JH642∆DltA +V/-I JH642∆DltA -V/-I 010 5 15 20 25 30 010 5 15 20 25 3 0 JH642+V/+I JH642 +V/-I JH642 -V/-I A B Fig. 5. Growth inhibition of B. subtilis JH642 (A) and B. subtilis JH642DdltA (B) using vancomycin and the inhibitor 5. The presence (+) and absence (–) of 5 (I) and vancomycin (V) are indicated and the concentrations used are 5 at 1 m M and vancomycin at 0.4 nM. Squares: without vancomycin and 5; diamonds with vancomycin; circles with vancomycin and 5. J. J. May et al. Characterization and inhibition of the Dlt system FEBS Journal 272 (2005) 2993–3003 ª 2005 FEBS 2997 have evolved an A-domain specific for a d-aa, no additional modifying enzyme such as an E-domain is needed to process the adenylate product, which shows the close affiliation of the dlt operon with primary metabolism. Sequence identity of DltC with ACP as well as PCPs is low (17.9% and 2.6–6.8%, respect- ively) but because percentage of homology is closer to ACP, we take this as another hint for association with primary metabolism. Because the dlt operon is not essential for viability, we decided to determine the Michaelis constants for the phosphopantetheinyla- tion of DltC by the PPTases of primary metabolism, namely AcpS, and secondary metabolism, Sfp. Sur- prisingly we found that the k cat values are in the same range for both PPTases whereas, in other cases, discrimination between protein substrates by PPTases is often reflected by these values [32,34,40]. K m values and catalytic efficiency of Sfp, however, are dimin- ished by a factor of 5.8 and 30.8, respectively, com- pared to those determined for AcpS, which is another hint for the fact that DltC is indeed part of primary metabolism. In addition, the K m value of AcpS with DltC compared to that with ACP [32] is almost eight- fold lower. Although we have not determined the abundance of DltC in B. subtilis, ACP is known to be one of the most abundant proteins [41], which ren- ders a low K m unnecessary. In the case of DltC, how- ever, the K m indicates that it is preferred over ACP so that B. subtilis can sustain this pathway even if the amount of DltC was comparatively low. The fact that DltC was shown to be the cognate protein substrate of DltA in other organisms [3,7–9] is in agreement with our findings in B. subtilis. DltA transfers activated d-Ala to DltC with very high effi- ciency (Fig. 2). However, the ACP of fatty acid syn- thase is also aminoacylated [6,42] but an attempt to determine the Michaelis constant failed because satura- tion could not be reached (data not shown). In addi- tion, DltD was shown to exhibit thioesterase activity toward d-alanylated ACP [9] which indicates that loading of ACP by DltA in our in vitro assay is an undesired side reaction. Mutants in several strains defective in DltA produc- tion underline the pharmacological relevance of this system. Blocking of the d-alanylation of the cell wall leads in many pathogenic bacteria to a higher suscepti- bility to cationic antibiotics and host defensins, abol- ishes biofilm production and reduces pathogenicity of these bacteria [4,12–16,43]. Therefore, we have synthes- ized 5 (Scheme 1), which shows the expected inhibitory effect on DltA in vitro. The K i (232 nm, Fig. 4) is well in the range of NRPS A-domain inhibitors [26] and inhibitors of aaRS [23,24]. In addition, the Phe activa- ting A-domain GrsA-A [18, 44] and the carboxy acid activating A-domain DhbE [19] remain unaffected by 5 up to a concentration of 2 mm (data not shown), which shows the specificity expected of this inhibitor. Also, comparison of the K i with the K m of DltA with d-Ala (13.62 lm; Fig. 3), shows that the K i is 60-fold lower which corroborates the suitability of 5 as an inhibitor. Ascamycin is the 2-chloro-l-Ala-sulfamoyl adeny- late analog of 5 (Fig. 6). This substance is a nucleo- side antibiotic found in the fermentation broth of Streptomyces [45]. It was therefore conceivable that, O OO N N N NH 2 HO O S O H 2 NCl 1) NaH, THF, 55°C 2) 0°C O OO N N N NH 2 O S H 2 N O O Boc- D -Ala-OSu DBU, DMF O OO N N N NH 2 O S N H O O O H N Boc O HO OH N N N NH 2 O S N H O O O H 2 N 2TFA TFA/H 2 O 1 2 3 4 5 N N NN Scheme 1. Synthesis of 5¢-O-[N-(D-alaninyl)sulfamoyl]adenosinÆ2TFA (5). For details see Experimental procedures. Characterization and inhibition of the Dlt system J. J. May et al. 2998 FEBS Journal 272 (2005) 2993–3003 ª 2005 FEBS at least to some extent, 5 would be capable of pass- ing the cell wall, rendering it useful for in vivo inhibi- tion studies. If the inhibitor reached its target within the cell, the phenotype of a wild type strain should be similar to that of a DltA deletion mutant. Our results shown in Fig. 5 support this assumption. Phenotypes of several bacterial strains with altered d-Ala content of the cell wall have been reported in the past. S. aureus, for instance, exhibits aberrant cell morphology and an increased susceptibility to the peptide antibiotic vanco- mycin [14] and other cationic antibiotics [46] as well as an impaired virulence [16]. B. subtilis has been shown to be more vulnerable toward endogenous lytic enzymes (autolysis) and b-lactam antibiotics [10,11]. Our in vivo studies on inhibition of DltA in wild type B. subtilis using 5 confirm these earlier results. As can be seen in Fig. 5, the wild type B. subtilis JH642 shows the predicted growth behavior, similar to the dltA mutant. No growth is observed in both strains after 30 h during treatment with 5 and vancomycin. In the presence of vancomycin and in absence of 5, the wild type recovers growth after 12 h incubation and, after 30 h, reaches an attenuance comparable to that of untreated wild type cells. In light of these results it is tempting to speculate that all other phenotypes described for mutants of dLtA [5] could be induced by addition of the inhibitor. Especially the lowered pathogenicity and the vulnerab- ility to host defensins observed in dLtA mutants of pathogenic strains [4,14,15,17,47,48] are of outstanding pharmacological interest. Also, the fact that the tar- geted DltA seems to have no protein counterpart in the human body makes 5 a promising scaffold for developing a drug candidate with pharmacological relevance to boost the effectiveness of antibiotics such as vancomycin. Experimental procedures Synthesis of 5¢-O-[N-(D-alanyl)-sulfamoyl]- adenosineÆ2TFA (5) 5¢-O-[N-(d-Alanyl)-sulfamoyl]-adenosineÆ2TFA was synthes- ized as shown in Scheme 1. 2¢,3¢-O-Isopropyliden-5¢-O-sulfamoyl-adenosine (3) Two grams (6.53 mmol) 2¢,3¢-O-isopropyliden-adenosine (1) were added in four portions to a suspension of 1.045 g (26.12 mmol) sodium hydride (60%, v ⁄ v, in mineral oil) in 100 mL tetrahydrofuran (THF) under argon atmosphere. After stirring for 75 min at 55 °C, the mixture was cooled to 0 °C. A solution of 289 mg (2.5 mmol) sulfamoyl chlo- ride (2), prepared as described previously [27], in 15 mL THF was added dropwise within 30 min, while the tem- perature was maintained at 1–3 °C. The mixture was stirred for an additional 3 h at 0 °C and the reaction was termin- ated by the addition of 7 mL methanol. The solvents were removed in vacuo and the residue was dissolved in water, adsorbed on silica and purified by flash-column chro- matography (CHCl 3 ⁄ MeOH, 9 : 1, v ⁄ v) to give 1.741 g (4.51 mmol, 86%) of sufamoyl-adenosine (3) as a colorless foam. 1 H-NMR (200 MHz, DMSO-d 6 ): 8.22 (s, 1H), 8.08 (s, 1H), 7.53 (s, br, 2H), 7.31 (s, br, 2H), 6.22 (d, J ¼ 2.4 Hz, 1H), 5.42 (dd, J ¼ 6.3, 2.4 Hz, 1H), 5.07 (dd, J ¼ 6.3, 3.0 Hz, 1H), 4.44–4.33 (m, 1H), 4.28–4.03 (m, 1H), 1.54 (s, 3H), 1.33 (s, 3H). MS (ESI): 387 (M + H + ). 