Báo cáo khoa học: Aspergillus nidulans a-galactosidase of glycoside hydrolase family 36 catalyses the formation of a-galacto-oligosaccharides by transglycosylation doc

Aspergillus nidulans a-galactosidase of glycoside hydrolase family 36 catalyses the formation of a-galacto-oligosaccharides by transglycosylation Hiroyuki Nakai 1 , Martin J. Baumann 1 , Bent O. Petersen 2 , Yvonne Westphal 3 , Maher Abou Hachem 1 , Adiphol Dilokpimol 1 , Jens Ø. Duus 2 , Henk A. Schols 3 and Birte Svensson 1 1 Enzyme and Protein Chemistry, Department of Systems Biology, Technical University of Denmark, Lyngby, Denmark 2 Carlsberg Laboratory, Valby, Denmark 3 Laboratory of Food Chemistry, Wageningen University, The Netherlands Keywords acceptor specificity; carbohydrate structural analysis; transglycosylation; a-galacto- oligosaccharides; a-galactosidase Correspondence B. Svensson, Enzyme and Protein Chemistry, Department of Systems Biology, Technical University of Denmark, Søltofts Plads, Building 224, DK-2800 Kgs. Lyngby, Denmark Fax: +45 4588 6307 Tel: +45 4525 2740 E-mail: bis@bio.dtu.dk (Received 17 May 2010, revised 2 July 2010, accepted 5 July 2010) doi:10.1111/j.1742-4658.2010.07763.x The a-galactosidase from Aspergillus nidulans (AglC) belongs to a phyloge- netic cluster containing eukaryotic a-galactosidases and a-galacto-oligosac- charide synthases of glycoside hydrolase family 36 (GH36). The recombinant AglC, produced in high yield (0.65 gÆL )1 culture) as His-tag fusion in Escherichia coli, catalysed efficient transglycosylation with a-(1 fi 6) regioselectivity from 40 mm 4-nitrophenol a-d-galactopyranoside, melibiose or raffinose, resulting in a 37–74% yield of 4-nitrophenol a-d-Galp-(1 fi 6)-d-Galp, a-d-Galp-(1 fi 6)-a-d-Galp-(1 fi 6)-d-Glc p and a-d-Galp-(1 fi 6)-a-d-Galp-(1 fi 6)-d-Glcp-(a1 fi b2)-d-Fruf (stachyose), respectively. Furthermore, among 10 monosaccharide acceptor candidates (400 mm) and the donor 4-nitrophenol a-d-galactopyranoside (40 mm), a-(1 fi 6) linked galactodisaccharides were also obtained with galactose, glu- cose and mannose in high yields of 39–58%. AglC did not transglycosylate monosaccharides without the 6-hydroxymethyl group, i.e. xylose, l-arabi- nose, l-fucose and l-rhamnose, or with axial 3-OH, i.e. gulose, allose, altrose and l-rhamnose. Structural modelling using Thermotoga maritima GH36 a-galactosidase as the template and superimposition of melibiose from the complex with human GH27 a-galactosidase supported that recognition at subsite +1 in AglC presumably requires a hydrogen bond between 3-OH and Trp358 and a hydrophobic environment around the C-6 hydroxymethyl group. In addition, successful transglycosylation of eight of 10 disaccharides (400 mm), except xylobiose and arabinobiose, indicated broad specificity for interaction with the +2 subsite. AglC thus transferred a-galactosyl to 6-OH of the terminal residue in the a-linked melibiose, maltose, trehalose, sucrose and turanose in 6–46% yield and the b-linked lactose, lactulose and cello- biose in 28–38% yield. The product structures were identified using NMR and ESI-MS and five of the 13 identified products were novel, i.e. a-d-Galp-(1 fi 6)-d-Manp; a-d-Galp-(1 fi 6)-b-d-Glcp-(1 fi 4)-d-Glcp; a-d-Galp-(1 fi 6) -b-d-Galp-( 1 fi 4)-d-Fruf; a-d-Ga lp-(1 fi 6)-d-Glcp-( a1 fi a1)- d-Glcp; and a-d-Galp-(1 fi 6)- a-d-Glcp-(1 fi 3)-d-Fruf. Abbreviations AglC, a-galactosidase from Aspergillus nidulans; GalA, a-galactosidase from Thermotoga maritima; GH, glycoside hydrolase family; HPAEC-PAD, high-performance anion-exchange chromatography equipped with pulsed amperometric detection; pNP, 4-nitrophenol; pNPaAra, 4-nitrophenyl a- L-arabinopyranoside; pNPaAraf, 4-nitrophenyl a-L-arabinofuranoside; pNPaGal, 4-nitrophenyl a-D-galactopyranoside; pNPaGalNAc, 4-nitrophenyl N-acetyl a- D-galactosaminiside; pNPaGlc, 4-nitrophenyl a-D-glucopyranoside; pNPaGlcNAc, 4-nitrophenyl N-acetyl a- D-glucosaminiside; pNPaMan, 4-nitrophenyl a-D-mannopyranoside; pNPaRha, 4-nitrophenyl a-L-rhamnopyranoside; pNPaXyl, 4-nitrophenyl a- D-xylopyranoside; pNPbGal, 4-nitrophenyl b-D-galactopyranoside. 3538 FEBS Journal 277 (2010) 3538–3551 ª 2010 The Authors Journal compilation ª 2010 FEBS Introduction a-Galactosidases (EC 3.2.1.22) are exo-acting glycoside hydrolases that catalyse the release of galactose from a-galacto-oligosaccharides, e.g. melibiose [a-d-Galp-(1 fi 6)-d-Glcp], raffinose [a-d-Galp-(1 fi 6)-d-Glcp-(a1 fi b2)-d-Fruf] and stachyose [a-d-Galp-(1 fi 6)-a-d-Galp- (1 fi 6)-d-Glcp-(a1 fi b2)-d-Fruf], polymeric galacto- mannans containing a-(1 fi 6) linked galactosyl resi- dues bound to a b-(1 fi 4) mannan backbone and galactolipids [1]. a-Galactosidases occur widely in bac- teria [2–11], fungi [12–15], plants [16,17] and animals [18,19] and have been classified based on substrate specificity [20] and sequence similarity [21]. With regard to substrate specificity, one type of a-galactosi- dase from fungi and plants acts specifically on a-galac- to-oligosaccharides, whereas another type is able to degrade both these and polymeric galactomannans. a-Galactosidases are classified into glycoside hydrolase families GH4, GH27, GH36, GH57, GH97 and GH110 [21]. Eukaryotic a-galactosidases belong to GH27 and GH36, which form clan GH-D together with GH31 (http://www.cazy.org/) [21] and are consid- ered to have a common evolutionary origin [22]. Hydrolysis of GH27 [23] and GH36 [24] catalysed by a-galactosidases proceeds via a double-displacement mechanism, resulting in net retention of the stereo- chemistry at the anomeric centre [25]. First, the general acid catalyst protonates the glycosidic oxygen concom- itantly with bond cleavage and the catalytic nucleo- phile forms a covalent glycosyl-enzyme intermediate by direct attack at the anomeric centre. In the next step, water is deprotonated by the general base catalyst and attacks the anomeric centre, releasing the carbohydrate moiety. For GH36, the nucleophile and the acid ⁄ base catalysts of Thermotoga maritima a-galactosidase (GalA) were identified by mutational and structural analyses to be Asp327 and Asp387, respectively [24]. In GH27, both labelling with mechanism-based inhibi- tors [26,27] and crystal structures of ligand complexes of a-galactosidase [27,28] and a-N-acetylgalactosamini- dase (EC 3.2.1.49) [29] identified the catalytic residues, whereas no crystal structure was available of a ligand complex for GH36. a-Galactosidases have been reported to form a-ga- lacto-oligosaccharides at high substrate concentrations by catalysing the transfer of a galactosyl moiety to an acceptor with a-(1 fi 3), a-(1 fi 4) or a-(1 fi 6) regi- oselectivity [2–4,30–35]. Chemo-enzymatic synthesis using suitable donor and acceptor pairs can produce raffinose, a-d-Galp-(1 fi 6)-b-d-Galp-(1 fi 4)-d-Glcp and a-d-Galp-(1 fi 6)-a-d-Glcp-(1 fi 4)-d-Glcp with melibiose as the donor and sucrose, lactose and maltose as acceptors, respectively [30,31]. Detailed acceptor specificity, however, has not been investigated previously for GH36 a-galactosidases and a survey is presented here of suitable acceptors. The results obtained may also provide a certain insight into speci- ficity in hydrolysis catalysed by GH36. Certain a-galacto-oligosaccharides have been reported to be candidates for health-promoting prebi- otic food ingredients [36–38] because a-galactosidase is lacking in the human gastrointestinal tract and a-galacto-oligosaccharides can be digested by the intes- tinal microbiota and stimulate growth of beneficial Bifidobacteria and Lactobacilli. In the present study, efficient transglycosylation catalysed by Aspergillus nidulans FGSC GH36 a-galactosidase (AglC), which was produced recombinantly in Escherichia coli, resulted in chemo-enzymatic synthesis of 13 a-galacto- oligosaccharides, including five not reported previ- ously, representing novel prebiotics oligosaccharide candidates. The enzymatic properties of AglC are described with focus on specificity and regioselectivity in transglycosylation using 4-nitrophenol a-d-galacto- pyranoside (pNPaGal) as the donor and different mono- and disaccharides as acceptors. Furthermore, structural modelling of AglC using the three-dimen- sional structure of GalA [24] as the template and superimposition of an equilibrium mixture of a- and b-galactose from Oryza sativa a-galactosidase [28], N-acetyl-a-galactosamine from Gallus gallus a-N-acet- ylgalactosaminidase [29] and melibiose from human a-galactosidase [27] complexes of GH27 were per- formed to illustrate the donor and acceptor specificity and the regioselectivity of AglC. Results and Discussion Sequence similarity of AglC The amino acid sequence of AglC, deduced from aglC (GenBank, gi: 40739585), shows 6–79% sequence iden- tity and 17–90% sequence similarity with different functionally characterized GH36 members (Table 1). Phylogenetically, AglC occurs in the cluster of eukary- otic a-galactosidases (Fig. 1) and has highest identity (79%) to a-galactosidase of Aspergillus niger [12], whereas it has low identity (6–10%) to plant alkaline a-galactosidases involved in the metabolism of raffi- nose, stachyose and polymeric galactomannans, serving as storage carbohydrates in many botanical families [16,17], and to raffinose (EC 2.4.1.82) [39] and stachy- ose synthases (EC 2.4.1.67) [40,41], which catalyse the H. Nakai et al. Transglycosylation by A. nidulans a-galactosidase FEBS Journal 277 (2010) 3538–3551 ª 2010 The Authors Journal compilation ª 2010 FEBS 3539 formation of storage oligosaccharides by transglycosy- lation using galactinol [O-a-d-Galp-(1 fi 1)-l-myo-ino- sitol] as the donor. This relationship motivated the detailed analysis of the capacity and specificity of AglC in transglycosylation reactions. Overproduction in E. coli and purification of AglC Similar to other fungal GH36 a-galactosidases [13–15], AglC has a signal peptide (Met1-Ala26; predicted by wolf psort [42] and signalp [43]), and the bioinfor- matic analysis suggests that AglC is an extracellular GH36 a-galactosidase. Previously, heterologous expres- sion in Pichia pastoris X-33 and partial characteriza- tion was described for AglC, together with a large number of cell wall polysaccharide-degrading enzymes annotated in the A. nidulans genome [12,44]. However, because this recombinant AglC was produced with sig- nal peptide, we overproduced AglC in E. coli by expression of aglC encoding mature protein, isolated from genomic DNA of the P. pastoris transformant (see Experimental procedures) under strict control of the cold shock promoter cpsA and the lac operator [45]. The resulting AglC His-tag fusion was purified by nickel chelating chromatography in a yield of 1.3 g from 2 L culture and migrated in SDS ⁄ PAGE as a sin- gle band with an estimated molecular mass of 83 kDa (Fig. S1). Moreover, the molecular mass of the recom- binant AglC was estimated to be 335 kDa by gel filtra- tion chromatography, indicating that AglC is a tetramer in solution, similar to several bacterial and fungal GH36 a-galactosidases [2,5,6,8,10,14,15]. Other bacterial and fungal GH36 a-galactosidases were found to be dimers [4], trimers [3] or octamers [11], whereas plant alkaline a-galactosidases [16] and bacterial a-N-acetylgalactosaminidases [46,47] were monomers. Enzymatic properties of AglC AglC hydrolysed pNPaGal, but not the pNP glycosides of N-acetyl a-d-galactosamine (pNPaGalNAc, i.e. the substrate for GH36 a-N -acetylgalactosaminidase [45,47]), b- d-galactopyranose (pNPbGal), a-d-gluco- pyranose (pNPaGlc), N-acetyl a-d-glucosamine (pNPa GlcNAc), a-d-xyl opyranose (pNPaXyl), a-d-manno- pyranose (pNPaMan), a-l-arabinopyranose (pNPaAra), a-l-arabinofuranose (pNP aAraf) and a-l-rhamnopyra- nose (pNPaRha) (less than 10 lm pNP liberated in the reaction mixture). AglC is thus an a-galactosidase, as also suggested by the sequence similarity (Table 1, Fig. 1). The pH optimum of AglC catalysed hydrolysis of pNPaGal was 5.0 (Fig. 2A) as found for bacterial [4,7,9,34] and other fungal a-galactosidases [13–15], whereas plant alkaline a-galactosidases have pH optima of 7.5–8.5 [16,17]. AglC showed good stability Table 1. Amino acid sequence comparison of AglC from Aspergillus nidulans FGSC with functionally characterized GH36 enzymes. Similari- ties of amino acid sequences were determined using the BLASTP program (Swiss-Prot ⁄ TrEMBL database). Swiss-Prot ⁄ TrEMBL accession no. Identity (%) Similarity (%) Gap (%) a-Galactosidase Aspergillus niger CBS 120.49 ⁄ N400 Q9UUZ4 79 90 0 Penicillium sp. F63 CGMCC1669 A4Z4V0 68 81 2 Geobacillus stearothermophillus NUB3621 Q9X624 39 54 6 Clostridium stercorarium F-9 Q84IQ0 36 54 7 Lactobacillus plantarum ATCC 8014 Q9L905 33 51 5 Carnobacterium piscicola strain BA Q93DW8 34 53 6 Lactococcus raffinolactis ATCC 43920 Q7XIP3 36 54 6 Mycocladus corymbiferus IFO 8084 Q9P8N4 28 44 11 Lactobacillus fermentum CRL722 Q6IYF5 27 45 8 Bifidobacterium bifidum NCIMB 41171 Q1KTD9 23 37 9 Bifidobacterium breve 203 Q2XQ11 21 36 12 Thermus sp. strain T2 Q9WXC1 10 19 38 Thermotoga maritima MSB8 O33835 8 18 32 a-N-Acetylgalactosaminidase Clostridium perfringens Q8XNK8 8 20 25 Raffinose synthase Glycine max CV. CLARK63 BD953761 8 20 25 Stachyose synthase Pisum sativum L cv. Wunder von Kelevedon Q93XK2 6 17 20 Vigna angularis Ohwi et Ohashi Q9SBZ0 6 17 21 Transglycosylation by A. nidulans a-galactosidase H. Nakai et al. 3540 FEBS Journal 277 (2010) 3538–3551 ª 2010 The Authors Journal compilation ª 2010 FEBS at pH 3.6–9.9 (Fig. 2B), maximum activity at 50 °C (Fig. 2C) and retained > 95% activity after 15 min incubation up to 45 °C at pH 5.0 (Fig. 2D). AglC hydrolysed the a-galactosidic linkage in pNPaGal, melibiose [a-d-Galp-(1 fi 6)- d-Glcp] and raffinose [a- d-Gal p-(1 fi 6)-d-Glcp-(a1 fi b2)-d-Fruf], but failed to cleave off a-(1 fi 6) galactosyl branches in galactomannan [48]. AglC thus belongs to the cate- gory of exo-acting fungal and plant a-galactosidases hydrolysing a-galacto-oligosaccharides [20]. The cata- lytic efficiency (k cat ⁄ K m ) towards pNPaGal was two orders of magnitude higher than for these oligosaccha- rides due to the lower K m value (Table 2). This repre- sents the first kinetic analysis of a fungal GH36 a-galactosidase and AglC gave approximately two-fold lower k cat ⁄ K m for raffinose compared with melibiose, similar to bacterial a-galactosidases [5,6,10,20], whereas plant alkaline a-galactosidase showed 18-fold higher k cat ⁄ K m for raffinose than melibiose [16]. Transglycosylation and acceptor specificity of AglC Phylogenetically AglC is in a cluster including eukary- otic a-galactosidases (Fig. 1) and also has sequence similarity (17–20%) to raffinose and stachyose synthas- es (Table 1). These enzymes synthesize raffinose and stachyose by transglycosylation, and it is shown here that AglC also efficiently catalysed transglycosylation of pNPaGal as monitored by TLC (Fig. 3A) and HPLC (Fig. 3D). The product was obtained in 74% yield after 1 h and ESI-MS showed m ⁄ z of 486 corre- Fig. 1. Phylogenetic tree constructed based on deduced full-length amino acid sequences of functionally characterized GH36 glycosidases and synthases using CLUSTALW. The rectangular cladogram tree was generated with TREEVIEW version 1.6.6 software. Values at nodes repre- sent the percentage of bootstrap confidence level on 1000 resamplings. Bacterial a-galactosidases: Bifidobacterium adolescentis DSM 20083 Aga (GenBank, gi: 14495552), Bifidobacterium bifidum NCIMB 41171 MelA (gi: 90655076), Bifidobacterium breve 203 Aga2 (gi:82468523), Clostridium stercorarium F-9 Aga36A (gi: 28268728), Escherichia coli K-12 RafA (gi: 147505), Geobacillus stearothermophilus KVE39 AgaA (gi: 12331004), Geobacillus stearothermophilus NUB3621 AgaN (gi: 4567098), Lactococcus raffinolactis ATCC 43920 AgA (gi: 32450781), Lactobacillus fermentum CRL722 MelA (gi: 47717086), Lactobacillus plantarum