Báo cáo khoa học: Transcript profiling during the early development of the maize brace root via Solexa sequencing pot

Transcript profiling during the early development of the maize brace root via Solexa sequencing Yan-Jie Li*, Ya-Ru Fu*, Jin-Guang Huang, Chang-Ai Wu and Cheng-Chao Zheng State Key Laboratory of Crop Biology, College of Life Sciences, Shandong Agricultural University, China Introduction Maize (Zea mays L.) develops a complex root architec- ture, including embryonic primary roots, seminal roots, lateral roots and shoot borne roots, which form at different developmental stages and have distinct physiological functions [1,2]. The shoot borne roots, which represent the major portion of the postembryon- ic roots, include crown roots formed underground and brace roots born on the stem nodes of successive basal phytomers. In cereal crops, the brace roots (also termed nodal adventitious roots), which are specifically developed in maize and sorghum, differ from the main roots in that they are mostly very short, lose their mer- istem and rapidly become determinate [3]. They con- tribute enormously to lodging resistance, water and nutrient uptake in the late growth and development of the maize plants [4,5]. Most importantly, they have a Keywords brace root; differential expression; maize; Solexa sequencing; tag Correspondence C C. Zheng or C A Wu, College of Life Sciences, Shandong Agricultural University, Taian, Shandong 271018, China Fax: +86 538 8226399 Tel: +86 538 8242894; +86 538 8246678 E-mail: cczheng@sdau.edu.cn; cawu@sdau.edu.cn *These authors contributed equally to this work (Received 16 September 2010, revised 19 October 2010, accepted 26 October 2010) doi:10.1111/j.1742-4658.2010.07941.x Currently, the molecular regulation mechanisms involved in the early development of maize brace root are poorly known. To gain insight into the transcriptome dynamics that are associated with its development, genome-wide gene expression profiling was conducted by Solexa sequencing (Illumina Inc., San Diego, CA, USA). More than five million tags were generated from the stem node tissues without and with just-emerged brace roots, including 149 524 and 178 131 clean tags in the two libraries, respec- tively. Of these, 82 864 (55.4%) and 91 678 (51.5%) tags were matched to the reference genes. The most differentially expressed tags with a log 2 ratio > 2 or < )2(P < 0.001) were analyzed further, representing 143 up-regu- lated and 152 down-regulated genes, except for unknown transcripts, which were classified into 11 functional categories. The most enriched categories were those of metabolism, signal transduction and cellular transport. Many genes or biological pathways were found to be commonly shared between brace root and lateral or adventitious root development, such as genes par- ticipating in cell wall degradation and synthesis, auxin transport and signal- ing, ethylene signaling, etc. Next, the expression patterns of 20 genes were assessed by quantitative real-time PCR, and the results obtained showed general agreement with the Solexa analysis. Furthermore, a comparison of the brace root transcriptome with that of maize primary root revealed sub- stantial differences in the categories and abundances of expressed tran- scripts. In conclusion, we first reveal the complex changes in the transcriptome during the early development of maize brace root and pro- vide a comprehensive set of data that are essential for understanding its molecular regulation. Abbreviations DGE, Illumina ⁄ Solexa digital gene expression; EST, expressed sequence tag; N, node tissues; NR, node tissues with just-emerged brace roots; qRT-PCR, quantitative real-time PCR; TPM, transcript per million. 156 FEBS Journal 278 (2011) 156–166 ª 2010 The Authors Journal compilation ª 2010 FEBS substantial influence on grain yield under soil flooding and water-limited conditions [6]. In the past decades, research on the maize brace roots has been focused mainly at the morphological and physiological levels. It has been well described that the primordia of brace roots develop from dedifferenti- ated cells of the stem parenchyma, just behind the stem cortex and below the intercalary meristem of the over- laying internodes [7]. Previous studies have demon- strated that many nutritional or environmental factors could affect brace root formation. Demotes-Mainard and Pellerin [8] reported that the number of brace roots emerging from the upper phytomers was lower when the carbohydrate nutrition of plants was reduced by shading or low light as a result of large plant densi- ties. Nutrient deficiencies such as phosphorus and nitrogen could decrease the rate of emergence or the number of brace roots [9,10]. Soil ridging is also an important factor that could increase the number of functional brace roots, and later ridging tends to result in shorter internodes and more functional nodal roots, leading to better lodging resistance [11,12]. However, to date, knowledge concerning their initiation or early development at the molecular level remains poor, and only the RTCS gene encoding a LOB domain protein was suggested to be a potential regulator of the maize crown and brace root initiation [13–15]. Recently, sev- eral genes involved in regulating the development of other root types of maize have been identified. The SLR1 and SLR2 genes were reported to be required for lateral root elongation [16]. Ten ZmGSL members in the gibberellic acid stimulated-like gene family were found to be involved in modulating the lateral root development [17]. The rum1 and lrt1 mutants failed to develop lateral roots [18]. In addition, the rth1 mutant, which is deficient in encoding a subunit of the exocyst complex, exhibited a reduction in root hairs [19]. Some possible regulatory genes involved in the lateral or adventitious root formation of Arabidopsis, rice and Pinus contorta were also proposed [20–23]. Therefore, it is interesting to determine whether