2¢,3¢-O-Isopropylidene-5¢-O-[N-(N-tert-butoxycarbonyl- D-alanyl)-sulfamoyl]-adenosine (4) A solution of 182 mg (0.63 mmol) Boc-d-Ala-OSu in 0.5 mL dimethylformamide (DMF) was added within 30 min to a solution of 245 mg (0.63 mmol) 2,3-O-isopro- pyliden-5¢-O-sulfamoyl-adenosine (3) and 97 lL (0.63 mmol) 1,8 diazobicyclo (5.4.0) undec-7-en (DBU) in 4 mL DMF. The mixture was stirred for 3 h at room temperature before the organic solvent was removed in vacuo. The residue was taken up in 20 mL water and extracted four times with a total of 125 mL CHCl 3 and once with 25 mL of CHCl 3 ⁄ iPrOH, 5 : 1 (v ⁄ v). The organic layers were combined, washed with 20 mL of a saturated aqueous NaCl solution and dried with Na 2 SO 4 . Removal of the solvents in vacuo and purification by flash-column chromatography (CHCl 3 ⁄ MeOH ⁄ iPrOH, 8 : 1 : 1, v ⁄ v ⁄ v) gave 260 mg (0.47 mmol, 74%) of sulfamoyl-adenosine (4) as a colorless solid. MS (ESI): 558 (M + H + ). O HO OH N N N N O NH 2 S H N O O O H 2 N DltA inhibitor Ascamycin O HO OH N N N N O NH 2 S H N O O O H 2 N Cl Fig. 6. Chemical structure of the DltA inhibitor and ascamycin. J. J. May et al. Characterization and inhibition of the Dlt system FEBS Journal 272 (2005) 2993–3003 ª 2005 FEBS 2999 5¢-O-[N-(D-Alanyl)-sulfamoyl]-adenosineÆ2TFA (5) Protected adenosinesulfonamide 4 (116 mg; 0.30 mmol) was dissolved in 3.5 mL water and 3.5 mL TFA were added. The mixture was stirred at room temperature for 3 h. After evaporation of the solvents in vacuo the crude product was purified by HPLC. The solution was purified using HPLC (Amersham ⁄ Pharmacia Aekta purifier, Uppsala, Sweden), Nucleodur column (Macherey and Nagel, Du ¨ ren, Germany) and monitored at 214 and 247 nm. The following gradient profile was used at a flow rate of 6 mLÆ min )1 , applying the sample at 5% (v ⁄ v) buffer B and performing a two step gradient. The first step was, after washing the column with one column volume (19.36 mL), from 5 to 25% buffer A in seven column volumes followed by the second step to 100% buffer B in one column volume [buffer A, 0.1% (v ⁄ v) TFA in H 2 O; buffer B, 0.1% (v ⁄ v) TFA in aceto- nitrile] to give after several runs 134 mg (0.27 mmol) of pure deprotected adenosinesulfonamide (5). Subsequently the peaks were verified by mass spectrometry on a Hewlett Packard 1100 Series machine. After pooling the collected peaks the solution was freeze dried and resuspended in water given a concentration of 100 mm (5). Growth conditions E. coli was grown on Luria–Bertani medium. Antibiotics were used at the following concentrations, ampicillin 100 lgÆmL )1 , kanamycin 25 lgÆmL )1 . For E. coli tech- niques, such as transformation and plasmid preparation, standard protocols were used [28]. Vent polymerase (New England Biolabs, Schwalbach, Germany) or Pwo poly- merase (Roche, Mannheim, Germany) was used to amplify gene fragments for cloning and expression purposes. Oligo- nucleotides were purchased from Qiagen-Operon (Cologne, Germany). All resulting clones were sequenced twice on an ABI prism sequencer according to the manufacturer’s protocol. Construction of deletion strain JH642 DdltA The B. subtilis dLtA deletion strain was constructed by the method