ATCC8014 MelA (gi: 15042935), Streptococ- cus mutans strain Ingribitt Aga (gi:153736), Thermotoga maritima MSB8 GalA (gi: 55165925), Thermotoga neapolitana 5068 AglA (gi: 3237318), Thermus brockianus ITI360 AgaT (gi: 4928639), Thermus sp. strain T2 AglA (gi: 4587043) and Thermus thermophilus TH125 AgaT (gi: 4894857); bacteria a-N-acetylgalactosaminidase: Clostridium perfringens ATCC 10543 AagA (gi: 22651784); fungal a-galactosidases: Aspergillus nidulans FGSC A4 AglC (gi: 40739585), Aspergillus niger CBS 120.49 ⁄ N400 AglC (gi: 6624914) and Penicillium sp. F63 CGMCC1669 Agl1 (gi: 85375918); plant alkaline a-galactosidase: Cucumis melo L. Aga1 and Aga2 (gi: 29838629 and gi: 29838631), Pisum sativum L. cv. Kelvedon Wonder AGa1 (gi: 148925503), Tetragonia tetragonioides TtAga1 (gi: 209171772) and Zea mays L. ZmAGA1 and ZmAGA3 (gi: 68270843 and gi: 33323027); raffinose synthase: Glycine max CV. CLARK63 Ras (gi: 67587384); stachyose synthases: Hordeum vulgare subsp. vulgare Sip1 (gi: 167100), Pisum sativum L. cv. Wunder von Kelvedon Sts1 (gi: 13992585), Stachys sieboldii STS (gi: 19571727) and Vigna angularis Ohwi wt Ohashi VaSTS1 (gi: 6634701). H. Nakai et al. Transglycosylation by A. nidulans a-galactosidase FEBS Journal 277 (2010) 3538–3551 ª 2010 The Authors Journal compilation ª 2010 FEBS 3541 sponding to the calculated value of the Na + adduct of pNP a-d-galactobioside (C 18 H 25 NO 13 +Na + ). 1 H- and 13 C-NMR spectroscopy indicated the formation of a single product, pNP a-d-Galp-(1 fi 6)-d-Galp, reflecting the regioselectivity of AglC (Table S1). In contrast, a-galactosidases of Bacillus stearothermophi- lus and Thermus brockianus were reported to produce both a-(1 fi 3) and a-(1 fi 6) linked pNP a-d-galacto- biosides [33]. AglC furthermore synthesized a tri- (Fig. 3B, E) and a tetrasaccharide (Fig. 3C, F) from 40 mm melibiose or raffinose in 59 and 37% yields, respectively, during 1 h reaction. ESI-MS showed m ⁄ z of 527 and 689 corresponding to the calculated values for Na + adducts of galactosyl-melibiose (C 18 H 32 O 16 + Na + ) and galactosyl-raffinose (C 24 H 42 O 21 +Na + ) and two-dimensional NMR identified the oligosaccha- rides as a-d-Galp-(1 fi 6)-a-d-Galp-(1 fi 6)-d-Glcp and a-d-Galp-(1 fi 6)-a-d-Galp-(1 fi 6)-d-Glcp-(a1 fi b2)-d-Fruf (stachyose), respectively (Table S1). AglC thus catalysed efficient transglycosylation with a-1,6- regioselectivity at a lower concentration (40 mm)of melibiose and raffinose compared with a-galactosidases of Bifidobacterium [3,4,32] and Lactobacillus [34] of the prokaryotic cluster (Fig. 1) at a higher concentration of melibiose (0.1–1.2 m) and raffinose (0.46 m) result- ing in 11–33% and 26% yield, respectively. This important transglycosylation catalysed by AglC motivated a comprehensive analysis of acceptor speci- ficity involving 10 mono- and 10 disaccharides (Table 3) for the formation of a-galacto-oligosaccha- rides with the donor pNPaGal, which has a good leaving group. Among the monosaccharides, only galactose, glucose and mannose were found to be acceptors, resulting in disaccharide yields of 39–58% after 3 h reaction (Table 3). Apparently, AglC did not transfer a-galactosyl to monosaccharides without 6-OH (xylose, l-arabinose, l-fucose and l-rhamnose) or with axial 3-OH (gulose, allose, altrose and l-rham- nose), indicating the equatorial 3-OH to be critical for recognition at subsite +1. On the other hand, analysis AB CD Fig. 2. Effect of pH and temperature on the activity and stability of AglC. (A) pH depen- dence for hydrolysis of pNPaGal by 0.27 n M AglC ( • )in40mM Britton-Robinson buffer pH 2.3–11.9. (B) pH stability of 1.6 n M AglC (s)in90m M Britton-Robinson buffer pH 2.3–11.9. (C) Temperature activity depen- dence for 4.1 n M AglC ( ) at 20–90 °C with 10 min reaction. (D) Stability of 9.0 n M AglC (h) in the temperature range 20–90 °C for 15 min. Each experiment was carried out in triplicate. Standard deviations are shown as error bars. Table 2. Kinetic parameters for hydrolysis of pNPaGal, melibiose and raffinose by AglC. Parameters are calculated from the initial velocities of release of pNP from pNPaGal and of galactose from melibiose and raffinose at different substrate concentrations (see Experimental procedures). Substrate K m (mM) k cat (s )1 ) k cat ÆK m )1 (s )1 ÆmM )1 ) pNPaGal 0.27 ± 0.01 1278 ± 38 4730 Melibiose 12 ± 0.12 1067 ± 26 88.9 Raffinose 15 ± 0.57 586 ± 17 39.1 Transglycosylation by A. nidulans a-galactosidase H. Nakai et al. 3542 FEBS Journal 277 (2010) 3538–3551 ª 2010 The Authors Journal compilation ª 2010 FEBS of disaccharide acceptors reflected broad specificity of subsite +2 and resulted in the formation of eight trisaccharides, five from a-linked (melibiose, maltose, trehalose, sucrose, turanose) and three from b-linked disaccharides (lactose, lactulose, cellobiose) in 26–46% yield, except for melibiose resulting in only 6% yield of trisaccharide. Melibiose at a high concentration pos- sibly competes with the donor pNPaGal having a good leaving group, resulting in the modest yield. As found for xylose and l-arabinose, xylobiose and arabinobiose were not acceptors (Table 3). Progress of transglycosylation during 3 h using 40 mm pNPaGal and 400 mm of the identified 11 func- tional acceptors (see above) (Fig. 4) showed