Báo cáo khoa học: Expression profiling reveals differences in metabolic gene expression between exercise-induced cardiac effects and maladaptive cardiac hypertrophy pot

Expression profiling reveals differences in metabolic gene expression between exercise-induced cardiac effects and maladaptive cardiac hypertrophy Claes C Strøm1, Mark Aplin1, Thorkil Ploug2, Tue E H Christoffersen1, Jozef Langfort3, Michael Viese2, Henrik Galbo2, Stig Haunsø1 and Søren P Sheikh1 CHARC (Copenhagen Heart Arrhythmia Research Center), Department of Medicine B, H:S Rigshospitalet, University of Copenhagen Medical School, Denmark Copenhagen Muscle Research Centre, Department of Medical Physiology, Panum Institute, University of Copenhagen, Denmark Laboratory of Experimental Pharmacology, Polish Academy of Science, Warsaw, Poland Keywords adaptive; DNA microarray; gene expression; hypertrophy; maladaptive Correspondence S P Sheikh, Laboratory of Molecular Cardiology, Department of Medicine B, H:S Rigshospitalet, University of Copenhagen, 20 Juliane Mariesvej, DK-2100 Copenhagen, Denmark Fax: +45 3545 6500 Tel: +45 3545 6730 E-mail: sheikh@molheart.dk (Received 10 October 2004, revised 15 March 2005, accepted 22 March 2005) doi:10.1111/j.1742-4658.2005.04684.x While cardiac hypertrophy elicited by pathological stimuli eventually leads to cardiac dysfunction, exercise-induced hypertrophy does not This suggests that a beneficial hypertrophic phenotype exists In search of an underlying molecular substrate we used microarray technology to identify cardiac gene expression in response to exercise Rats exercised for seven weeks on a treadmill were characterized by invasive blood pressure measurements and echocardiography RNA was isolated from the left ventricle and analysed on DNA microarrays containing 8740 genes Selected genes were analysed by quantitative PCR The exercise program resulted in cardiac hypertrophy without impaired cardiac function Principal component analysis identified an exercise-induced change in gene expression that was distinct from the program observed in maladaptive hypertrophy Statistical analysis identified 267 upregulated genes and 62 downregulated genes in response to exercise Expression changes in genes encoding extracellular matrix proteins, cytoskeletal elements, signalling factors and ribosomal proteins mimicked changes previously described in maladaptive hypertrophy Our most striking observation was that expression changes of genes involved in b-oxidation of fatty acids and glucose metabolism differentiate adaptive from maladaptive hypertrophy Direct comparison to maladaptive hypertrophy was enabled by quantitative PCR of key metabolic enzymes including uncoupling protein (UCP2) and fatty acid translocase (CD36) DNA microarray analysis of gene expression changes in exercise-induced cardiac hypertrophy suggests that a set of genes involved in fatty acid and glucose metabolism could be fundamental to the beneficial phenotype of exercise-induced hypertrophy, as these changes are absent or reversed in maladaptive hypertrophy Abbreviations ACE, angiotensin converting enzyme; ALP, actinin a2 associated LIM protein; EST, expressed sequence tag; FABP4, fatty acid binding protein 4; FACL, fatty acid CoA ligase; FDR, false discovery rate; GCKR, glucokinase regulatory protein; HR, heart rate; LVEDP, left ventricular end diastolic pressure; MAP, mean arterial pressure; MBE, model based expression; MYL, fast myosin alkali light chain; PCA, principal component analysis; PDC, pyruvate dehydrogenase complex; PDP, pyruvate dehydrogenase phosphatase; Slc27a1, fatty acid transport protein 4; UCP2, uncoupling protein 2684 FEBS Journal 272 (2005) 2684–2695 ª 2005 FEBS C C Strøm et al Heart disease is a leading cause of death in the Western world and is commonly associated with cardiac hypertrophy Sustained cardiac hypertrophy leads to cardiac dysfunction, heart failure, arrhythmia and sudden death As a result, cardiac hypertrophy is an independent risk factor for cardiac morbidity and mortality [1] Exercise-induced cardiac hypertrophy is distinct from the hypertrophy seen in different pathological settings, as it is not accompanied by cardiac dysfunction or increased morbidity [2,3] This intriguing distinction has led to the concepts of maladaptive and adaptive forms of cardiac hypertrophy While gene expression changes in maladaptive cardiac hypertrophy have been extensively investigated, much less is known about transcriptional regulation in exercise-induced hypertrophy Identification of a set of genes unique to this condition would enhance our understanding of the molecular differences between maladaptive and adaptive cardiac hypertrophy Exercise training increases the functional capacity of the cardiovascular system The adaptations include increases in cardiac mass and dimension, maximum oxygen consumption and coronary blood flow [4] Also, exercise results in a balanced growth of cardiomyocytes with normal myofibril to mitochondrial ratio [5,6] In the setting of maladaptive hypertrophy, a shift from fatty acids to glucose as the main fuel in the myocardium has been described, and is in part caused by downregulation of gene products involved in b-oxidation of fatty acids [7] Whether this metabolic shift also occurs in adaptive hypertrophy remains to be established Although the physiological and morphological changes during cardiac adaptations to exercise are well characterized, little is known about the underlying molecular changes Evidence that adaptive and maladaptive hypertrophic cardiac phenotypes result from activation of distinct signalling pathways has come from studies demonstrating that exercise-induced hypertrophy is not prevented by angiotensin II receptor blockade or cyclosporine treatment [8,9] Also, several authors have demonstrated that expression of marker genes including atrial natriuretic peptide, myosin heavy chain isoforms and thyroid hormone receptor