described by [29]. The 5¢ and 3¢ flanking regions of the dltA gene were PCR amplified using the primer pairs dLtA-P1 ⁄ dLtA-P2 and dLtA-P3 ⁄ dLtA-P4, respectively. The primers dLtA-P2 and dLtA-P3 contain complementary sequences to the ends of the kanamycin resistance cassette of the plasmid pDG783 [30]. The 5¢ and 3¢ flanking regions and the kanamycin cassette were combined in a second PCR with successive amplification of a 3435 bp fragment after addition of primers dLtA-P1 and dLtA-P4. B. subtilis strain JH642 was transformed with the PCR fragment, carrying the kanamycin resistance cassette between the flanking regions, resulting in JH642 DdltA. Successful integration of the kanamycin resistency cassette was con- firmed by PCR. dLtA-P1, 5¢-ACAAATATAGACACCGAGCAAAATGG CAA; dLtA-P2, 5¢- CGAGCTCGAATTCGTAATCATGGT CATATTATAAATATATGAACCGCTATTCGCGGT-3¢ (3¢ kanamycin fragment underlined); dLtA-P3, 5¢- GTAT AATCTTACCTATCACCTCAAATGGTTCTCGTTTTTA TTCTTTATACTGCTTGGCAT-3¢ (5¢ kanamycin fragment underlined); dLtA-P4, 5¢-GTTTTTGATCCACTTTTTCTT AGTCATCCA-3¢. Construction of plasmids Construction of pQE60-dLtC The dltC gene encoding the B. subtilis DltC was amplified by PCR using oligonucleotides 5¢-ATA CCATGGATT TTAAACAAGAAG-3¢ and 5¢-ATA AGATCTTTTCAA CTCAGACAGCT-3¢ (restriction sites are underlined) from chromosomal DNA of B. subtilis MR168. The amplified fragment was digested with NcoI and BglII and ligated into the NcoI and BglII sites of pQE60 (Qiagen, Hilden, Ger- many). The resulting plasmid pQE60-dLtC encodes the recombinant DltC with a C-terminal tag RSHHHHHH. Construction of pQE60-dLtA The dltA gene encoding B. subtilis DltA was amplified by PCR with oligonucleotides 5¢-GATACCATGGAACTT TTACATGCTATTCAAACAC-3¢ and 5¢-GATAAGATCT TACAAGAACCTCTTCGCCAATG-3¢ from chromosomal DNA of B. subtilis ATCC21332 and, after restriction digest of the amplified fragment, ligated into the NcoI and BglII sites of pQE60 (Qiagen). The resulting plasmid pQE60- dLtA encodes the recombinant DltA with a C-terminal tag RSHHHHHH. Overproduction and purification of recombinant proteins E. coli M15 (Qiagen) was transformed with pQE60-dLtC or pQE60-dLtA for the production of the His 6 fusion proteins DltC and DltA, respectively. An overnight culture (5 mL) of these strains was inoculated into 500 mL of LB medium. The production culture was grown to D 600 of 0.7 at 37 °C and 250 r.p.m. at which expression was induced by addition of isopropyl thio-b-d-galactoside (1 mm final concentra- tion). The culture was allowed to grow for an additional 3–5 h before being harvested by centrifugation at 7000 g and 4 °C. Cells were lysed by three passages through a cooled French pressure cell. The resulting crude extract was centrifuged at 36 000 g at 4 °C for 30 min. Ni 2+ ⁄ nitrilotri- acetic acid chromatography was carried out as described previously [31]. The proteins were purified further by gel filtration chromatography using buffer GFC (50 mm Characterization and inhibition of the Dlt system J. J. May et al. 3000 FEBS Journal 272 (2005) 2993–3003 ª 2005 FEBS Tris ⁄ HCl pH 7.0) in the case of DltC and dialysis buffer (50 mm Hepes, 100 mm NaCl, pH 7.8) for DltA. For DltC, glycerol was added to the protein solutions (10% final con- centration, v ⁄ v) to be stored at )80 °C. ACP, AcpS and Sfp were produced and purified as described previously [32]. Protein concentrations were determined based on the calculated extinction coefficient at 280 nm: DltA-His 6 49 650 m )1 Æcm )1 , DltC-His 6 5810 m )1 Æcm )1 . ATP-pyrophosphate exchange reaction The amino-acid selectivity of DltA was assayed with the ATP ⁄ PP i