individual product formation rates and yields, glucose and malt- ose giving the highest yield, but having the slowest reaction rate. Noticeably, only one product (Table 3) was obtained with each acceptor, emphasizing that rigorous recognition governs the transglycosylation outcome. Analysis of the product structures (see below) accordingly indicated strict a-(1 fi 6) regiospec- ificity for the AglC transglycosylation. ESI-MS analysis gave m ⁄ z signals of 365 or 527 corresponding to calculated molecular masses of Na + adducts of mono- or disaccharide acceptor conjugates of galactose. Chemical shifts for NMR linkage analysis were assigned based on two-dimensional NMR spectra (Tables S2 and S3). The formed a-(1 fi 6) linkages were identified by long-range proton–carbon tree bond correlation from the nonreducing anomeric proton to C-6 of the substituted position, as confirmed by inter NOE correlations. AglC thus recognized the C-6 hydroxymethyl and equatorial 3-OH group of an aldohexopyranosyl unit at subsite +1 and transferred a-galactopyranosyl to the 6-OH, resulting in 11 a-(1 fi 6) linked galactosyl-oligosaccharides. These ABC DEF Fig. 3. Monitoring formation of transglycosylation products from pNPaGal (A), melibiose (B) and raffinose (C) by TLC (see Experimental pro- cedures). Standards: lane S1, pNPaGal and galactose; lane S2, galactose and melibiose; lane S3, glucose; lane S4, galactose and raffinose; lane S5, sucrose. Products from pNPaGal (D), melibiose (E) or raffinose (F) were reconfirmed by HPLC equipped with a UV or refractive index (RI) detector and a TSKgel Amide-80 column. The compounds, pNP (1), pNP a-Galp (2), pNP a-Galp-(1 fi 6)-Galp (3), galactose and glucose (4), melibiose (5), a-Galp-(1 fi 6)-a-Galp-(1 fi 6)-Glcp (6), galactose (7), sucrose (8), raffinose (9) and a-Galp-(1 fi 6)-a-Galp-(1 fi 6)- Glcp-(a1 fi b2)-Fruf (10) are marked by arrows. H. Nakai et al. Transglycosylation by A. nidulans a-galactosidase FEBS Journal 277 (2010) 3538–3551 ª 2010 The Authors Journal compilation ª 2010 FEBS 3543 products include five novel compounds (Fig. 5); a-d-galactopyranosyl-(1 fi 6)-d-mannopyranose; a-d- galactopyranosyl-(1 fi 6)-d-glucopyranosyl-(a1 fi a1)- d-glucopyranose; a-d-galactopyranosyl-(1 fi 6)-a-d-gluco pyranosyl-(1 fi 3)-d-fructofuranose; a-d-galactopyr- anosyl-(1 fi 6)-b-d-galactopyranosyl -(1 fi 4)-d-fruc- tofuranose; and a-d-galactopyranosyl-(1 fi 6)-b-d- glucopyranosyl-(1 fi 4)-d-glucopyranose. Substrate recognition by AglC The crystal structure of GalA (PDB ID:1ZY9) [24] was used as the template to model a truncated AglC (Gly193–Glu699) comprising b6-b15 of the N-terminal b-sandwich domain (Gly193–Ala347) and the catalytic (b ⁄ a) 8 -barrel (Thr348–Glu699) (Fig. 6). This truncated AglC has 25% sequence identity and 40% sequence similarity with corresponding GalA domains, whereas full-length AglC shows only 8% identity and 18% sim- ilarity. Recognition of a-galactose at subsite )1 of the modelled AglC structure (Fig. 6A, B) was proposed by superimposition of a- and b-galactose and N-acetyl- a-galactosamine, respectively, from complexes with O. sativa a-galactosidase (1UAS) [28] and G. gallus a- N-acetylgalactosaminidase (1KTC) [29] both of GH27, because a ligand complex structure was not available for GH36. Direct hydrogen bonds appeared in this model between the a-anomeric 1-OH and the 2-OH of a-galactose with Asp573, corresponding to Asp387, i.e. the proposed acid ⁄ base catalyst in GalA [24]. Further- more, Asp511, which corresponds to the predicted cat- alytic nucleophile Asp327 in GalA [24], presumably makes a hydrogen bond with O5 of the galactose ring and direct hydrogen bonds were also suggested between Lys509 and 3-OH and the axial 4-OH as well as Asp388 and Asp389 and 4-OH and 6-OH, respec- tively. These AglC ⁄ a-galactose contacts are consistent with the reported recognition at subsite )1 of the mod- Table 3. Test of carbohydrate acceptor candidates for transgly- cosylation as catalysed by AglC using the donor pNPaGal. Products from 40 m M pNPaGal and 400 mM acceptor were quantified by HPAEC-PAD using melibiose and raffinose as standards for di- and trisaccharide products, respectively. Yields are based on the pNPa Gal concentration (see Experimental procedures). Acceptor Product Yield (%) Monosaccharide Galactose (Gal) a-Galp-(1 fi 6)-Galp 39 Gulose – – Glucose (Glc) a-Galp-(1 fi 6)-Glcp 58 Allose – – Mannose (Man) a-Galp-(1 fi 6)-Manp 50 Altrose – – Xylose (Xyl) – – L-Arabinose (L-Ara) – – L-Fucose (L-Fuc) – – L-Rhamnose – – Disaccharide Melibiose a-Galp-(1 fi 6)-a-Galp-(1 fi 6)-Glcp 6 Maltose a-Galp-(1 fi 6)-a-Glcp-(1 fi 4)-Glcp 46 Trehalose a-Galp-(1 fi 6)-Glcp-(a1 fi a1)-Glcp 26 Sucrose a-Galp-(1 fi 6)-Glcp-(a1 fi b2)-Fruf 28 Turanose a-Galp-(1 fi 6)-a-Glcp-(1 fi 3)-Fruf 26 Arabinobiose – – Lactose a-Galp-(1 fi 6)-b-Galp-(1 fi 4)-Glcp 38 Lactulose a-Galp-(1 fi 6)-b-Galp-(1 fi 4)-Fruf 38 Cellobiose a-Galp-(1 fi 6)-b-Glcp-(1 fi 4)-Glcp 28 Xylobiose – – ABC Fig. 4. Progress of AglC (18 nM) catalysed transglycosylation with different acceptors (400 mM) and pNPaGal (40 mM) as the donor. (A) Monosaccharides: galactose (•), glucose (s), mannose (h). (B) a-Linked disaccharides: melibiose (•), maltose (s), trehalose (h), sucrose (e), turanose ( ). (C) b-Linked disaccharides: lactose (D), lactulose ( ) and cellobiose (¤)in40mM Na acetate (pH 5.0) at 37 °C for 3 h. Product concentrations were calculated from peak areas of HPAEC-PAD (linear gradient, 0–75 m M Na acetate in 100 mM NaOH for 35 min; flow rate, 0.35 mLÆmin )1 ) calibrated with melibiose and raffinose as standards for di- and trisaccharides, respectively. Transglycosylation by A. nidulans a-galactosidase H. Nakai et al. 3544 FEBS Journal 277 (2010) 3538–3551 ª 2010 The Authors Journal compilation ª 2010 FEBS elled structure for Bifidobacterium adolescentis GH36 a-galactosidase [35] and AglC specifically hydrolysing pNPaGal and not pNPaMan and pNPaGlc having equatorial 4-OH, or pNPaXyl lacking the 6-hydroxym- ethyl group. Noticeably, the axial 1-OH of a-galactose projects out of the active site in the model and the cat- alytic nucleophile Asp511 together with Trp221, from the N-terminal b-sandwich domain, block for binding of a b-linked aglycone at subsite +1 in agreement with AglC not hydrolysing pNPbGal. The bulky Trp221 and Trp570 side chains presumably preclude binding of the C-2 substituent of N-acetyl-a-galactosamine (Fig. 6B). The a-N-acetylgalactosaminidase from G. gallus, in contrast, has a cavity formed by Ser172 and Ala175 in the (b ⁄ a) 8 -barrel loop connecting b5 and a5 where the N-acetyl group becomes sandwiched between Tyr176 and Arg197 and Ser172 hydrogen bonds to the carbonyl oxygen [29]. The acceptor recognition at subsite +1 of the mod- elled AglC structure (Fig. 6C) was further illustrated by superimposition of melibiose from a complex with human GH27 a-galactosidase (3HG3) [27]. Proposed recognition of the a-galactose moiety in melibiose at subsite )1 seems identical to that of the a-galactose superimposed from the complex with O. sativa a-galac- tosidase (Fig. 6A,C). Noticeably, direct hydrogen bonds at subsite +1 are suggested, involving 3-OH and O5 of the b-glucose moiety in melibose and Trp358 and Asp511 (the acid ⁄ base catalyst), respectively. Furthermore, Trp221 from the N-terminal b-sandwich domain presumably makes a hydrophobic environment for the C-6 hydroxymethyl group of the b-glucose moiety. These observations supported that AglC specifically transferred a-galactopyranosyl to C-6 hydroxymethyl of aldohexopyranosyl units with equa- torial 3-OH group (Table 3). Conclusion AglC catalysed transglycosylation with remarkable effi- ciency and selectively transferred a-galactopyranosyl to the 6-hydroxymethyl group of aldohexopyranoses with equatorial 3-OH, as indicated by reaction with three monosaccharide acceptors. AglC also catalysed transfer to 6-OH of the terminal residue in eight disaccharides. Five novel a-(1 fi 6) linked galacto- oligosaccharides were obtained. The very efficient expression system makes the production of engi- neered AglC feasible and the transglycosylation has potential for the design and production of a-galacto- oligosaccharides with prebiotic effect on human gut microbiota. Experimental procedures Materials Allose, altrose, galactose, glucose, gulose, mannose, l-fucose, l-arabinose, l-rhamnose, cellobiose, lactose, lactu- lose, maltose, melibiose, sucrose, trehalose, turanose, raffi- nose, pNPaAra, pNPaAraf, pNPaGal, pNPaGalNAc, pNPbGal, pNPaGlc, pNPaGlcNAc, pNPaMan, pNPaRha and pNPaXyl were purchased from Sigma (St. Louis, MO, USA). Galactomannans (Carubin type and 98% Guarin type) and xylose were purchased from Carl Roth (Kar- lsruhe, Germany). Arabinobiose and xylobiose were from Megazyme (Bray, Ireland). Other reagents were of analyti- cal grade and from commercial sources. Sequence analysis clustalw (http://clustalw.ddbj.nig.ac.jp/top-j.html) was used for the phylogenetic analysis using full-length amino acid sequences of functionally characterized GH36 members (http://www.cazy.org/fam/GH36.html). A rectangular clad- ogram tree was generated using treeview version 1.6.6 AD B C E Fig. 5. Structures of novel a-galacto-oligosaccharides produced by transglycosylation catalysed by AglC. (A) a-Galp-(1 fi 6)-Manp, (B) a-Galp-(1 fi 6)-Glcp-(a1 fi a1)-Glc p,(C)a-Gal p-(1 fi 6)- a-Glcp-(1 fi 3)-Fruf, (D) a-Galp-(1 fi 6)-b-Galp-(1 fi 4)-Fruf, (E) a-Galp-(1 fi 6)-b-Glcp- (1 fi 4)-Glcp. H. Nakai et al. Transglycosylation by A. nidulans a-galactosidase FEBS Journal 277 (2010) 3538–3551 ª 2010 The Authors Journal compilation ª 2010 FEBS 3545 software and a bootstrap test based on 1000 resampl- ings (http://taxonomy.zoology.gla.ac.uk/rod/treeview.html). Protein localization and signal peptides were predicted using wolf psort (http://wolfpsort.org/) [42] and signalp 3.0 server (http://www.cbs.dtu.dk/services/SignalP/) [43], respectively. A B C Fig. 6. Stereo views of presumed ligand interactions with the active site of AglC. (A) An equilibrium mixture of a- and b-galac- tose (pink) from the complex with O. sativa a-galactosidase (1UAS) [28] superimposed on the structure AglC modelled using T. maritima GH36 a-galactosidase (GalA, 1ZY9) [24] as a template. Suggested hydro- gen bonds are shown as dotted lines. Asp511 and Asp573 are predicted to be nucleophile (nu) and acid ⁄ base (a ⁄ b) cata- lysts, respectively, by sequence alignment with GalA [24]. (B) N-acetyl-a-galactosamine (as a yellow stick) from the complex with G. gallus a-N-acetylgalactosaminidase (as yellow lines; 