isoforms differ between adaptive and maladaptive hypertrophy [10–12] A comprehensive analysis of the gene expression changes in exerciseinduced cardiac hypertrophy, however, is lacking Such an approach may identify shared and divergent molecular networks between adaptive and maladaptive hypertrophy and point to new therapeutic strategies The microarray technology allows simultaneous analysis of the expression level of thousands of genes FEBS Journal 272 (2005) 2684–2695 ª 2005 FEBS Gene expression in exercise-induced cardiac hypertrophy making this technology well suited for comprehensive analysis of gene expression changes in response to physiological challenges DNA microarrays have been useful in analysis of cellular responses to stimuli, animal models of human disease and cancer classification [13,14] We used DNA microarrays to define gene expression changes that characterize exercise-induced cardiac hypertrophy We identified 305 genes with differential expression in response to cardiac exercise, the majority of which have not previously been associated with exercise The most directly interpretable and potentially biologically important finding was a reversed metabolic shift in response to exercise suggesting that genes involved in fatty acid and glucose metabolism are key regulatory points that distinguish adaptive beneficial hypertrophy from more adverse maladaptive forms elicited by pathological stimuli Results Physiological response to exercise Several pieces of data indicated that exercised rats had cardiac hypertrophy as compared to the sedentary control animals First, training resulted in an  25% increase in left and right ventricular masses when normalized to lean body weight (Table 1) and a 10% increase when compared to tibial length (data not shown) Other organ weights were unchanged (lungs, kidney and stomach) after normalization (Table 1) Absolute cardiac weights were increased but not significantly, while other organ weights were significantly Table Organ weights Values are mean ± SEM Weights (W) of heart (H), left ventricle (LV), right ventricle (RV), lungs (P), kidney (K) and stomach (S) divided by lean (L) body (B) weight (mgỈg0.78)1) Exercised BW Tibia HW LVW RVW PW KW SW HW ⁄ BWL LVW ⁄ BWL RVW ⁄ BWL PW ⁄ BWL KW ⁄ BWL SW ⁄ BWL Sedentary 350 40.2 1.10 0.73 0.18 1.18 1.20 1.70 11.4 7.6 1.9 12.3 12.4 17.7 429 41.5 1.07 0.69 0.17 1.32 1.36 1.91 9.5 6.1 1.5 11.6 12.0 16.9 ± ± ± ± ± ± ± ± ± ± ± ± ± ± 5* 0.3 0.04 0.02 0.01 0.03* 0.05* 0.06* 0.4* 0.2* 0.1* 0.3 0.5 0.6 ± ± ± ± ± ± ± ± ± ± ± ± ± ± 0.7 0.02 0.02 0.01 0.03 0.04 0.04 0.1 0.1 0.1 0.1 0.3 0.3 *P < 0.05 2685 Gene expression in exercise-induced cardiac hypertrophy C C Strøm et al Table Echocardiography Values are mean ± SEM AWT, Anterior wall thickness; PWT, posterior wall thickness; d, diastole; LVA, left ventricular area; BW, lean body weight; FAC, fractional area of shortening AWTd (cm) PWTd (cm) LVAd ⁄ BW (mm2Ỉg)0.78) FAC (%) Exercised 0.205 ± 0.007* 0.195 ± 0.007* 4.97 ± 0.12* 77 ± Sedentary 0.180 ± 0.003 0.171 ± 0.004 4.57 ± 0.09 78 ± *P < 0.05 Table Left ventricular pressures Values are mean ± SEM dP ⁄ dt-max, Maximal rates of isovolumetric pressure development; dP ⁄ dt-min, maximal rates of isovolumetric pressure decay LVEDP dP ⁄ dt-max dP ⁄ dt-min (mm Hg) (m HgỈs)1) (mHgỈs)1) Exercised 6.0 ± 0.7 7.9 ± 0.3 Sedentary 4.1 ± 0.5 9.3 ± 0.6 MAP HR (mm Hg) (min)1) ) 10.1 ± 0.4 113 ± ) 11.0 ± 0.6 111 ± 347 ± 8* 383 ± *P < 0.05 reduced A less intense training protocol resulted in significant body weight reductions but no increase in ventricular weights (data not shown) Secondly, echocardiographic examination of the cardiac phenotype revealed that exercised rats had increases in both left ventricular wall thickness and left ventricular cavity dimensions (Table 2) Anterior and posterior wall thicknesses were both increased by 14% and left ventricular area indexed to lean body mass increased 9% Cardiac function at rest, as determined by fractional area of change (Table 2), left ventricular end diastolic pressure (LVEDP), and maximal rate of isovolumetric pressure development and decay (Table 3), was identical in the two groups, which is consistent with previous findings [15] Mean arterial pressure showed no differences between exercised and sedentary rats (Table 3), but resting heart rate decreased 10% in response to exercise The decrease in resting heart rate probably results from an increase stroke volume and increased parasympathetic tone Thus, our exercise protocol resulted in a phenotype of eccentric hypertrophy without impairment of cardiac function Distinct global gene expression profiles between exercised and sedentary animals We first analysed the data for differences in global gene expression patterns between exercised and control animals using a principal component analysis (PCA) This type of analysis serves to reduce the 2686 Fig Global gene expression in the hearts of exercised rats is different from that of sedentary controls A principal component analysis was performed on all genes (n ¼ 8740) to find trends in the microarray data The two first components (PC1 and PC2) from the analysis are shown in the figure Exercised rats clearly cluster separate from the sedentary controls indicating the existence of a distinct gene expression program induced by exercise number of variables in multivariate data with minimal loss of information The PCA analysis based on all 8740 genes clearly distinguished the gene expression profiles of hearts of exercised animals from those of controls (Fig 1) This finding indicated the existence of a distinct gene expression program induced by exercise Identification of individual genes that are differentially expressed in response to exercise Next, individual genes regulated by exercise were identified as described in Experimental procedures (Fig 2) The vast majority of genes were unchanged At the applied threshold [predefined to a false discovery rate (FDR) of 5% or less], 329 genes were identified as differentially regulated in response to exercise (marked with grey in the figure) Of these, 267 genes were upregulated while 62 genes were downregulated The upregulated genes represented 179 known genes, 66 expressed sequence tags (EST) and 22 replicate genes Among the downregulated genes were 43 known genes, 17 ESTs and two replicate probe sets A subgroup of the genes is listed in Table and the full list of genes is given in supplementary Table S1 To demonstrate the specificity of the gene expression changes, we randomly divided samples into two groups of equal size and repeated the SAM analysis (see Experimental procedures) This procedure was repeated FEBS Journal 272 (2005) 2684–2695 ª 2005 FEBS C C Strøm et al Gene expression in exercise-induced cardiac hypertrophy Fig Identification of differentially expressed genes A scatter plot of the observed relative difference in gene expression vs the expected difference based on permutation of samples At the solid line, observed values are identical to expected values The applied threshold (delta ¼ 1.20) is shown as dotted lines Corresponding values of significance threshold (delta), FDRs, number of genes identified as differentially expressed and the expected number of false positives are listed in the lower right quadrant several times No genes were identified as differentially expressed in the randomized data sets as shown in Fig Confirmation of differential expression of selected metabolic genes by quantitative PCR From the interesting metabolic genes, six were chosen for validation by quantitative PCR analysis CD36, fatty acid binding protein (FABP4), fatty acid transport protein (Slc27a1), and glucokinase regulatory protein (GCKR) were upregulated and uncoupling protein (UCP2) was downregulated confirming the DNA microarray data (Fig 4) Expression of fatty acid CoA ligase (FACL) was not significantly upregulated in the quantitative PCR analysis of exercise-induced hypertrophy Expression of selected genes in maladaptive hypertrophy To compare expression of CD36 and UCP2 in adaptive and maladaptive hypertrophy we analysed expression of CD36 and UCP2 in the noninfarcted region of the left ventricle weeks after myocardial infarction as compared to sham-operated animals Contrary to adaptive hypertrophy, where CD36 was upregulated and UCP2 downregulated, CD36 expression was unchanged and UCP2 expression increased (26%) in maladaptive hypertrophy (Fig 5) FEBS Journal 272 (2005) 2684–2695 ª 2005 FEBS Discussion In this work, we present a comprehensive analysis of transcriptional changes in response to exercise-induced cardiac hypertrophy, thereby for the first time providing an overview of molecular clues to the adaptive cardiac phenotype We identified a distinct global gene expression pattern of myocardium adapting to the physiological challenge of exercise, and statistical analysis identified 267 upregulated and 62 downregulated gene transcripts, providing a host of potential novel diagnostic and therapeutic targets for further investigation The exercise resulted in a relatively small increase in left ventricular mass (6%), which was in the same range as that found by others after isotonic exercise [10,16] When normalized to body weight or tibial length the increase in left ventricular mass was larger and significant Taken together with the fact that the absolute weights of all other organs were significantly reduced in the exercised animals, these data support that the exercise regime elicited cardiac hypertrophy The reduction in body weight seen in the exercised animals most likely resulted from a combination of reduced body fat and growth retardation In line with this, a pilot series of less intense exercise resulted in a reduction in body weight (exercise 313 g vs sedentary 403 g), concurrent reductions in absolute cardiac weights, and no hypertrophy after normalization to body weight or tibial length 2687 Gene expression in exercise-induced cardiac hypertrophy C C Strøm et al Table Expression changes in response to exercise Gene names are listed with GenBank accession number; SAM score, fold change (FC) and P-values calculated by a Welch t-test are listed for comparison Gene Metabolism Palmitoyl-protein thioesterase Fatty acid binding protein Fatty acid Coenzyme A ligase, long chain Cd36 Fatty acid transport protein Uncoupling protein 2, mitochondrial Glucokinase regulatory protein Pyruvate dehydrogenase phosphatase Solute carrier 16 (monocarboxylic acid transporter), member Hexokinase Phosphofructokinase, liver, B-type Extracellular matrix Biglycan Matrix Gla protein Integrin alpha Laminin receptor Cystatin B Cystatin C Cathepsin L Cathepsin S Cytoskeletal Sarcosin Fast myosin alkali light chain (MYL1) Talin Actinin alpha associated LIM protein Arg ⁄ Abl-interacting protein (ArgBP2) Myosin light chain alkali, smooth-muscle isoform (MYL6) Non-muscle myosin alkali light chain, new-born, heart ventricle (MYL4) Actin-related protein complex 1b Growth Eukaryotic translation elongation factor alpha Eukaryotic translation elongation factor Polymerase (RNA) II (DNA directed)polypeptide G Ribosomal protein L10a Ribosomal protein S16 Ribosomal protein L12 Ribosomal protein S27 PRKC, apoptosis, WT1, regulator BCL2-like 11 (apoptosis facilitator) Discs, large homolog (Drosophila) (Dlgh3) Disabled homolog (doc2) Rgc32 protein Growth differentiation factor 10 Inflammation Superoxide dismutase Lysozyme Complement component 1q b Complement component s Signalling Annexin Cbp ⁄ p300-interacting transactivator 2¢,3¢- Cyclic nucleotide 3¢-phosphodiesterase (CNP) Protein tyrosine phosphatase 4a1 AKAP4 2688 Accession number Score(d) FC P-value L34262 AI169612 AI236284 AA925752 U89529 AB010743 AA945442 AF062740 D63834 AI012593 X58865 5.5 3.8 5.1 4.5 3.2 ) 4.7 4.4 3.3 4.3 3.3 3.8 1.2 1.2 1.3 1.3 1.2 0.7 1.1 1.4 1.4 1.2 1.1 3.75E-04 3.34E-03 5.17E-04 1.21E-03 1.88E-02 8.25E-04 1.72E-03 