exchange assay as previously described for other A-domains [33]. For the determination of kinetic constants, reaction mixtures (in triplicate) containing 1–1000 lm d-Ala were incubated at 37 °C for 30 s until the reaction was stopped by addition of 800 lL ice-cold termination mix [100 mm sodium pyrophosphate, 560 mm perchloric acid, 1.2% (w ⁄ v)]. The incorporated radioactivity, which correlates directly with the enzyme activity, was counted in a liquid scintillation counter. K i values were determined in essentially the same man- ner, except that reaction mixtures (in triplicate) contained 6.8–27.2 lmd-Ala and 25–400 nm inhibitor. Posttranslational modification of DltC by AcpS and Sfp For kinetic studies, the amount of holo-carrier protein formed was determined by an HPLC method essentially as described previously [34]. Reaction mixtures (800 lL) con- taining 1–150 lm apo-DltC, 50 mm Tris ⁄ HCl pH 8.8 (75 mm Mes ⁄ NaAc pH 6.0 in the case of Sfp) 12.5 mm MgCl 2 ,2mm dithiothreitol, 1 mm CoA and 5.6 nm AcpS of B. subtilis or 11 nm Sfp were incubated at 37 °C for 10 min. The reaction was stopped and the protein precipita- ted by the addition of TCA to a final concentration of 10%. Reaction mixtures were centrifuged for 30 min at 16 000 g and 4 °C in a table top centrifuge. The pellet was subsequently resuspended in 120 lLof1m Tris ⁄ HCl pH 8.8. A 100 lL sample of this solution was injected onto a reversed phase HPLC column (Nucleosil C18, 250 mm, 5 lm, 300 A ˚ ; Macherey and Nagel) equilibrated with 5% solvent A [0.1% (v ⁄ v) TFA in water]. Apo- and holo-DltC could be separated by applying a 24.3 mL linear gradient 5% to 70% solvent B [0.1% (v ⁄ v) TFA in acetonitrile] fol- lowed by a 2.7 mL linear gradient to 95% solvent B (flow- rate 0.9 mLÆmin )1 at 45 °C). Samples were examined for their A 220 . Under these conditions, the holo-carrier protein migrates faster than the apo-form. Retention times for the respective holo- and apo-carrier proteins were: DltC, 23.51 and 25.06 min; ACP, 21.02 and 21.76 min. The amount of holo-DltC formed was determined by comparing the peak area of the holo-DltC formed with those of both apo- and holo-DltC and substracting the amount of holo-DltC that was already present after the heterologous expression of the protein in E. coli. Kinetic analysis of the carrier protein modification by DltA Kinetic studies of the modification of DltC and ACP by DltA were carried out by varying the carrier protein con- centration while the d-Ala concentration was kept constant. Reaction mixtures contained 0.12–10.05 lm holo-DltC or 0.19–119.5 lm holo-ACP, 10 mm MgCl 2 ,2mm ATP and 130 lmd-Ala (55 mCiÆ mmol )1 , 100 l CiÆmL )1 )in50lL assay buffer and were preincubated at 37 °C for 2 min. The reaction was started by the addition of 200 nm DltA (600 nm in the case of ACP) in 50 lL assay buffer pre- heated to 37 °C and allowed to proceed for 1 min (2 min in the case of ACP) before it was quenched and the proteins precipitated by the addition of 800 lL 10% (v ⁄ v) TCA. 15 lL of a 25 mgÆmL )1 BSA solution were added and the proteins were collected by centrifugation for 30 min in a table-top centrifuge at 4 °C. The protein pellet was washed twice with 1 mL ice-cold 10% (v ⁄ v) TCA and subsequently dissolved in 180 lL formic acid. This protein solution was mixed with 3.5 mL Rotiszint Eco Plus scintillation fluid (Roth, Karlsruhe, Germany) and counted using a 1900CA Tri-Carb liquid scintillation analyzer (Packard, Dreieich, Germany). Quality of inhibition by (5) in vivo To test whether 5 enhances the susceptibility of B. subtilis to vancomycin as well as