1KTC) [29] superimposed on the modelled AglC structure (grey lines). A hydrogen bond (2.6 A ˚ ) suggested between S172 1KTC and oxygen of the N-acetyl group of a-galactosamine is shown (dotted line). (C) Melibiose (as an orange stick) from the complex with human GH27 a-galactosidase (3HG3) [27] superimposed on the modelled AglC structure (grey lines). Suggested hydrogen bonds are shown as dotted lines. Transglycosylation by A. nidulans a-galactosidase H. Nakai et al. 3546 FEBS Journal 277 (2010) 3538–3551 ª 2010 The Authors Journal compilation ª 2010 FEBS Cloning of aglC and construction of the expression plasmid The gene aglC (GenBank, gi: 40739585) was cloned by direct PCR [49] from a P. pastoris X-33 transformant har- bouring the expression plasmid aglC ⁄ pPICZaC (FGSC database accession no. 10122; http://www.fgsc.net) [12] pur- chased from Fungal Genetics Stock Center (School of Bio- logical Sciences, University of Missouri, MO, USA) with elimination of both the Saccharomyces cerevisiae a-factor signal peptide [50] and the AglC signal sequence (Met1- Ala26). The Expand High Fidelity PCR System (Roche, Basel, Switzerland) was used as DNA polymerase with oligonucleotides based on the genomic sequence [44]: 5¢-GGG GAGCTCATTGCGCAGGGTACAACTGGTTCC AATG-3¢ containing a SacI site (underlined) as 5¢ forward and 5¢-CCC TCTAGACTGCCTTTCTAAGAAGACCACT TTG-3¢ containing an XbaI site (underlined) as the 3¢ reverse primer. The PCR product was purified (QIAquick Gel Extraction Kit; Qiagen, Germantown, MD, USA), digested by SacI and XbaI (New England Biolabs, Ontario, Canada) and cloned into pCold I [47] (Takara, Kyoto, Japan). The plasmid was propagated in E. coli DH5a (Novagen, Madison, WI, USA), purified (QIAprep Spin Miniprep Kit; Qiagen), and its sequence verified (MWG Biotech, Ebersberg, Germany). Recombinant AglC production Escherichia coli BL21(DE3) (Novagen) harbouring aglC- pCold I was grown at 12 °C in Luria-Bertani medium (1% tryptone, 0.5% yeast extract, 1% NaCl) containing 50 lgÆmL )1 ampicillin (2 · 1 L in 2 L shake flasks). Expression of aglC was induced by 0.1 mm isopropyl-1- thio-b-galactopyranoside and continued at 12 °C for 24 h. Cells were harvested by centrifugation (9000 g, 10 min, 4 °C), resuspended in 20 mL BugBuster Protein Extrac- tion Reagents (Novagen) containing 2 lL Benzonate Nuclease (Novagen) followed by 30 min at room tempera- ture and centrifugation (19 000 g, 15 min, 4 °C). The supernatant was filtered (acetate, pore size: 0.22; GE Infrastructure Water & Process Technologies Life Science Microseparations, Trevose, PA, USA) and applied to HisTrap HP (5 mL; GE Healthcare UK, Uppsala, Sweden) equilibrated with 20 mm HEPES pH 7.5, 0.5 m NaCl, 10 mm imidazole (A ¨ KTAexplorer; GE Healthcare) and washed with 20 mm HEPES pH 7.5, 0.5 m NaCl, 22 mm imidazole. Protein was eluted by a linear 22–400 mm imidazole gradient in the same buffer and AglC-containing fractions were pooled, dialysed against 20 mm HEPES pH 7.0, and concentrated (Centriprep YM50; Millipore Corporation, Billerica, MA, USA). All purification steps were performed at 4 °C. The protein concentration was measured spectrophotometrically at 280 nm using E 0.1% = 1.44 (determined using amino acid analysis). The molecular mass of AglC was estimated by SDS ⁄ PAGE stained with Coomassie Brilliant Blue and by gel filtration (HiLoad TM 200 Superdex TM 16 ⁄ 60 column; flow rate, 0.5 mLÆmin )1 ;A ¨ KTAexplorer; GE Healthcare) equilibrated with 10 mm MES pH 6.8, 0.15 m NaCl and using the Gel Filtration Calibration kit HMW (GE Health- care) as standards. Routine enzyme assay AglC (0.18–0.27 nm) hydrolysed 2 mm pNPaGal in 40 mm Na acetate pH 5.0, 0.02% BSA (50 lL) for 10 min at 37 °C. The reaction was stopped by 1 m Na 2 CO 3 (100 lL) and released pNP was measured spectrophotometrically from the absorbance at 410 nm using E 1mM = 2.01. One unit of activity was defined as the amount of enzyme that liberates 1 lmol pNP from pNPaGal per minute under these conditions. Characterization of enzymatic properties The pH optimum of 0.27 nm AglC for 2 mm pNPaGal was determined in 40 mm Britton-Robinson buffer [51] (50 lL; pH 2.3–11.9; 40 mm acetic acid, 40 mm phospho- ric acid, 40 mm boric acid, pH adjusted by NaOH), as above. The temperature optimum of activity (see above) in the range 20–90 °C was determined in 40 mm Na acetate pH 5.0, 0.02% BSA (100 lL). The dependence of AglC stability on pH and temperature was deduced from resid- ual activity analysed by the standard assay for 1.6 nm AglC in 90 mm Britton-Robinson buffer (pH 2.3–11.9), 0.02% BSA incubated at 4 °C for 24 h and for 4.1 nm AglC in 20 mm HEPES pH 7.0, 0.02% BSA incubated at 20–90 °C for 15 min. Each experiment was carried out in triplicate. Hydrolytic activity of 0.27–270 nm AglC was tested towards 5 mm pNPaGal, pNPaGalNAc, pNPaAra, pNPaAraf, pNPaGlc, pNPaGlcNAc, pNPaMan, pNPaRha, pNPaXyl, and pNPbGal, and 0.4% galactomannans in 40 mm Na acetate pH 5.0, 0.02% BSA, for 10 min at 37 °C. Initial rates of hydrolysis of 0.10–2.0 mm p NPaGal, 1.0–12 mm melibiose and 1.0–12 mm raffinose were mea- sured at seven different substrate concentrations using AglC (0.18 nm for pNPaGal, 0.37 nm for melibiose, 0.91 nm for raffinose) in 40 mm Na acetate pH 5.0, 0.02% BSA (1 mL) at 37 °C. Aliquots (100 lL) removed at 0, 5, 10, 20, 30 min were mixed with 1 m Na 2 CO 3 (200 lL) for pNPaGal or 2 m Tris-HCl pH 8.0 (200 lL) for melibiose and raffinose to stop the reaction. pNP was quantified spectrophotomet- rically as above. Galactose released from melibiose and raffinose was quantified using the Lactose ⁄ Galactose (Rapid) kit (Megazyme). K m and k cat were determined from Lineweaver–Burk plots (1 ⁄ s)1 ⁄ v plots). Each experiment was carried out in triplicate. H. Nakai et al. Transglycosylation by A. nidulans a-galactosidase FEBS Journal 277 (2010) 3538–3551 ª 2010 The Authors Journal compilation ª 2010 FEBS 3547 [...]