8.97E-03 1.78E-03 8.41E-03 3.61E-03 U17834 AI012030 X65036 D25224 AI008888 AI231292 AI176595 L03201 3.3 3.2 3.4 5.3 3.9 5.9 3.8 3.5 1.3 1.3 1.2 1.2 1.2 1.4 1.1 1.5 1.74E-02 1.01E-02 7.93E-03 3.67E-04 3.25E-03 1.54E-04 5.88E-03 7.97E-03 AI639444 L00088 AA800962 AF002281 AF026505 AA875523 S77858 AF083269 3.2 3.4 3.3 3.2 4.1 4.4 4.1 3.5 1.4 1.5 1.2 1.2 1.3 1.3 1.2 1.3 8.74E-03 1.03E-02 8.57E-03 1.13E-02 2.48E-03 1.29E-03 2.08E-03 5.85E-03 AI008852 AI178750 Z71925 X93352 X17665 X53504 X59375 U05989 AF065433 U50147 U95178 AF036548 D49494 4.4 4.1 3.7 6.3 3.9 3.7 4.5 5.0 4.4 3.9 4.9 3.4 3.9 1.2 1.1 1.2 1.3 1.2 1.2 1.3 0.8 0.9 0.8 1.4 1.4 0.8 3.83E-03 2.00E-03 4.01E-03 2.31E-04 5.05E-03 6.43E-03 1.28E-03 5.69E-04 1.25E-03 3.56E-03 7.47E-04 6.47E-03 4.60E-03 Z24721 AA892775 X71127 D88250 4.2 4.7 3.6 5.2 1.2 2.3 1.4 1.4 2.04E-03 3.13E-03 5.36E-03 9.23E-04 AI171962 AA900476 L16532 L27843 AF008114 3.9 4.0 5.0 5.2 3.4 1.4 1.5 1.2 1.4 1.1 3.67E-03 2.69E-03 9.14E-04 4.02E-04 7.40E-03 ) ) ) ) FEBS Journal 272 (2005) 2684–2695 ª 2005 FEBS C C Strøm et al Gene expression in exercise-induced cardiac hypertrophy Table (Continued) Gene Cathechol-O-methyltransferase Guanine nucleotide binding protein, alpha inhibiting polypeptide N-myristoyltransferase ADRBK1 (GRK2) MAP-kinase phosphatase (cpg21) Calcium ⁄ calmodulin-dependent protein kinase Cholecystokinin B receptor 5-hydroxytryptamine (serotonin) receptor 2B Prolactin receptor GABA-A receptor alpha-6 subunit Munc13–3 Accession number M93257 AI228247 AA859942 M87854 AF013144 D86556 M99418 X66842 M19304 L08495 AA943677 Score(d) FC P-value 4.2 3.3 4.0 4.3 7.8 4.3 4.2 4.3 4.7 4.5 4.5 1.3 1.1 1.2 0.9 0.9 0.9 0.8 0.8 0.7 0.9 0.8 5.89E-03 8.47E-03 3.58E-03 2.83E-03 1.87E-04 3.47E-03 1.98E-03 3.41E-03 9.43E-04 1.49E-03 1.41E-03 ) ) ) ) ) ) ) ) Fig A scatter plot of the number of differentially expressed genes compared to the number of false-positive genes at different levels of delta The black line represents the actual data while the three grey lines represent data from three random divisions of samples into two groups The dotted black line represents unity, where the number of called genes is identical to the number of false positives Overall, gene expression patterns in adaptive cardiac hypertrophy were quite similar to previously published data from maladaptive cardiac hypertrophy A general upregulation of signalling, cytoskeletal and extracellular matrix genes was evident and the isoform shifts in sarcomeric proteins resembled those of maladaptive hypertrophy The most prominent difference from the maladaptive response was differential expression of a set of metabolic genes not previously associated with exercise-induced cardiac hypertrophy While downregulation of genes involved in lipid oxidation is typical of maladaptive hypertrophy, we found upregulation of sevFEBS Journal 272 (2005) 2684–2695 ª 2005 FEBS Fig Expression of selected metabolic genes by quantitative PCR confirming the microarray data Expression was normalized to GAPDH Bars represent SEM and *P < 0.05 eral of these genes in adaptive hypertrophy Expression levels of glycolytic enzymes indicated both enhanced glycolysis and glucose oxidation to contrast the impairments of glucose oxidation in maladaptive hypertrophy We also identified several differences in expression of 2689 Gene expression in exercise-induced cardiac hypertrophy Fig Expression of UCP2 and CD36 by quantitative PCR in maladaptive hypertrophy weeks after myocardial infarction (mi) UCP2 was significantly upregulated while CD36 expression was unchanged contrasting the findings in adaptive hypertrophy Expression was normalized to GAPDH Bars represent SEM and *P < 0.05 signalling proteins between adaptive and maladaptive hypertrophy including important modulators of adrenergic signalling Perhaps the most striking and potentially physiologically meaningful observation was the shift in metabolic gene expression This finding is especially interesting as it differentiates adaptive from maladaptive hypertrophy and could be the molecular mechanism underlying earlier findings of a balanced growth of cardiomyocytes with a normal ratio of mitochondria to cell number [10,17] and normal myofibril to mitochondrial ratio [5,6] in adaptive hypertrophy In our study, several genes involved in b-oxidation of lipids (CD36, FACL, fatty acid binding protein) were upregulated Genes involved in b-oxidation are downregulated in maladaptive cardiac hypertrophy [18,19] One gene, CD36 or Fat, encoding a fatty acid translocase, was upregulated in response to exercise but not regulated after maladaptive hypertrophy CD36 has recently been shown to be responsible for the defect in fatty acid metabolism seen in spontane2690 C C Strøm et al ously hypertensive rats [20], and myocardial recovery from ischaemia is impaired in CD36 knockout mice [21] Thus the differential expression of CD36 between maladaptive and adaptive hypertrophy might be of key importance for the difference in clinical outcome in the two conditions Glucose utilization through glycolysis is enhanced in hypertrophic hearts [22,23] However, there is no corresponding increase in rates of glucose oxidation [22,23] The consequent low coupling of glucose oxidation to glycolysis is functionally relevant, as it contributes to the contractile dysfunction in hypertrophic hearts [23] The multienzyme pyruvate dehydrogenase complex (PDC) catalyses the oxidative decarboxylation of pyruvate and contributes strongly to flux control of myocardial glucose oxidation The activity of PDC is continuously regulated by balance of inhibiting pyruvate dehydrogenase kinase and activating pyruvate dehydrogenase phosphatase (PDP) reactions [24] We found upregulation of the PDP gene, thus, suggesting an increased glucose oxidation in exercise-induced hypertrophy GCKR was upregulated; this has been shown to increase both glucokinase protein and enzymatic activity levels, leading to improved