quantifying the inhibition of 5 in vivo, growth curves in LB medium were measured. The growth curves were carried out in 96-well plates (200 lL per well) using B. subtilis JH642 and B. subtilis JH642DdltA and 5 at 1 m m and vancomycin at 0.4 nm. The A 580 was measured in a plate reader (PerklinElmer ⁄ Wallac Victor2 multilable counter, Ju ¨ gesheim, Germany) at 37 °C. Acknowledgements We would like to thank Antje Scha ¨ fer for excellent technical assistance. This work was supported by the Deutsche Forschungsgemeinschaft (DFG) and Fonds der chemischen Industrie. References 1 Hyyrylainen HL, Vitikainen M, Thwaite J, Wu H, Sarvas M, Harwood CR, Kontinen VP & Stephenson K (2000) d-Alanine substitution of teichoic acids as a modulator of protein folding and stability at the cyto- plasmic membrane ⁄ cell wall interface of Bacillus subtilis. J Biol Chem 275, 26696–26703. J. J. May et al. Characterization and inhibition of the Dlt system FEBS Journal 272 (2005) 2993–3003 ª 2005 FEBS 3001 2 Fischer W (1988) Physiology of lipoteichoic acids in bacteria. Adv Microb Physiol 29, 233–302. 3 Perego M, Glaser P, Minutello A, Strauch MA, Leo- pold K & Fischer W (1995) Incorporation of d-Alanine into lipoteichoic acid and wall teichoic acid in Bacillus subtilis. Identification of genes and regulation. J Biol Chem 270, 15598–15606. 4 Peschel A, Otto M, Jack RW, Kalbacher H, Jung G & Gotz F (1999) Inactivation of the dlt operon in Staphy- lococcus aureus confers sensitivity to defensins, prote- grins, and other antimicrobial peptides. J Biol Chem 274, 8405–8410. 5 Neuhaus FC & Baddiley J (2003) A continuum of anio- nic charge: structures and functions of d-alanyl-teichoic acids in Gram-positive bacteria. Microbiol Mol Biol Rev 67, 686–723. 6 Neuhaus FC, Heaton MP, Debabov DV & Zhang Q (1996) The dlt operon in the biosynthesis of d-alanyl- lipoteichoic acid in Lactobacillus casei. Microb Drug Resist 2, 77–84. 7 Kiriukhin MY and Neuhaus FC (2001) d-Alanylation of lipoteichoic acid: role of the d-alanyl carrier protein in acylation. J Bacteriol 183, 2051–2058. 8 Debabov DV, Heaton MP, Zhang Q, Stewart KD, Lambalot RH & Neuhaus F.C (1996) The d-alanyl car- rier protein in Lactobacillus casei: cloning, sequencing, and expression of dltC. J Bacteriol 178, 3869–3876. 9 Debabov DV, Kiriukhin MY & Neuhaus FC (2000) Biosynthesis of lipoteichoic acid in Lactobacillus rham- nosus: role of DltD d-alanylation. J Bacteriol 182, 2855–2864. 10 Wecke JPM & Fischer W (1996) d-Alanine deprivation of Bacillus subtilis teichoic acids is without effect on cell growth and morphology but affects the autolytic activ- ity. Microb Drug Resist 2, 123–129. 11 Wecke JMK & Fischer W (1997) The absence of d-alanine from lipoteichoic acid alters surface charge, enhances autolysis and increases susceptibility to methicillin in Bacillus subtilis. Microbiology 143, 2953– 2960. 12 Gross M, Cramton SE, Gotz F & Peschel A (2001) Key role of teichoic acid net charge in Staphylococcus aureus colonization of artificial surfaces. Infect Immun 69, 3423–3426. 13 Gotz F (2002) Staphylococcus and biofilms. Mol Micro- biol 43, 1367–1378. 14 Peschel A, Vuong C, Otto M and Gotz F (2000) The d-Alanine residues of Staphylococcus aureus teichoic acids alter the susceptibility to vancomycin and the activity of autolytic enzymes. Antimicrob Agents Chemo- ther 44, 2845–2847. 15 Poyart C, Pellegrini E, Marceau M, Baptista M, Jaubert F, Lamy MC & Trieu-Cuot P (2003) Attenuated viru- lence of Streptococcus agalactiae deficient in d-alanyl- lipoteichoic acid is due to an increased susceptibility to defensins and phagocytic cells. Mol Microbiol 49, 1615– 1625. 