the maize brace root formation shares the same regulatory mechanisms with these underground roots. To obtain a comprehen- sive and unbiased transcript profile during maize brace root formation, we performed deep sequencing analysis using the Illumina ⁄ Solexa digital gene expression (DGE) system. The DGE system is an improved tag- based method that can sequence in parallel millions of DNA molecules that are derived directly from mRNA [24]. The development of the DGE system enables the sequencing of total cDNA for the derivation of an accurate measure of gene expression, both individually and comprehensively, and the discovery of novel regions of transcription, dramatically changing the way that the functional complexity of transcriptome can be studied. In the present study, an overall impression of gene profiles during the early development of the maize brace root was acquired by deep sequencing. For the first time, we have comprehensively characterized the molecular basis of the physiological processes during maize brace root formation and provide useful infor- mation for further research. Results Characterization of the sequenced Solexa libraries To identify genes involved in brace root initiation, two maize Solexa libraries were constructed from tissues of node and node with just-emerged brace roots. Sequencing depths of 4 172 448 and 5 713 648 tags were achieved in the two libraries, including 328 043 and 432 881 distinct tags, respectively. To make the libraries meaningful, tags recorded only once were first wiped off as a result of their unreliability; leaving 149 524 and 178 131 distinct tags in each library that were detected multiple times (clean tags). The fre- quency of these tags is shown in Table 1, which lists the copy numbers in the range 2–100 or higher, in which the majority of clean tags (68% from each) were present at low copy numbers (< 10 copies), and approximately 26% tags from each library were counted between 11 and 100 times. Only approxi- mately 5% tags were detected more than 100 times. To identify the genes corresponding to the 149 524 and 178 131 meaningful tags in each library, an essential dataset containing 163 919 reference genes expressed in the maize genome from the MaizeSequence database (http://maizesequence.org/index.html) was prepared by Table 1. Distribution of the experimental tags sequenced from the two solexa libraries. NNR Total number of tags 4 172 448 5 713 648 Total number of distinct tags 328 043 432 881 Tag copy number > 1 (clean tag) 149 524 178 131 2–5 79 592 96 393 6–10 22 284 25 215 11–20 16 804 19 180 21–50 15 997 17 867 51–100 7316 9088 > 100 7531 10 388 Y J. Li et al. Solexa profiles of maize brace roots FEBS Journal 278 (2011) 156–166 ª 2010 The Authors Journal compilation ª 2010 FEBS 157 expressed sequence tag (EST) analysis. Altogether, 144 768 genes (88.3%) have the CATG sites, resulting in a total number of 1 417 555 reference tags. By assigning the experimental Solexa tags to the virtual reference ones (Table 2), we observed that 68 639 (45.9%) and 71 250 (40%) tags were perfectly matched to the refer- ence genes in node tissues (N) and node tissues with just-emerged brace roots (NR) libraries respectively. Out of the tags matched to reference genes, approxi- mately 13% were mapped to multiple locations, includ- ing low complexity tags with poly(A) tails and tags derived from repetitive sequences. Further sequences analysis revealed that some of them were mapped to highly conserved domains shared by different genes. For example, CATGGACAAGTTCGGCGGCGT could be matched to AC194430.3_FG026 and AC194430.3_ FG036 sharing a 792 bp sequence encoding a fatty acid hydroxylase domain. In addition, approximately 14% tags in two libraries were mapped to the antisense strands, demonstrating that those regions might be bidi- rectionally transcribed. However, for the discrepancy between the reference tags and experimental tags [25], 10% of 1 bp mismatched tags were present in the two libraries. Altogether, there are 82 864 (55.4%) tags in the N library and 91 678 (51.5%) tags in the NR library matched to the reference genes. The unmatched tags were then blasted against the maize genome, and approximately 31% tags were matched to the genomic sequences in the two libraries. These might represent non-annotated genes or noncoding transcripts that derived from intergenic regions. As a result of the sig- nificant sequencing depth of Solexa technology and incomplete annotation of the maize genome, however, 13.7% and 15.7% unmatched tags in each library were observed. Identification of differentially expressed transcripts By comparing our two Solexa libraries, a great number of differentially expressed transcripts were identified. The distribution of fold-changes in tag number between the two libraries is shown in Fig. S1. The great major- ity of transcripts were expressed at similar levels in the two libraries: approximately 98.6% tags showed a < 5- fold difference in expression. Tags with expressional changes in the range 5–200-fold accounted for 1.39%, and only 0.01% tags showed > 200-fold changes in expression level. At a statistically significant value (P < 0.01), 7239 differentially expressed tags exhibiting substantial changes were detected, including 3720 anno- tated genes (51%). Scatter plot analysis also presented a broader scope of differentially expressed tags than annotated genes, demonstrating that a great number of unknown transcripts were revealed (Fig. S2). To study a subset of genes that were associated with brace root development and to assess the molecular basis of brace root development, we analyzed the most differentially regulated tags with a log 2 ratio > 2 or < )2 using a greater statistically significant value (P < 0.001) as well as false discovery rates (FDR < 0.01), representing 307 up-regulated and 372 down-regulated transcripts. Apart from the unknown transcripts (55%), predicted or known genes were categorized