... Biochemical and genetic analysis of Streptococcus mutans a-galactosidase J Gen Microbiol 137, 757– 764 9 Liebl W, Wagner B & Schellhase J (1998) Properties of an a-galactosidase, and structure of its gene galA, within an a- and b-galactoside utilization gene cluster of the hyperthermophilic bacterium Thermotoga maritima Syst Appl Microbiol 21, 1–11 Transglycosylation by A nidulans a-galactosidase 10 Fridjonsson... characterization of the main a-galactosidase Biochem J 339, 43–53 24 Comfort DA, Bobrov KS, Ivanen DR, Shabalin KA, Harris JM, Kulminskaya AA, Brumer H & Kelly RM (2007) Biochemical analysis of Thermotoga maritima GH36 a-galactosidase (TmGalA) confirms the mechanistic commonality of clan GH-D glycoside hydrolases Biochemistry 46, 3319–3330 25 Zechel DL & Withers SG (2000) Glycosidase mechanisms: anatomy of a finely... Chany CJ, Withers SG, Sims PF, Sinnott ML & Brumer H (2000) Identification of Asp-130 as the catalytic nucleophile in the main a-galactosidase from Phanerochaete chrysosporium, a family 27 glycosyl hydrolase Biochemistry 39, 9826–9 836 27 Guce AI, Clark NE, Salgado EN, Ivanen DR, Kulminskaya AA, Brumer H & Garman SC (2010) Catalytic mechanism of human a-galactosidase J Biol Chem 285, 362 5 363 2 28 Fujimoto... 38 39 40 41 42 43 44 45 46 47 48 49 Increasing the transglycosylation activity of a-galactosidase from Bifidobacterium adolescentis DSM 20083 by site-directed mutagenesis Biotechnol Bioeng 93, 122–131 Tzortzis G, Goulas AK, Baillon ML, Gibson GR & Rastall RA (2004) In vitro evaluation of the fermentation properties of galactooligosaccharides synthesised by a-galactosidase from Lactobacillus reuteri Appl... (2009) The SWISS-MODEL Repository and associated resources Nucleic Acids Res 37, D387–D392 Supporting information The following supplementary material is available: Fig S1 SDS ⁄ PAGE of recombinant AglC (4.8 lg) Table S1 1H and 13C NMR data assignment for a-galacto-oligosaccharides produced from pNPaGal, Transglycosylation by A nidulans a-galactosidase melibiose and raffinose as substrates by transglycosylation. .. produced with pNPaGal as the donor and suitable monosaccharide acceptors by transglycosylation Table S3 1H and 13C NMR data assignment for a-galacto-trisaccharides produced from pNPaGal as the donor and suitable disaccharide acceptors by transglycosylation Table S4 Purification conditions of a-galacto-oligosaccharides by HPLC This supplementary material can be found in the online version of this article Please.. .Transglycosylation by A nidulans a-galactosidase H Nakai et al TLC and HPLC monitoring of transglycosylation Transglycosylation products formed by AglC (18 nm for pNPaGal, 37 nm for melibiose, 91 nm for raffinose) with 40 mm substrate in 40 mm Na acetate pH 5.0 at 37 °C for 0–1 h were detected by TLC (TLC Silica gel 60 F254; Merck, Darmstadt, Germany) developed by acetonitrile ⁄ water... Gehweiler A, Rohrhirsch T & Mattes R (1999) Cloning of the gene encoding a novel thermostable a-galactosidase from Thermus brockianus ITI360 Appl Environ Microbiol 65, 3955– 3963 11 Ishiguro M, Kaneko S, Kuno A, Koyama Y, Yoshida S, Park GG, Sakakibara Y, Kusakabe I & Kobayashi H (2001) Purification and characterization of the recombinant Thermus sp strain T2 a-galactosidase expressed in Escherichia coli... (2010) 3538–3551 ª 2010 The Authors Journal compilation ª 2010 FEBS 3549 Transglycosylation by A nidulans a-galactosidase H Nakai et al 22 Rigden DJ (2002) Iterative database searches demonstrate that glycoside hydrolase families 27, 31, 36 and 66 share a common evolutionary origin with family 13 FEBS Lett 523, 17–22 23 Brumer H, Sims PFG & Sinnott ML (1999) Lignocellulose degradation by Phanerochaete chrysosporium:... dimension Homology modelling of AglC The three-dimensional structure of AglC covering Gly193Ala347 (b6–b15 of the N-terminal b-sandwich domain) and Thr348–Glu699 [the (b ⁄ a)8-barrel catalytic domain] was modelled (swiss model; http://swissmodel.expasy.org/) [53] using the structure of GalA (PDB ID: 1ZY9) [24] as a template An equilibrium mixture of a- and b-galactose from O sativa a-galactosidase (1UAS) . Aspergillus nidulans a-galactosidase of glycoside hydrolase family 36 catalyses the formation of a-galacto-oligosaccharides by transglycosylation Hiroyuki Nakai 1 ,. at the anomeric centre. In the next step, water is deprotonated by the general base catalyst and attacks the anomeric centre, releasing the carbohydrate moiety. For GH36, the nucleophile and the. analysis of Thermotoga maritima GH36 a-galactosidase (TmGalA) confirms the mecha- nistic commonality of clan GH-D glycoside hydrolases. Biochemistry 46, 3319–3330. 25 Zechel DL & Withers SG