16 Collins LV, Kristian SA, Weidenmaier C, Faigle M, Van Kessel KP, Van Strijp JA, Gotz F, Neumeister B & Peschel A (2002) Staphylococcus aureus strains lack- ing d-alanine modifications of teichoic acids are highly susceptible to human neutrophil killing and are viru- lence attenuated in mice. J Infect Dis 186, 214–219. 17 Abachin E, Poyart C, Pellegrini E, Milohanic E, Fiedler F, Berche P & Trieu-Cuot P (2002) Formation of d-alanyl-lipoteichoic acid is required for adhesion and virulence of Listeria monocytogenes. Mol Microbiol 43, 1–14. 18 Conti E, Stachelhaus T, Marahiel MA & Brick P (1997) Structural basis for the activation of phenylalanine in the non-ribosomal biosynthesis of gramicidin S. EMBO J 16, 4174–4183. 19 May JJKN, Marahiel MA & Stubbs MT (2002) Crystal structure of DhbE, an archetype for aryl acid activating domains of modular nonribosomal peptide synthetases. Proc Natl Acad Sci USA 99, 12120–12125. 20 Weber T & Marahiel MA (2001) Exploring the domain structure of modular nonribosomal peptide synthetases. Structure 9, R3–R9. 21 Cusack S (1997) Aminoacyl-tRNA synthetases. Curr Opin Struct Biol 7, 881–889. 22 Forrest AK, Jarvest RL, Mensah LM, O’Hanlon PJ, Pope AJ & Sheppard RJ (2000) Aminoalkyl adenylate and aminoacyl sulfamate intermdediate analogues differ- ing greatly in affinity for their cognate Staphylococcus aureus tRNA synthetases. Bioorg Med Chem Lett 10, 1871–1874. 23 Pope AJ, Moore KJ, McVey M, Mensah L, Benson N, Osbourne N, Broom N, Brown MJB & O’Hanlon P (1998) Characterization of isoleucyl-t-RNA synthetase from Staphylococcus aureus II. Mechnism of inhibition by reaction intermediate and pseudomonic acid ana- logues studied using transient and steady-state kinetics. J Biol Chem 273, 31691–31701. 24 Pope AJ, Lapointe J, Mensah L, Benson N, Brown MJB & Moore KJ (1998) Characterization of isoleucyl- t-RNA synthetase from Staphylococcus aureus I: Kinetic mechanism of the substrate activation reaction studied by transient and steady-state techniques. J Biol Chem 273, 31680–31690. 25 Ueda H, Yoshimitsu S, Hayashi N & Mitsunaga J (1991) X-ray crystallographic study of 5¢-O[N-(l-ala- nyl)-sulfamoyl]adenosine, a substrate analogue for alanyl-tRNA synthetase. Biochim Biophys Acta 1080, 126–134. 26 Finking R, Neumuller A, Solsbacher J, Konz D, Kretzschmar G, Schweitzer M, Krumm T & Marahiel MA (2003) Aminoacyl adenylate substrate analogues for the inhibition of adenylation domains of nonriboso- mal peptide synthetases. Chembiochem 4, 903–906. Characterization and inhibition of the Dlt system J. J. May et al. 3002 FEBS Journal 272 (2005) 2993–3003 ª 2005 FEBS [...]... Losick R (2001) Bacillus subtilis and its closest relatives: from genes to cells ASM Press 37 Heaton MP & Neuhaus FC (1992) Biosynthesis of d-alanyl-lipoteichoic acid: cloning, nucleotide sequence, and expression of the Lactobacillus casei gene for the d-alanine-activating enzyme J Bacteriol 174, 4707– 4717 FEBS Journal 272 (2005) 2993–3003 ª 2005 FEBS Characterization and inhibition of the Dlt system... peptide synthetases by module and domain fusions Proc Natl Acad Sci USA 97, 5848– 5853 30 May JJ, Wendrich TM & Marahiel MA (2001) The dhb operon of Bacillus subtilis encodes the biosynthetic template for the catecholic siderophore 2,3-dihydroxybenzoate-glycine-threonine trimeric ester bacillibactin J Biol Chem 276, 7209–7217 31 Kuchel PW & Ralston GB (1988) Schaum’s Outline of Theory and Problems of Biochemistry... Recognition of hybrid peptidyl carrier proteins ⁄ acyl carrier proteins in nonribosomal peptide synthetase modules by the 