according to their functions. Altogether, 143 up- and 152 down-regulated genes were listed and classified into 11 categories (Tables 3 and S1). Of these, the most enriched func- tional categories are those of metabolism (19.6%), sig- naling pathway (12.8%) and cellular transport (12.6%). Gene categories showed an obvious increase in tran- script abundance involved in protein binding and cell wall metabolism. By contrast, transcriptional abun- dance for genes participating in transcript regulation, cell cycle and DNA replication pathways were reduced. At the cellular level, brace root initiation involves two major steps similar to that of lateral or adventi- tious roots: the degradation of overlaying cells and the reorganization of new root cells, which are regulated by auxin associated networks [23]. In total, 25 differen- tially expressed genes involved in cell wall metabolism and cell morphogenesis were listed (Table S1). Nine transcripts encoding endoglucanase, pectin lyase and chitinase genes, which were involved in cell wall degra- dation, were greatly up-regulated. On the other hand, another 10 genes directly participating in cell wall bio- synthesis and cell morphogenesis were obviously induced as well, such as xyloglucan fucosyltransferase, cellulose synthase, COBRA and expansin. Interestingly, many auxin associated genes were also differentially Table 2. Summary of Solexa distinct tag-to-gene mapping data. Tag mapping Distinct tags NNR Sense Perfect match 59 802 (40%) 62 276 (35%) bp mismatch 12 241 (8.1%) 17 852 (10%) Antisense Perfect match 8837 (5.9%) 8974 (5%) 1 bp mismatch 1984 (1.3%) 2576 (1.4%) All tags mapping to gene 82 864 (55.4%) 91 678 (51.5%) Tags mapping to genome 46 247 (30.9%) 58 430 (32.8%) No matched tags 20 413 (13.7%) 28 023 (15.7%) Total distinct tags (clean tags) 149 524 178 131 Solexa profiles of maize brace roots Y J. Li et al. 158 FEBS Journal 278 (2011) 156–166 ª 2010 The Authors Journal compilation ª 2010 FEBS regulated in the present study, such as AUX, ARF, H+ pyrophosphatase, P450 CYP81A and ABC trans- porters (Table S1). In accordance with previous studies [22,26], the AUX gene was sharply induced and two ARF proteins were greatly decreased in the present analysis, which could positively regulate brace root development. In addition, it was observed that many gene families were over-represented in the data of the present study (Table S1). For example, six transcripts encoding members of major facilitator super family were classi- fied into cellular transport categories, and five of them are down-regulated in the NR library. The most abun- dant gene family present is the protein kinase family; 16 genes out of the total 24 members were significantly induced in the NR library, implying the importance of signal transduction during the early brace root devel- opment. The over-representation of the same family members strongly suggests their regulating roles in this developmental transition processes. Furthermore, with the benefit of Solexa sequencing (i.e. meaning that the entire transcriptome is surveyed), numerous novel transcripts with an unclear function were also detected (Table S2). Quantitative quantitative real-time PCR (qRT-PCR) confirmation To evaluate the validity of Solexa analysis and to further assess the patterns of differential gene expres- sion, 20 candidate genes were selected and detected by qRT-PCR, including two unknown transcripts AC211140.2_FG010 and AC209357.3_FG031 (Table S2). As shown in Table 4, the expression patterns showed general agreement with the Solexa sequencing. Because of the apparent discrepancies with respect to ratio, it should be attributed to the essentially different algo- rithms determined by the two techniques [27]. In the analysis of gene profiles, the deep sequencing method generates absolute rather than relative expression mea- surements. As expected, transcripts from highly abun- dant Solexa tags appeared at the expected lower cycle numbers in the quantitative PCR analyses. Addition- ally, high-fold changes were observed for genes that showed low copy numbers in the N library but high abundances in the NR library. For example, PI12 showed no expression in the N library, whereas it was detected 230 times in the NR library. It was signifi- cantly up-regulated by 166.7-fold in the RT-PCR analysis. Similarly, a b-1,3-glucanase-like gene was induced by 62-fold. These results basically confirmed the reliability of our transcriptome analysis. To further investigate the expression profiles of these genes, stem node tissues were harvested from separate successive phytomers of the V6 stage maize, representing four different developmental phases of brace roots: pre-initiation, initiation, emergence and post-emergence (Fig. 1A). From the qRT-PCR results (Fig. 1B), altered expression was observed for all the candidate genes, indicating that they were involved in the regulatory networks during brace root formation. GRP (glycine-rich cell wall structural protein), PI 12 (proteinase inhibitor I 12), PI 13 (proteinase inhibitor I 13), BGL (B-1,3-glucanase like), Chn1 (Chitinase) and ABC transporter gene were up-regulated, whereas E3, AC209357.3_FG031 and AC211140.2_FG010 genes were down-regulated as the brace root devel- ops, indicating that these genes play positive or negative roles during both brace root initiation and later development. Other genes such as expansin, XF (xyloglucan fucosyltransferase), CesA (cellulose syn- thase), NOI (nitrogen transporter) and CYP 81A Table 3. Functional classification of genes differentially expressed during the early development of the maize brace root. Functional category Number (proportion) Up-regulated Down-regulated Total Cell wall metabolism 15 (5.1%) 6 (2%) 21 (7.1%) Cell morphogenesis 4 (1.3%) 0 (0) 4 (1.3%) Signaling pathway 23 (7.8%) 15 (5%) 30 (12.8%) Cell replication 1 (0.3%) 18 (6.1%) 19 (6.4%) Epigenetic modulation 1 (0.3%) 3 (1%) 4 (1.3%) Environmental response 22 (7.5%) 12 (4.1%) 34 (11.6%) Ion uptake and cellular transport 12 (4.1%) 25 (8.5%) 37 (12.6%) Transcription regulation 8 (2.7%) 22 (7.5%) 30 (10.2%) Metabolism 29 (9.8%) 29 (9.8%) 58 (19.6%) Protein synthesis, protein fate and function regulation 11 (3.7%) 14 (4.7%) 25 (8.4%) Protein binding function 17 (5.7%) 8 (2.7%) 25 (8.4%) Total 143 (48.3%) 152 (51.7%) 295 (100%) Y J. Li et al. Solexa profiles of maize brace roots FEBS Journal 278 (2011) 156–166 ª 2010 The Authors Journal compilation ª 2010 FEBS 159 were first induced to a high expression level and then decreased, indicating that they might play major roles in specific developmental stages. Moreover, the expression of ARF, two DNA methyltransferases and HMG fluctuated during brace root development, demonstrating that these genes might be regulated in a temporal manner. Comparison of the maize brace root and primary root transcript profiles To determine the differentially expressed transcripts involved in the maize brace root and primary root development, we compared the 80 most highly abun- dant brace root transcripts in the NR library (Table S3) and the primary root transcripts reported by Poroyko et al. [28]. The results obtained revealed that the selected tags in brace root and primary root showed little overlap in functional category or tran- script identity. Functional analysis of the 80 abundant brace root transcripts revealed that a large proportion of them are enzymes involved in the metabolic and energy processes, such as glutathione S-transferase, glycoside hydrolase and dTDP-glucose dehydratase, indicating that these metabolic processes are more active in the early development of brace roots. More- over, as shown in Table 5, comparison of gene catego- ries showed that, except for the categories of chromatin structure and energy production, substantial differences were observed. For example, in the maize primary root tissue, the most abundant genes were involved in translation and ribosome structure, which accounted for 24% of genes, whereas only 11.3% of genes were classified into this category in the brace root tissue. For the rest of the categories, the tran- script abundances in the brace root were higher than that in the primary root. In the 55 annotated tags in the primary root reported by Poroyko et al. [28], 19 tags showed no match to any transcript in our NR libraries, suggesting that these genes were not expressed in brace root tissue. Thirty-one tags, as a result of being only 14 nucleotides in length, were mapped to more than one brace root tag (21 nucleo- tides). Only five transcripts were present in both libraries, encoding a initiation factor 5A, elongation factor 1-b, 60S ribosomal protein L5, ribosomal pro- tein S10 and calmodulin, respectively (Table 6). The obvious discrepancies between the two root expression profiles imply that different regulation mechanisms are involved in maize brace root and primary root early development. Discussion The major goal of the present study is to preliminarily explore transcripts involved in the early development Table 4. Confirmation of the expression profiles of selected genes by qRT-PCR. Gene ID Description Solexa qRT-PCR NR ⁄ N b NNRNR⁄ N a AC196718.3_FG011 Glycine-rich cell wall protein 6 33 5.5 9.09 AC186025.4_FG038 Endochitinase A 2 2391 9.77 21.21 AC210802.2_FG026 Cellulose synthesis 139 778 5.60 1.66 AC213625.3_FG012 Chitinase, Chn1 0 19 19 2.38 AC190604.1_FG019 Xyloglucan fucosyltransferase 0 16 16 250 AC196105.3_FG035 b1,3-glucanase like 0 51 51 62.31 AC204864.2_FG012 Expansin 0 25 25 16.7 AC207722.2_FG007 Peptidoglycan-binding LysM 366 82 0.22 0.49 AC186904.4_FG033 Ubiquitin-conjugating enzyme E3 22 4 0.18 0.37 AC202436.3_FG030 CYP81A 0 21 21 67 AC191413.2_FG016 Auxin response factor 49 8 0.16 0.34 AC203442.2_FG039 ABC transporter 0 18 18 3.2 AC196047.2_FG033 Nitrate-induced NOI, related to nitrate transport 0 36 36 1.78 AC205343.2_FG019 MCM protein 5 8 0 0.13 0.40 AC194119.3_FG024 Sugar transporter 0 16 8.19 4.72 AC204716.3_FG005 DNA cytosine methyltransferase MET2a 13 0 0.07 0.51 AC190984.3_FG038 Proteinase inhibitor I12 0 231 231 166.7 GRMZM2G077244 Proteinase inhibitor I13 0 59 59 150 AC211140.2_FG010 Unknown 55 9 0.16 0.45 AC209357.3_FG031 Unknown 77 16 0.21 0.2 a To avoid division by 0, we used a tag value of 1 for any tag that was not detected in any sample. b Ratio of relative concentrations. Solexa profiles of maize brace roots Y J. Li et al. 160 FEBS Journal 278 (2011) 156–166 ª 2010 The Authors Journal compilation ª 2010 FEBS of the maize brace root, as well as to provide ground- work for investigating their regulating mechanisms. To our knowledge, this is the first report that comprehen- sively shows the transcriptional changes during the onset of brace root branching. We used the Illu- mina ⁄ Solexa DGE system, which is essentially a serial analysis of gene expression-based tag profiling approach. Several previous studies for the plant pri- mary and lateral root transcript profiles using deep sequencing have been reported [25,27–29]. Fizames et al. [25] investigated root transcriptome responses to 2,4,6-trinitrotoluene exposure in Arabidopsis. Poroyko et al. [28] defined the number and abundance of tran- scripts in the root tip of the maize seedlings. In the present study, a sequencing depth of more than five million tags was finally achieved, which was increased by approximately 25-fold compared to maize primary root transcript profiling [28]. Recently, Wang et al. [29] revealed the epigenetic modifications in maize shoots and roots by Solexa sequencing, demonstrating that Solexa sequencing analysis has emerged as an efficient and economical method for sampling transcript P1 P2 P3 P4 XF P1 P2 P3 P4 GRP BA P1 P2 P3 P4 P1 P2 P3 P4 AC209357.3_FG031 P1 P2 P3 P4 P1 P2 P3 P4 P1 P2 P3 P4 P1 P2 P3 P4 PI12 P1 P2 P3 P4 E3 P1 P2 P3 P4 Expansin P1 P2 P3 P4 P1 P2 P3 P4 Chn1 LysM P1 P2 P3 P4 ABC transporter MET P1 P2 P3 P4 NOI CesA P1 P2 P3 P4 AC211140.2_FG010 