glucose tolerance and lowered plasma glucose in diabetic mice [25] In accordance with these data, we found upregulation of glucokinase (hexokinase 1) in hearts of exercised rats Further evidence of enhanced glycolysis came from the upregulation of 6-phosphofructo-2-kinase ⁄ fructose-2,6-bisphosphatase that stimulates 6-phosphofructo-1-kinase [26], a key enzyme of glycolysis, which was also upregulated in our experiments Collectively, these findings support the notion that cardiac capacity for glucose utilization is in fact increased by adaptation to exercise and that a transcriptional explanation for this aspect of functional improvement exists We found significant downregulation of UCP2 in response to exercise, while UCP2 was upregulated in maladaptive hypertrophy Uncoupling proteins dissipate the proton electrochemical gradient formed during mitochondrial respiration and generate heat production instead of ATP [27] Thus, ATP production through oxidative phosphorylation might be more effective in adaptive than in maladaptive hypertrophy due to differences in UCP2 expression In line with this, UCP2 was recently found to be upregulated in several different transgenic models of cardiomyopathy induced by chronic b-adrenergic receptor signalling [28] The upregulation of UCP2 was partly reversed by b-adrenergic receptor blockade In response to volume overload, UCP2 expression was increased and this increase was partly reversed by an angiotensin converting enzyme (ACE)-inhibitor [29] UCP2 has previously been found FEBS Journal 272 (2005) 2684–2695 ª 2005 FEBS C C Strøm et al to be downregulated in response to exercise [30] Thus, upregulation of UCP2 seems a general feature of maladaptive cardiac remodelling, and the well documented beneficial effects of ACE-inhibitors and b-adrenergic receptor-blockade are accompanied by decreased UCP2 expression These findings indicate that the downregulation of UCP2 in adaptive hypertrophy constitutes a molecular feature of ‘adaptiveness’ and that upregulation of UCP2 may be a key factor underlying defective energetics in diseased hearts In accordance with previous reports we did not find activation of the typical neonatal gene expression pattern found in pathological hypertrophy, which includes uprelation of atrial natriuretic peptide, B-type natriuretic peptide, a-skeletal and smooth muscle actin, and b-myosin heavy chain [16] However, exercise-induced hypertrophy was accompanied by a marked upregulation of genes involved in extracellular matrix remodeling (biglycan, matrix gla protein, cathepsins, cystatins, integrin a7 and laminin receptor) These genes are consistently upregulated in pathological models of cardiac hypertrophy indicating that these genes are necessary to the cardiac growth response [18,31,32] In contrast to pathological models of cardiac hypertrophy we found no increase in collagen mRNA expression We found upregulation of a number of cytoskeletal genes Several of these genes were previously described to be upregulated in pathological hypertrophy (MYL 1, and 6, sarcosin, talin, actin-related protein complex 1b and ArgBP2) [31,33] Upregulation of actinin a2 associated Lim11/rat Isl-1/Mec3 (LIM) protein (ALP) in cardiac hypertrophy has not been described previously but ALP– ⁄ – mice develop cardiomyopathy [34] In the only microarray study on exercise-induced cardiac hypertrophy reported to date, MYL upregulation was also found and confirmed by 2D gel electrophoresis [35] The study only employed three DNA microarrays in each group and did not use a statistical method to identify differentially expressed genes We found prominent upregulation of proteins involved in protein synthesis (eukaryotic translation elongation factor alpha 1, eukaryotic translation elongation factor 2, RNA polymerase II polypeptide G and several ribosomal proteins) These findings are consistent with the increased demand for protein synthesis in response to cardiac hypertrophy In accordance with previous studies on maladaptive hypertrophy [18,36] we found upregulation of inflammatory genes (superoxide dismutase 3, complement component 1qb and 1c, lysozyme and others) indicating that inflammation is a general feature of cardiac hypertrophy We cannot exclude the possibility that the strong physical stress induced by the FEBS Journal 272 (2005) 2684–2695 ª 2005 FEBS Gene expression in exercise-induced cardiac hypertrophy exercise contributed to the inflammatory response and exercise of more moderate extent with slower and continuous time course may induce hypertrophy without inflammation Several of the differentially regulated signalling proteins have also been reported to change in maladaptive hypertrophy (Cbp ⁄ p300-interacting transactivator, protein tyrosine phosphatase 4a1, annexin and cyclic nucleotide 3¢-phosphodiesterase) [18,32,33] Adrenergic signalling is important in cardiac hypertrophy and we found differential expression of several genes involved in adrenergic signal transduction (catechol-O-methyl transferase, GRK2, AKAP4 and Gai3) GRK2 desensitizes G-protein coupled receptors and is upregulated [37] in maladaptive hypertrophy We found downregulation of GRK2 in adaptive hypertrophy pointing to a potentially important difference in adrenergic signalling between maladaptive and adaptive hypertrophy In conclusion, we have used DNA microarrays to map gene expression in adaptive hypertrophy While expression of extracellular matrix proteins and sarcomeric proteins was similar to the changes known to occur in maladaptive hypertrophy, we found striking differences in expression of genes involved in metabolism between adaptive and maladaptive hypertrophy Experimental procedures Animal handling and training procedure Twenty-four male Wistar rats (Taconic M & B, Ejby, Denmark) weighing 285 ± 10 g (mean ± SD; n ¼ 24) were randomly assigned to either a seven-week treadmill running program (n ¼ 12) or served as sedentary controls (n ¼ 12) The