4¢-phosphopantetheinyl transferases AcpS and Sfp J Biol Chem 277, 17023–17031 35 Finking R, Solsbacher J, Konz D, Schobert M, Schafer A, Jahn D & Marahiel MA (2002) Characterization of a new type of phosphopantetheinyl transferase for fatty acid and siderophore synthesis in Pseudomonas aeruginosa... A Laboratory Manual Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 46 Kuwayama H, Obara S, Morio T, Katoh M, Urushihara H & Tanaka Y (2002) PCR-mediated generation of a gene disruption construct without the use of DNA ligase and plasmid vectors Nucleic Acids Res 30, E2 47 Guerout-Fleury AM, Shazand K, Frandsen N & Stragier P (1995) Antibiotic-resistance cassettes for Bacillus subtilis. .. Yang XL, Lovato MA, Skene RJ, McRee DE, De Pouplana LR & Schimmel P (2004) Alanyl-tRNA synthetase crystal structure and design for acceptor-stem recognition Mol Cell 13, 829–841 33 Mootz HD, Finking R & Marahiel MA (2001) 4¢-Phosphopantetheine transfer in primary and secondary metabolism of Bacillus subtilis J Biol Chem 276, 37289– 37298 34 Mofid MR, Finking R & Marahiel MA (2002) Recognition of hybrid... (1999) The specificity-conferring code of adenylation domains in nonribosomal peptide synthetases Chem Biol 6, 493– 505 28 Mootz HD & Marahiel MA (1997) The tyrocidine biosynthesis operon of Bacillus brevis: complete nucleotide sequence and biochemical characterization of functional internal adenylation domains J Bacteriol 179, 6843– 6850 29 Mootz HD, Schwarzer D & Marahiel MA (2000) Construction of hybrid... Liang NS & Weiss JP (2002) Role of charge properties of bacterial envelope in bactericidal action of human group IIA phospholipase A2 against Staphylococcus aureus J Biol Chem 277, 47636–47644 39 Stachelhaus T & Marahiel MA (1995) Modular structure of peptide synthetases revealed by dissection of the multifunctional enzyme GrsA J Biol Chem 270, 6163– 6169 40 Isono K, Uramoto M, Osada H, Ubukata M, Kusakabe... sensitivity J Bacteriol 182, 6055–6065 43 Peschel A, Jack RW, Otto M, Collins LV, Staubitz P, Nicholson G, Kalbacher H, Nieuwenhuizen WF, Jung G, Tarkowski A, van Kessel KP & van Strijp JA (2001) Staphylococcus aureus resistance to human defensins and evasion of neutrophil killing via the novel virulence factor MprF is based on modification of membrane lipids with l-lysine J Exp Med 193, 1067–1076 44 Schneider... biological activity of ascamycin, a new nucleoside antibiotic Nucleic Acids Symp Ser, 65–67 41 Peschel A & Collins L.V (2001) Staphylococcal resistance to antimicrobial peptides of mammalian and bacterial origin Peptides 22, 1651–1659 42 Boyd DA, Cvitkovitch DG, Bleiweis AS, Kiriukhin MY, Debabov DV, Neuhaus FC & Hamilton IR (2000) Defects in d-alanyl-lipoteichoic acid synthesis in Streptococcus mutans... K, Frandsen N & Stragier P (1995) Antibiotic-resistance cassettes for Bacillus subtilis Gene 167, 335–336 48 Stachelhaus T & Walsh CT (2000) Mutational analysis of the epimerization domain in the initiation module PheATE of gramicidin S synthetase Biochemistry 39, 5775–5787 3003 . Inhibition of the D-alanine:D-alanyl carrier protein ligase from Bacillus subtilis increases the bacterium’s susceptibility to antibiotics that target the cell wall Juergen J inhibitor. To test if the inhibitor 5 was able to penetrate the cell wall to reach its target DltA, we investigated chan- ges in the growth rates of the Gram positive wild type strains B. subtilis. 5). Discussion The biosynthesis of d-alanyl-lipoteichoic acid requires four proteins that are encoded by the dlt operon [5]. The synthesis starts with the selection of the d-Ala by the 57 kDa d-Ala-d-Ala carrier