Endochitinase A P1 P2 P3 P4 P1 P2 P3 P4 ARF Sugar transporter P1 P2 P3 P4 PI13 P1 P2 P3 P4 BGL P1 P2 P3 P4 CYP81A P1 P2 P3 P4 0 5 10 15 20 25 0 0.2 0.4 0.6 0.8 1 1.2 0 0.2 0.4 0.6 0.8 1 1.2 0123456 0 0.2 0.4 0.6 0.8 1 1.2 0 3 6 9 12 15 0 0.5 1 1.5 2 2.5 0 0.3 0.6 0.9 1.2 1.5 0 0.2 0.4 0.6 0.8 1 1.2 0 0.3 0.6 0.9 1.2 1.5 0 0.4 0.8 1.2 1.6 2 0 0.4 0.8 1.2 1.6 2 0 3 6 9 12 15 0 0.3 0.6 0.9 1.2 1.5 00.551.522.53 0 0.4 0.8 1.2 1.6 2 2.4 0 0.2 0.4 0.6 0.8 1 1.2 0 0.2 0.4 0.6 0.8 1 1.2 0 1020304050 0 0.2 0.4 0.6 0.8 1 1.2 MCM Fig. 1. The expression profiles of 20 selected genes in different developmental stages of the maize brace roots. (A) Schematic drawings illustrating different developmental stages of the maize brace root in different phytomers. P1, P2, P3 and P4 represent the first, second, third and fourth phytomer, respectively. (B) Relative expression of the 20 genes detected by qRT-PCR in different phytomers. The transcript levels were normalized to that of elongation factor 1-a, and the level of each gene in the first phytomer (P1) was set at 1.0. Error bars repre- sent the SE for three independent experiments. GRP (glycine-rich cell wall structural protein), endochitinase A, CesA (cellulose synthesis), Chn1 (chitinase chem5), XF (xyloglucan fucosyltransferase), BGL (b1,3-glucanase like), expansin, LysM (peptidoglycan-binding LysM), E3 (ubiquitin-conjugating enzyme E3), CYP 81A (cytochrome P450 81A), ARF (auxin response factor), ABC transporter, NOI (nitrate-induced NOI, correlated to nitrate transport), MCM (MCM protein 5), sugar transporter, MET (DNA cytosine methyltransferase MET2a), PI13 (protein- ase inhibitor I13), PI12 (proteinase inhibitor I12) (Table S1), AC211140.2_FG010, AC209357.3_FG031 (Table S2). Y J. Li et al. Solexa profiles of maize brace roots FEBS Journal 278 (2011) 156–166 ª 2010 The Authors Journal compilation ª 2010 FEBS 161 profiles under specific experimental conditions. Gener- ally, a significant sequencing depth would greatly help to explore clean tags that were detected more than once. In the present study, the clean tags and the sin- gletons accounted for approximately 43% and 57% in the two Solexa libraries. However, a total of 40 599 different tags were sequenced in the maize primary root tissues, of which 63.5% tags were singletons [28]. Furthermore, 84% tags in the wheat grain tissues were singletons [30]. These data suggest that, as the sequenc- ing depth increases, the proportion of clean tags will also increase. A crucial step in deep sequencing studies is the annotation of the tags. In the present study, we gener- ated a 21 bp tag for mapping to the existing tran- scripts data, which is more specific than the 14 or 19 bp tags emploted in previous serial analyses of gene expression [25,27,31]. In total, we could map approxi- mately 85.3% of tags to unique or non-unique posi- tions, which is the same proportion as that described by Wang et al. [29], demonstrating that Illumina⁄ So- lexa sequencing and tag mapping are feasible with great accuracy in large and repeat-rich maize genomes. However, these approaches still suffer limitations in the reference gene databases. In the present study, only 88.3% of reference genes from the maize EST library have the CATG sites, leaving 19 151 genes unanalyzed, which means that a number of the related genes involved in brace root initiation would be neglected. For example, because of the absence of CATG in the EST sequence, we did not detect tags representing the RTCS gene, which was reported to be involved in con- trolling brace root development [15]. Solexa sequencing could provide a comprehensive and unbiased dataset in the global analysis of gene expression. Recently, Zenoni et al. [32] profiled the Table 5. Comparison of the functional categories of the 80 most abundant tags in the maize brace root and primary root tissues. Functional category % maize brace root % maize primary root Translation, ribosome structure 11.3 24 Transcription 6.3 0.8 Chromatin structure 1.3 1.6 Energy production and conversion 3.8 4 Carbohydrate transport and metabolism 8.8 4 Lipid transport and metabolism 3.8 1.6 Cell wall ⁄ membrane ⁄ envelope biogenesis 3.8 0.8 Signal transduction 1.3 0.8 Ion transport 2.9 1.6 Defense mechanisms 1.3 0 Table 6. The common transcripts present in both maize brace root and primary root. Tag Maize root Maize brace root Copy number Abundance (%) Maize EST Tag Copy number Abundance (%) Gene Gene description CATGTGAACCGTAC 55 0.0335 CF636407 CATGTGAACCGTACTGAGTAT 996 0.0174 AC191267.3_FG009 Initiation factor 5A CATGCTGCCATCCG 35 0.0213 CF636691 CATGCTGCCATCCGTGCTGAT 95 0.0017 AC219023.2_FG021 60S ribosomal protein L5 CATGATGACCATCG 28 0.017 CF637384 CATGATGACCATCGTCGACGA 3969 0.0695 AC195599.3_FG034 Elongation factor 1-b, putative CATGGGATCGGTTT 10 0.061 CF634223 CATGGGATCGGTTTGAGTTCC 279 0.0049 AC225796.1_FG024 Ribosomal protein S10 CATGATCAACGAGG 3 0.0018 CF636639 CATGATCAACGAGGTCGATGC 150 0.0026 AC203677.3_FG029 Calmodulin Solexa profiles of maize brace roots Y J. Li et al. 162 FEBS Journal 278 (2011) 156–166 ª 2010 The Authors Journal compilation ª 2010 FEBS patterns of gene expression during plant developmental transition in Vitis vinifera , and a wide range of tran- scriptional responses associated with berry develop- ment were investigated, demonstrating that the plant developmental transition is a complex process that requires the regulation of many transcripts [32,33]. In the present study, 7239 differentially expressed anno- tated and novel transcripts (P < 0.01) were explored. Except for unknown transcripts, the most differentially expressed genes with a log 2 ratio > 2 or < )2(P < 0.001) also participate in various biological pathways, such as cell wall metabolism, signal transduction, envi- ronmental response and transcription regulation. Inter- estingly, many transcripts detected at very low copy numbers in the control library (N) were significantly up-regulated in the NR library (Table S1), implying that these genes might be specifically expressed in brace root tissues. For example, the presence of sugar transporter and potassium uptake channel genes in the NR library rather than the N library indicates that the emerged brace roots begin to take on new functions with respect to ion uptake or nutrient transport. Previous studies have reported the transcript profiles of P. contorta adventitious root development and Ara- bidopsis lateral root development by microarray analy- sis [20,21]. A large number of differentially expressed genes involved in critical pathways during the lateral or adventitious root development were also found in the present study, such as genes participating in cell wall degradation and synthesis, auxin transport and signaling. In Arabidopsis, P450 CYP83A1, CYP83B1, CYP79B2 and CYP79B3 were previously reported to act as key enzymes in the auxin biosynthesis pathway [34,35]. We proposed that the sharp increase of tran- script encoding the P450 CYP81A might be required for auxin biosynthesis during maize brace root pattern- ing, indicating that auxin represents a regulator in both brace root and lateral or adventitious root devel- opment in higher plants [20,23,36,37]. In addition, blocking ethylene responses by etr1 (ethylene triple response1) or ein2 (ethylene insensitive 2) mutation was reported to increase lateral root formation in Ara- bidopsis [38]. We observed that an EIN3 (ethylene- insensitive 3) gene was markedly decreased in the NR library (Table S1), implying that ethylene signaling was also negatively involved in brace root development. In addition, a large number of transcripts involved in wound, pathogen or disease defenses were significantly induced, including proteinase inhibitors, disease resis- tance proteins and pathogenesis-related genes, etc., which is also observed in P. contorta adventitious root development [20]. We thus propose that these tran- scripts might be also induced by the break up of tissues during the emergence of the brace root from the stem node, which in turn contributes to a defensive barrier against extrinsic biotic intrusion. Taken together, some regulating mechanisms appear to be commonly shared with respect to maize brace root and plant lateral or adventitious root formation. Although numerous nomatched or unknown tags were detected, the value of this tag collection will increase as more maize genomic sequences become available. Further functional analysis of the differen- tially expressed genes will provide deeper insight into the regulation of maize brace root development. Materials and methods Plant material and RNA extraction The maize (Zea mays) inbred line H5468 was used in the present study. Seeds of H5468 were surface-sterilized with 3% sodium hypochlorite for 10 min and rinsed in distilled water. Sterilized seeds were pre-germinated on moistened filter papers in a plant growth chamber at 60% humidity and 28 °C, under a 16 : 8 h light ⁄ dark cycle for 3 days. Then, the seedlings were transferred into the field in a greenhouse and cultivated at a mean temperature of 28 °C with both natural light and an additional 16 : 8 h light ⁄ dark cycle. For solexa analysis and qRT-PCR verification, plants were harvested when they are at the V4 (four-leaf stage) or V6 (six-leaf stage) stages (http://www.exten sion.iastate.edu/hancock/info/corn.htm). Each sample was derived from at least five independent plants and the tissues were mixed together. The transverse section of stem node tissues at the first aboveground phytomer (from the bottom to the top) of the V4 stage maize with no brace root initia- tion were harvested as the control (N), and the same loca- tion stem node tissues of the V6 stage where the brace roots just emerge were sampled as NR (i.e. node tissue with just-emerged brace roots). For analysis of the different developmental phases, the transverse sections of the stem node tissues at the first, second, third and fourth above- ground phytomers were harvested from at least five inde- pendent plants of V6 stage. All samples were immediately frozen in liquid nitrogen. Then, total RNA were prepared from 0.1 g tissues and extracted with Trizol Reagent (Invi- trogen, Carlsbad, CA, USA) in accordance with the manu- facturer’s instructions. Tag library construction and sequencing For Solexa tag preparation and sequencing, 1 lg of total RNA was incubated with oligo(dT) beads to capture the mRNA with a poly(A) tail. First- and second-strand cDNA was synthesized and bead-bound cDNA was subsequently digested with NlaIII. The GEX adapters 1 containing a Y J. Li et al. Solexa profiles of maize brace roots FEBS Journal 278 (2011) 156–166 ª 2010 The Authors Journal compilation ª 2010 FEBS 163 restriction site for MmeI were ligated to the free 5¢ ends of the digested bead-bound cDNA fragments. Then, the bead- bond fragments were digested with MmeI, which could cut 17–18 bp downstream of the CATG site (NlaIII site), releasing 21–22 bp tags starting with the NlaIII recognition sequence. A second adaptor (GEX adaptor 2) was ligated at the site of MmeI cleavage, and the adapter-ligated cDNA tags were enriched using PCR primers that anneal to the adaptor ends. The resulting PCR fragments were purified from a 6% acrylamide gel and subjected to the Illu- mina ⁄ Solexa sequencing system (Illumina Inc., San Diego, CA, USA) using a sequencing-by-synthesis method in accordance with the manufacturer’s instructions. Tag-to-gene assignment and functional categorization Sequencing quality evaluation and data summarization were performed using Illumina ⁄ Solexa pipeline software after sequencing. For tag-to-gene assignment, soap (Short Oligo- nucleotide Alignment Program) was used, allowing no more than one base mismatch [39]. The schematic overview of the procedure is given in Fig. S3. Reference ESTs or cDNA sequences represented by bacteria artificial chromosomes were obtained from the MaizeSequence database, release 3b.50 (http://maizesequence.org/index.html). The experimen- tal tags were first filtered to eliminate unauthentic ones and to leave the clean tags for mapping to the reference tags derived from cDNA or EST sequences, and the unmatched ones were then blasted against the maize genome sequences. For those sequenced tags, their expressional abundances in each library were shown by copy numbers in the library. For differential expression analysis, the fold changes were assessed by the log 2 ratio (TPM-NR ⁄ TPM-N) after the expressional abundances in each library were normalized to transcript per million (TPM), which is accordance with the study of Audic and Claverie [40]. After tag-to-gene assign- ment, genes were grouped into functional categories based on the MIPS Functional Catalogue Database (http://mips. gsf.de), which was developed for the functional description of proteins. The presence of identified functional domains by blastx search in the examined sequence was accepted for the assignment of functions. A criterion of sequence similarity E-value < 1 · 10 )5 was used for the significant hits. Func- tional categorization was carried out in the same way and included a blast search against the Arabidopsis protein database at TAIR (http://www.arabidopsis.org/index.jsp) and the rice protein database (http://www.tigr.org/). The search results were linked to the MIPS Functional Catalogue Database for further functional categorization. Real-time PCR Reverse transcription reactions were performed using 5 lg of RNA by M-MLV reverse transcriptase (Takara Bio Inc., Otsu, Japan) in accordance with the manufacturer’s instruc- tions after incubation with RNase-free DNase I. For real- time PCR, selected gene sequences were obtained from the MaizeSequence database. Primers were designed using bea- con designer 7.0 software (Premier Biosoft International, Palo Alto, CA, USA). Elongation factor 1-a was used as the inner control. The PCR primers are shown in Table S4. Real-time PCR reactions were performed with a Bio-Rad real-time thermal cycling system (Bio-Rad, Hercules, CA, USA) using SYBR-Green to detect gene expression abun- dances. The reaction mixture (25 lL) contained 0.5 lm of each primer and the appropriate amounts of enzymes, cDNA and fluorescent dyes. All runs used a negative con- trol without adding target cDNA, resulting in no detectable fluorescence signal from the reaction. A range of five dilu- tions of the total cDNA was tested under the same condi- tions as the samples. Amplification reactions were initiated with a pre-denaturing step at 95 °C for 10 s and followed by denaturing (95 °C for 5 s), annealing (60 °C for 10 s) and extension (72 °C for 15 s) steps for 49 cycles during the second stage, and a final stage of 55 °Cto95°C to deter- mine dissociation curves of the amplified products. All reac- tions were performed with at least three replicates. Data were analyzed using Bio-Rad cfx manager software. Acknowledgements This work was supported by the National Natural Science Foundation (grant numbers 30970225 and 30970230) and the Genetically modified organisms breeding major projects (2009ZX08009-092B) in China. References 1 Hochholdinger F, Park WJ, Sauer M & Woll K (2004a) From weeds to crops: genetic analysis of root develop- ment in cereals. Trends Plant Sci 9, 42–48. 2 Hochholdinger F, Woll K, Sauer M & Dembinsky D (2004b) Genetic dissection of root formation in maize (Zea mays) reveals root-type specific developmental pro- grammes. Ann Bot 93, 359–368. 3 Varney GTMM (1991) The branch roots of Zea. II. Developmental loss of the apical meristem in field- grown roots. New Phytol 118, 535–546. 4 Varney GTCM (1993) Rates of water uptake into the mature root system of maize plants. New Phytol 123, 775–786. 5 Wang XLMM & Canny MJ (1994) The branch roots of Zea. IV. The maturation and openness of xylem con- duits in first-order branches of soil-grown roots. New Phytol 126, 21–29. 6 Hochholdinger F & Tuberosa R (2009) Genetic and genomic dissection of maize root development and architecture. Curr Opin Plant Biol 12, 172–177. Solexa profiles of maize brace roots Y J. Li et al. 164 FEBS Journal 278 (2011) 156–166 ª 2010 The Authors Journal compilation ª 2010 FEBS 7 Hoppe DC, McCully ME & Wenzel CL (1986) The nodal roots of Zea: their development in relation to structural features of the stem. Can J Bot 64, 2524– 2537. 8 Demotes-Mainard S & Pellerin S (1992) Effect of mutual shading on the emergence of nodal roots and the root ⁄ shoot ratio of maize. Plant Soil 147, 87–93. 9 Pellerin S (1994) Number of maize nodal roots as affected by plant density and nitrogen fertilization: relationships with shoot growth. Eur J Agron 3, 101–110. 10 Sylvain Pellerin AM & Daniel Ple¢net (2000) Phosphorus deficiency affects the rate of emergence and number of maize adventitious nodal roots. Agronomy 92, 690–697. 11 Kaspar ALTaTC (1995) Maize nodal root response to soil ridging and three tillage systems. Agron J 87, 853– 858. 12 Kaspar ALTaTC (1997) Maize nodal root response to time of soil ridging. Agron J 89, 195–200. 13 Hochholdinger F & Zimmermann R (2008) Conserved and diverse mechanisms in root development. Curr Opin Plant Biol 11, 70–74. 14 Paszkowski U & Boller T (2002) The growth defect of lrt1, a maize mutant lacking lateral roots, can be complemented by symbiotic fungi or high phosphate nutrition. Planta 214, 584–590. 15 Taramino G, Sauer M, Stauffer JL Jr, Multani D, Niu X, Sakai H & Hochholdinger F (2007) The maize (Zea mays L.) RTCS gene encodes a LOB domain pro- tein that is a key regulator of embryonic seminal and post-embryonic shoot-borne root initiation. Plant J 50, 649–659. 16 Hochholdinger F, Park WJ & Feix GH (2001) Coopera- tive action of SLR1 and SLR2 is required for lateral root-specific cell elongation in maize. Plant Physiol 125, 1529–1539. 17 Zimmermann R, Sakai H & Hochholdinger F (2010) The gibberellic acid stimulated-like gene family in maize and its role in lateral root development. Plant Physiol 152, 356–365. 