animals had free access to food (standard rodent pellets) and water Rats in the running group were exercised on a custom-built 12-lane treadmill with an 8° inclination for hặday)1, daysặweek)1, for 7ẵ weeks between 12 : 00 and 17 : 30 Each training session started with a 20-min warm-up at 11 mỈmin)1 the first week gradually increasing to 18 mỈmin)1 the last weeks Running speed was set to 15 mỈmin)1 the first week, gradually increasing to level at 32.5 mặmin)1 the nal 2ẵ weeks, while the duration was reduced from 100 to 80 for the final 2½ weeks After week of training one rat had a small injury to one of its feet and was therefore withdrawn from further exercise and excluded from the study The experiments were approved by the Animal Experimentation Inspectorate of the Danish Ministry of Justice and the investigation conforms to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH publication no 85-23, revised 1996) The day after completion of the training protocol, all animals were sub- 2691 Gene expression in exercise-induced cardiac hypertrophy C C Strøm et al jected to echocardiography and hemodynamic examination under isoflurane anesthesia before being killed Hearts were excised, rinsed in ice-cold saline, weighed, dissected into left and right ventricles, frozen in liquid nitrogen and stored at )80 °C until mRNA extraction As exercise resulted in a significantly reduced body weight (BW) when compared to sedentary controls, normalization of organ weights to BW would result in apparent hypertrophy of all organs in the training animals For valid comparison of experimental groups, organ weights were instead normalized to lean body mass, estimated as BW0.78 [38], rendering only weights of total heart and left and right ventricles different between groups, while lung, kidney and stomach were not Echocardiography Echocardiography was performed during anesthesia with 1–1.5% isoflurane using a Vivid Five Echocardiograph (GE Medical Systems Ultrasound, Little Chalfont, UK) Recordings were stored digitally for off-line analysis Left ventricular cavity and wall dimensions were measured in 2D short axis recordings at the level of the papillary muscles Hemodynamic examination A microtip transducer catheter (Millar Instruments, Houston, TX, USA) was introduced from the right carotid artery and placed in the left ventricle for measurements of LVEDP and maximal rates of isovolumetric pressure development (dP ⁄ dtmax) and decline (dP ⁄ dtmin) After retraction from the left ventricle, mean arterial pressure (MAP) was measured Simultaneous elecrocardiography was performed from subcutaneously placed needle electrodes and heart rate (HR) was calculated Myocardial infarction Myocardial infarction was induced by ligating the left coronary artery Sham-operated animals served as controls [39] After weeks, animals were killed and total RNA was isolated from the noninfarcted part of the left ventricle as described in [36] Despite large thinned fibrotic scars, the weight of the left ventricle was increased in infarcted animals compared to controls, indicating left ventricular hypertrophy of the noninfarcted ventricle Gene expression profiling The GeneChip RGU34A from Affymetrix containing 8740 probe sets (and 59 control probe sets which were excluded from further analysis) was used for all hybridizations The probe sets represent approximately 6000 known rat genes, the rest being ESTs (see http://www.affymetrix.com for a more detailed description) Standard protocols for chip hybridizations available at http://www.affymetrix.com were used Briefly, cDNA was synthesized from total RNA extracted from the tissue samples by Trireagent (Molecular Research Center, Inc., OH, USA) cDNA was then used for in vitro transcription to produce biotin-labelled cRNA The cRNA was fragmented before hybridization RNA from individual animals was hybridized to each chip and six randomly chosen samples were analysed from each group Chip hybridizations were performed at a core facility with ample experience in microarray handling to ensure quality Raw data are available at http://www.ncbi.nlm nih.gov/geo as series number GSE739 (access by username: revstro90, password: revstro90) Array data analysis Array data were normalized using the nonlinear invariant rank fitting method of Li and Wong available at http:// www.dchip.org [40] Model based expression (MBE) values were calculated for each gene using dChip (perfect match only model) Differentially expressed genes were identified using SAM available at http://www-stat stanford.edu ⁄ tibs ⁄ SAM ⁄ [41] Briefly, SAM is a statistical approach to identify differentially expressed genes by controlling the FDR The FDR is the percentage of genes identified by chance SAM identifies the differentially regulated genes by assimilating a set of gene specific t-tests Each gene is assigned a score by dividing the average difference in gene expression between groups by the pooled SD Genes with scores greater than threshold delta (Fig 2, grey) are deemed potentially significant By permutation of the Table Primer sets used in quantitative PCR Sequences are shown in the 5¢)3¢ orientation Gene Forward Reverse Target position Product size GAPDH FABP4 CD36 FACL4 GCKR Slc27a1 UCP2 GTCGGTGTGAACGGATTTG GGAAAGTGAAGAGCATCATAACC GCAAAGAAGGGAAACCTGTG CCTGGATTAGGACCAAAGGA TGCAGAGGTTCTCTGGACAGT CCACTCAGCAGGGAACATCA GAAAGGGACCTCTCCCAATG CTTGCCGTGGGTAGAGTCAT ATGACACATTCCACCACCAG TCCAGTTATGGGTTCCACATC ATTTTGCTGGACTGGTCAGA GTGGGGATCACCTTTTCCTT GGCATATTTCACCGATGTACTGC GGAGGTCGTCTGTCATGAGG 859–1008 289–412 1071–1207 981–1126 1589–1739 950–1098 872–987 150 124 137 146 151 149 116 2692 FEBS Journal 272 (2005) 2684–2695 ª 2005 FEBS C C Strøm et al samples and recalculation of the scores, the FDR is estimated at different values of delta Log2 MBE values were analysed using a two-class unpaired approach with an FDR of less than 5% For comparison, we calculated P-values for each gene by a Welch t-test, which allows for inequality of variances between groups P-values ranged from 2.0 · 10)7 to 0.02 Quantitative PCR RNA was extracted de novo from all the cardiac tissue samples (exercised, n ¼ 11; sedentary, n ¼ 12) Reverse transcription was performed using the Omniscript RT Kit (Qiagen, Valencia, CA, USA) on lg total RNA samples and random hexamer primers according to manufacturer’s instructions Primers were designed using PRIMER3 (MIT and available online at http://www-genome.wi.mit.edu/cgi/ bin/primer/primer3.cgi/primer3_www.cgi) and sequence information retrieved from the NCBI database Intron spanning pairs were used to avoid amplification of genomic sequences, and primer specificity and emergence of only one product of the predicted size were ascertained by agarose gel electrophoresis and real-time melting curve analysis of all PCR products Each sample reaction contained cDNA synthesized from 10 ng heart RNA Standard curve reactions contained cDNA pooled from all samples and diluted : 2, : 4, : 10, : 50 and : 100 (corresponding to 50, 25, 10, and ng of total heart RNA, respectively) DNA amplification was carried out using the RotorGene (Corbett Research, Sydney, Australia) and the SYBR green PCR Master Mix (Quantitect, Berkely, CA, USA) The reactions were set up in 0.1 mL microtubes in a total volume of 20 lL with lL of template Standard curves in duplicate were included in every run, and quantification of individual samples performed by normalization to GAPDH Constant GADPH expression between exercised and sedentary animals was confirmed by northern blotting (data not shown) At least three independent runs were performed for every target transcript The primer sets used in quantitative PCR are shown in Table Statistical analysis Array data were analysed as described above All other comparisons were made by an unpaired Student’s t-test P-values ¼ 0.05 were considered significant Acknowledgements We thank the staff at the Microarray Center, Rigshospitalet, Denmark, for performing the microarray hybridizations and scannings We thank Peter Schjerling for Northern blots of GAPDH and Pernille Gundelach and Katrine Kastberg for technical assistance The FEBS Journal 272 (2005) 2684–2695 ª 2005 FEBS Gene expression in exercise-induced cardiac hypertrophy work was supported by the John and Birthe Meyer Foundation, the Danish Heart Foundation (01-1-2-5922907, 99-1-2-31-22684), the Villadsen Family Foundation, the Foundation of 17.12.1981, the University of Copenhagen, Rigshospitalet, the Novo-Nordisk Foundation and the Danish National Research Foundation References Agabiti-Rosei E & Muiesan ML (1997) Prognostic significance of left ventricular hypertrophy regression Adv Exp Med Biol 432, 199–205 Ehsani AA, Hagberg JM & Hickson RC (1978) Rapid changes in left ventricular dimensions and mass in response to physical conditioning and deconditioning Am J Cardiol 42, 52–56 Shapiro LM (1984) Physiological left ventricular hypertrophy Br Heart J 52, 130–135 Kozakova M, Galetta F, Gregorini L, Bigalli G, Franzoni F, Giusti C & Palombo C (2000) Coronary vasodilator capacity and epicardial vessel remodeling in physiological and hypertensive hypertrophy Hypertension 36, 343–349 Weber KT, Clark WA, Janicki JS & Shroff SG (1987) Physiologic versus pathologic hypertrophy and the pressure-overloaded myocardium J Cardiovasc Pharmacol 10, S37–S50 Tomanek RJ (1979) Quantitative ultrastructural aspects of cardiac hypertrophy Tex Rep Biol Med 39, 111–122 Barger PM & Kelly DP (2000) PPAR signaling in the control of cardiac energy metabolism Trends Cardiovasc Med 10, 238–245 Hainsey T, Csiszar A, Sun S & Edwards JG (2002) Cyclosporin A does not block exercise-induced cardiac hypertrophy Med Sci Sports Exerc 34, 1249–1254 Geenen DL, Malhotra A & Buttrick PM (1996) Angiotensin receptor blockade does not prevent physiological cardiac hypertrophy in the adult rat J Appl Physiol 81, 816–821 10 Iemitsu M, Miyauchi T, Maeda S, Sakai S, Kobayashi T, Fujii N, Miyazaki H, Matsuda M & Yamaguchi I (2001) Physiological and pathological cardiac hypertrophy induce different molecular phenotypes in the rat Am J Physiol Regul Integr Comp Physiol 281, R2029– R2036 11 Calderone A, Murphy RJ, Lavoie J, Colombo F & Beliveau L (2001) TGF-beta(1) and prepro-ANP mRNAs are differentially regulated in exercise-induced cardiac hypertrophy J Appl Physiol 91, 771–776 12 Wisloff U, Loennechen JP, Falck G, Beisvag V, Currie S, Smith G & Ellingsen O (2001) Increased contractility and calcium sensitivity in cardiac myocytes isolated from endurance trained rats Cardiovasc Res 50, 495– 508 2693 Gene expression in exercise-induced cardiac hypertrophy 13 Golub TR, Slonim DK, Tamayo P, Huard C, Gaasenbeek M, Mesirov JP, Coller H, Loh ML, Downing JR, Caligiuri MA, Bloomfield CD & Lander ES (1999) Molecular classification of cancer: class discovery and class prediction by gene expression monitoring Science 286, 531–537 14 Roberts CJ, Nelson B, Marton MJ, Stoughton R, Meyer MR, Bennett HA, He YD, Dai H, Walker WL, Hughes TR, Tyers M, Boone C & Friend SH (2000) Signaling and circuitry of multiple MAPK pathways revealed by a matrix of global gene expression profiles Science 287, 873–880 15 Buttrick PM & Scheuer J (1987) Physiologic, biochemical, and coronary adaptation to exercise conditioning Cardiol Clin 5, 259–270 16 Jin H, Yang R, Li W, Lu H, Ryan AM, Ogasawara AK, Van Peborgh J & Paoni NF (2000) Effects of exercise training on cardiac function, gene expression, and apoptosis in rats Am J Physiol Heart Circ Physiol 279, H2994–H3002 17 Hardie DG & Hawley SA (2001) AMP-activated protein kinase: the energy charge hypothesis revisited Bioessays 23, 1112–1119 18 Stanton LW, Garrard LJ, Damm D, Garrick BL, Lam A, Kapoun AM, Zheng Q, Protter AA, Schreiner GF & White RT (2000) Altered patterns of gene expression in response to myocardial infarction Circ Res 86, 939–945 19 Tan FL, Moravec CS, Li J, Apperson-Hansen C, McCarthy PM, Young