18 Woll K, Borsuk LA, Stransky H, Nettleton D, Schnable PS & Hochholdinger F (2005) Isolation, characteriza- tion, and pericycle-specific transcriptome analyses of the novel maize lateral and seminal root initiation mutant rum1. Plant Physiol 139, 1255–1267. 19 Wen TJ, Hochholdinger F, Sauer M, Bruce W & Sch- nable PS (2005) The roothairless1 gene of maize encodes a homolog of sec3, which is involved in polar exocytosis. Plant Physiol 138, 1637–1643. 20 Brinker M, van Zyl L, Liu W, Craig D, Sederoff RR, Clapham DH & von Arnold S (2004) Microarray analyses of gene expression during adventitious root development in Pinus contorta. Plant Physiol 135, 1526– 1539. 21 Himanen K, Vuylsteke M, Vanneste S, Vercruysse S, Boucheron E, Alard P, Chriqui D, Van Montagu M, Inze D & Beeckman T (2004) Transcript profiling of early lateral root initiation. Proc Natl Acad Sci USA 101, 5146–5151. 22 Inukai Y, Sakamoto T, Ueguchi-Tanaka M, Shibata Y, Gomi K, Umemura I, Hasegawa Y, Ashikari M, Kit- ano H & Matsuoka M (2005) Crown rootless1, which is essential for crown root formation in rice, is a target of an AUXIN RESPONSE FACTOR in auxin signaling. Plant Cell 17, 1387–1396. 23 Peret B, Larrieu A & Bennett MJ (2009) Lateral root emergence: a difficult birth. J Exp Bot 60 , 3637– 3643. 24 Morozova O & Marra MA (2008) Applications of next-generation sequencing technologies in functional genomics. Genomics 92, 255–264. 25 Fizames C, Munos S, Cazettes C, Nacry P, Boucherez J, Gaymard F, Piquemal D, Delorme V, Commes T, Doumas P et al. (2004) The Arabidopsis root transcrip- tome by serial analysis of gene expression. Plant Physiol 134, 67–80. 26 Marchant A, Bhalerao R, Casimiro I, Eklof J, Casero PJ, Bennett M & Sandberg G (2002) AUX1 promotes lateral root formation by facilitating indole-3-acetic acid distribution between sink and source tissues in the Arabidopsis seedling. Plant Cell 14, 589–597. 27 Ekman DR, Lorenz WW, Przybyla AE, Wolfe NL & Dean JF (2003) SAGE analysis of transcriptome responses in Arabidopsis roots exposed to 2,4,6-trinitro- toluene. Plant Physiol 133 , 1397–1406. 28 Poroyko V, Hejlek LG, Spollen WG, Springer GK, Nguyen HT, Sharp RE & Bohnert HJ (2005) The maize root transcriptome by serial analysis of gene expression. Plant Physiol 138, 1700–1710. 29 Wang X, Elling AA, Li X, Li N, Peng Z, He G, Sun H, Qi Y, Liu XS & Deng XW (2009) Genome-wide and organ-specific landscapes of epigenetic modifications and their relationships to mRNA and small RNA tran- scriptomes in maize. Plant Cell 21, 1053–1069. 30 Poole RL, Barker GL, Werner K, Biggi GF, Coghill J, Gibbings JG, Berry S, Dunwell JM & Edwards KJ (2008) Analysis of wheat SAGE tags reveals evidence for widespread antisense transcription. BMC Genomics 9, 475. 31 Byun YJ, Kim HJ & Lee DH (2009) LongSAGE analy- sis of the early response to cold stress in Arabidopsis leaf. Planta 229, 1181–1200. 32 Zenoni S, Ferrarini A, Giacomelli E, Xumerle L, Fasoli M, Malerba G, Bellin D, Pezzotti M & Delledonne M (2010) Characterization of transcriptional complexity during berry development in Vitis vinifera using RNA- Seq. Plant Physiol 152, 1787–1795. 33 Willenbrock H, Salomon J, Sokilde R, Barken KB, Hansen TN, Nielsen FC, Moller S & Litman T (2009) Y J. Li et al. Solexa profiles of maize brace roots FEBS Journal 278 (2011) 156–166 ª 2010 The Authors Journal compilation ª 2010 FEBS 165 [...]... transcripts with log2 ratio > 8 or < )8 Table S3 The 80 most abundant transcripts in the maize brace root tissues Table S4 Primers used the in the real-time PCR analysis This supplementary material can be found in the online version of this article Please note: As a service to our authors and readers, this journal provides supporting information supplied by the authors Such materials are peer-reviewed... of the distinct tag copy number between N and NR libraries Fig S2 Scatter plots of expressed tags and genes evaluated by a significant value (P < 0.01) between the two libraries Fig S3 Schematic overview of the procedure for sequenced tags to reference genes or genome assignment Table S1 Differentially expressed genes involved in the brace root development Table S2 Differentially regulated unknown transcripts.. .Solexa profiles of maize brace roots 34 35 36 37 38 39 40 166 Y.-J Li et al Quantitative miRNA expression analysis: comparing microarrays with next-generation sequencing RNA 15, 2028–2034 Bak S, Tax FE, Feldmann KA, Galbraith DW & Feyereisen R (2001) CYP83B1, a cytochrome P450 at the metabolic branch point in auxin and indole glucosinolate biosynthesis in Arabidopsis Plant... root initiation and emergence in Arabidopsis thaliana Plant J 55, 335–347 Li RQ, Li YR, Kristiansen K & Wang J (2008) SOAP: short oligonucleotide alignment program Bioinformatics 24, 713–714 Audic S & Claverie JM (1997) The significance of digital gene expression profiles Genome Res 7, 986–995 Supporting information The following supplementary material is available: Fig S1 Distribution of the ratio of. .. Celenza JL (2002) Trp-dependent auxin biosynthesis in Arabidopsis: involvement of cytochrome P450s CYP79B2 and CYP79B3 Gene Dev 16, 3100–3112 Fukaki H, Okushima Y & Tasaka M (2007) Auxinmediated lateral root formation inhigher plants Int Rev Cytol 256, 111–137 Vieten A, Sauer M, Brewer PB & Friml J (2007) Molecular and cellular aspects of auxin-transport-mediated development Trends Plant Sci 12, 160–168... peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset Technical support issues arising from supporting information (other than missing files) should be addressed to the authors FEBS Journal 278 (2011) 156–166 ª 2010 The Authors Journal compilation ª 2010 FEBS . Transcript profiling during the early development of the maize brace root via Solexa sequencing Yan-Jie Li*, Ya-Ru Fu*,. complexity of transcriptome can be studied. In the present study, an overall impression of gene profiles during the early development of the maize brace root