JB & Bond M (2002) The gene expression fingerprint of human heart failure Proc Natl Acad Sci USA 99, 11387–11392 20 Aitman TJ, Glazier AM, Wallace CA, Cooper LD, Norsworthy PJ, Wahid FN, Al-Majali KM, Trembling PM, Mann CJ, Shoulders CC, Graf D, St Lezin E, Kurtz TW, Kren V, Pravenec M, Ibrahimi A, Abumrad NA, Stanton LW & Scott J (1999) Identification of Cd36 (Fat) as an insulin-resistance gene causing defective fatty acid and glucose metabolism in hypertensive rats Nat Genet 21, 76–83 21 Irie H, Krukenkamp IB, Brinkmann JF, Gaudette GR, Saltman AE, Jou W, Glatz JF, Abumrad NA & Ibrahimi A (2003) Myocardial recovery from ischemia is impaired in CD36-null mice and restored by myocyte CD36 expression or medium-chain fatty acids Proc Natl Acad Sci USA 100, 6819–6824 22 Allard MF, Schonekess BO, Henning SL, English DR & Lopaschuk GD (1994) Contribution of oxidative metabolism and glycolysis to ATP production in hypertrophied hearts Am J Physiol 267, H742–H750 23 Wambolt RB, Lopaschuk GD, Brownsey RW & Allard MF (2000) Dichloroacetate improves postischemic function of hypertrophied rat hearts J Am Coll Cardiol 36, 1378–1385 24 Lydell CP, Chan A, Wambolt RB, Sambandam N, Parsons H, Bondy GP, Rodrigues B, Popov KM, 2694 C C Strøm et al 25 26 27 28 29 30 31 32 33 34 35 36 Harris RA, Brownsey RW & Allard MF (2002) Pyruvate dehydrogenase and the regulation of glucose oxidation in hypertrophied rat hearts Cardiovasc Res 53, 841–851 Slosberg ED, Desai UJ, Fanelli B, St Denny I, Connelly S, Kaleko M, Boettcher BR & Caplan SL (2001) Treatment of type diabetes by adenoviral-mediated overexpression of the glucokinase regulatory protein Diabetes 50, 1813–1820 Beauloye C, Marsin AS, Bertrand L, Vanoverschelde JL, Rider MH & Hue L (2002) The stimulation of heart glycolysis by increased workload does not require AMP-activated protein kinase but a wortmannin-sensitive mechanism FEBS Lett 531, 324–328 Nicholls DG & Locke RM (1984) Thermogenic mechanisms in brown fat Physiol Rev 64, 1–64 Gaussin V, Tomlinson JE, Depre C, Engelhardt S, Antos CL, Takagi G, Hein L, Topper JN, Liggett SB, Olson EN, Lohse MJ, Vatner SF & Vatner DE (2003) Common genomic response in different mouse models of beta-adrenergic-induced cardiomyopathy Circulation 108, 2926–2933 Murakami K, Mizushige K, Noma T, Tsuji T, Kimura S & Kohno M (2002) Perindopril effect on uncoupling protein and energy metabolism in failing rat hearts Hypertension 40, 251–255 Boss O, Samec S, Desplanches D, Mayet MH, Seydoux J, Muzzin P & Giacobino JP (1998) Effect of endurance training on mRNA expression of uncoupling proteins 1, 2, and in the rat FASEB J 12, 335–339 Jin H, Yang R, Awad TA, Wang F, Li W, Williams SP, Ogasawara A, Shimada B, Williams PM, de Feo G & Paoni NF (2001) Effects of early angiotensin-converting enzyme inhibition on cardiac gene expression after acute myocardial infarction Circulation 103, 736–742 Weinberg EO, Mirotsou M, Gannon J, Dzau VJ, Lee RT & Pratt RE (2003) Sex dependence and temporal dependence of the left ventricular genomic response to pressure overload Physiol Genomics 12, 113–127 Hwang JJ, Allen PD, Tseng GC, Lam CW, Fananapazir L, Dzau VJ & Liew CC (2002) Microarray gene expression profiles in dilated and hypertrophic cardiomyopathic end-stage heart failure Physiol Genomics 10, 31–44 Pashmforoush M, Pomies P, Peterson KL, Kubalak S, Ross J Jr, Hefti A, Aebi U, Beckerle MC & Chien KR (2001) Adult mice deficient in actinin-associated LIM-domain protein reveal a developmental pathway for right ventricular cardiomyopathy Nat Med 7, 591–597 Diffee GM, Seversen EA, Stein TD & Johnson JA (2003) Microarray expression analysis of effects of exercise training: increase in atrial MLC-1 in rat ventricles Am J Physiol Heart Circ Physiol 284, H830–H837 Strom CC, Kruhoffer M, Knudsen S, Stensgaard-Hansen F, Jonassen TEN, Orntoft TF, Haunso S & Sheikh SP FEBS Journal 272 (2005) 2684–2695 ª 2005 FEBS C C Strøm et al (2004) Identification of a core set of genes that signifies pathways underlying cardiac hypertrophy Comp Funct Genom 5, 459–470 37 Choi DJ, Koch WJ, Hunter JJ & Rockman HA (1997) Mechanism of beta-adrenergic receptor desensitization in cardiac hypertrophy is increased beta-adrenergic receptor kinase J Biol Chem 272, 17223–17229 38 Batterham AM, George KP & Mullineaux DR (1997) Allometric scaling of left ventricular mass by body dimensions in males and females Med Sci Sports Exerc 29, 181–186 39 Theilade J, Strom C, Christiansen T, Haunso S & Sheikh SP (2003) Differential G protein receptor kinase expression in compensated hypertrophy and heart failure after myocardial infarction in the rat Basic Res Cardiol 98, 97–103 FEBS Journal 272 (2005) 2684–2695 ª 2005 FEBS Gene expression in exercise-induced cardiac hypertrophy 40 Li C & Hung Wong W (2001) Model-based analysis of oligonucleotide arrays: model validation, design issues and standard error application Genome Biol 2, RESEARCH0032 Epub 41 Tusher VG, Tibshirani R & Chu G (2001) Significance analysis of microarrays applied to the ionizing radiation response Proc Natl Acad Sci USA 98, 5116–5121 Supplementary material The following material is available from http://www blackwellpublishing.com/products/journals/suppmat/ EJB/EJB4684/EJB4684sm.htm Table S1 Expression changes in response to exercise Table S2 Raw gene expression data 2695 ... protein Integrin alpha Laminin receptor Cystatin B Cystatin C Cathepsin L Cathepsin S Cytoskeletal Sarcosin Fast myosin alkali light chain (MYL1) Talin Actinin alpha associated LIM protein Arg... upregulated in the quantitative PCR analysis of exercise-induced hypertrophy Expression of selected genes in maladaptive hypertrophy To compare expression of CD36 and UCP2 in adaptive and maladaptive hypertrophy. .. C C Strøm et al Gene expression in exercise-induced cardiac hypertrophy Table (Continued) Gene Cathechol-O-methyltransferase Guanine nucleotide binding protein, alpha inhibiting polypeptide N-myristoyltransferase