Báo cáo khoa học: Deciphering the key residues in Plasmodium falciparum b-ketoacyl acyl carrier protein reductase responsible for interactions with Plasmodium falciparum acyl carrier protein pptx

Deciphering the key residues in Plasmodium falciparum b-ketoacyl acyl carrier protein reductase responsible for interactions with Plasmodium falciparum acyl carrier protein Krishanpal Karmodiya, Rahul Modak, Nirakar Sahoo, Syed Sajad and Namita Surolia Molecular Biology and Genetics Unit, Jawaharlal Nehru Centre for Advanced Scientific Research, Jakkur, Bangalore, India Keywords fatty acid synthase; fluorescence; malaria; protein–protein interactions; surface plasmon resonance Correspondence N Surolia, Molecular Biology and Genetics Unit, Jawaharlal Nehru Centre for Advanced Scientific Research, Jakkur, Bangalore 560064, India Fax: +91 80 22082766 Tel: +91 80 22082820-21 E-mail: surolia@jncasr.ac.in (Received 14 June 2008, revised 23 July 2008, accepted 25 July 2008) doi:10.1111/j.1742-4658.2008.06608.x The type II fatty acid synthase (FAS) pathway of Plasmodium falciparum is a validated unique target for developing novel antimalarials, due to its intrinsic differences from the type I pathway operating in humans b-Ketoacyl acyl carrier protein (ACP) reductase (FabG) performs the NADPH-dependent reduction of b-ketoacyl-ACP to b-hydroxyacyl-ACP, the first reductive step in the elongation cycle of fatty acid biosynthesis In this article, we report intensive studies on the direct interactions of Plasmodium FabG and Plasmodium ACP in solution, in the presence and absence of its cofactor, NADPH, by monitoring the change in intrinsic fluorescence of P falciparum FabG (PfFabG) and by surface plasmon resonance To address the issue of the importance of the residues involved in strong, specific and stoichiometric binding of PfFabG to P falciparum ACP (PfACP), we mutated Arg187, Arg190 and Arg230 of PfFabG The activities of the mutants were assessed using both an ACP-dependent and an ACP-independent assay The affinities of all the PfFabG mutants for acetoacetyl-ACP (the physiological substrate) were reduced to different extents as compared to wild-type PfFabG, but were equally active in biochemical assays with the substrate analog acetoacetyl-CoA Kinetic analysis and studies of direct binding between PfFabG and PfACP confirmed the identification of Arg187 and Arg230 as critical residues for the PfFabG–PfACP interactions Our studies thus reveal the significance of the positively charged ⁄ hydrophobic patch located adjacent to the active site cavities of PfFabG for interactions with PfACP The human malaria-causing parasite Plasmodium falciparum harbors the type II fatty acid synthase (FAS) [1,2], which is essential for its sustenance and survival In contrast to the multifunctional FAS enzyme in the type I pathway operating in humans [3], the type II FAS system has discrete enzymes for each step of the pathway Type II FAS in P falciparum is one of the pathways specific to its ‘plastid’ and has been validated as a unique target for developing new antimalarials [4–8] During the elongation cycle of type II FAS, the growing acyl chain, i.e butyryl–acyl carrier protein (ACP), is elongated successively in each round by two carbon units by the action of four enzymes acting consecutively First, b-ketoacyl ACP synthase (either FabB or FabF) elongates the acyl-ACP of the Cn acyl chain Abbreviations ACP, acyl carrier protein; FabG, b-ketoacyl acyl carrier protein reductase; FAS, fatty acid synthase; PfACP, Plasmodium falciparum acyl carrier protein; PfFabG, Plasmodium falciparum b-ketoacyl acyl carrier protein reductase; SPR, surface plasmon resonance 4756 FEBS Journal 275 (2008) 4756–4766 ª 2008 The Authors Journal compilation ª 2008 FEBS K Karmodiya et al to a Cn + 2, b-ketoacyl form The b-ketoacyl-ACP thus formed is reduced to b-hydroxyacyl-ACP by an NADPH-dependent b-ketoacyl ACP reductase (FabG) The b-hydroxyacyl group is then dehydrated to an enoyl-ACP by a b-hydroxyacyl ACP dehydratase (FabZ or FabA) Reduction of the enoyl group by an enoyl ACP reductase (FabI, FabK or FabL) finally produces Cn + acyl-ACP, which can either re-enter the elongation cycle, or be hydrolyzed to ACO and the acyl moiety for the synthesis of phospholipids or sphingolipids, or become diverted for other modifications [9] All of the enzymes participating in type II FAS interact, but not much is known about the residues involved in interactions Plasmodium falciparum ACP (PfACP) is a small protein, with a flexible conformation, which shuttles the substrates between the enzymes of the pathway PfACP is a nuclear-encoded and plastid-targeted protein of 137 amino acids that includes leader and transit sequences Mature PfACP consists of 79 amino acids (residues 58–137) with a preponderance of acidic residues [10] Two-dimensional NMR [11] has revealed that PfACP has a defined but flexible tertiary structure dominated by four a-helices located at residues 4–15 (helix I), 37–51 (helix II), 57–61 (helix II¢) and 66–74 (helix III), all connected by loops with a long structured turn between helix I and helix II The unusually mobile structure of ACP can be best represented as a dynamic equilibrium between two conformers Highly mobile portions of PfACP include the loop regions and helix II FabG is highly conserved across species, and is the only known isoform that functions as a ketoacyl reductase in the type II FAS system Recently, the crystal structure of P falciparum FabG (PfFabG) has been solved [12], and suggests that the interactions of PfFabG with the 4¢-phosphopantetheine moiety of PfACP are hydrophobic in nature Plasmodium FabG with a lone tryptophan provides an ideal system with which to study ligand-induced conformational changes by monitoring the change in its intrinsic fluorescence In these studies, we have investigated the interactions between PfFabG and PfACP using a combination of computational, biochemical and biophysical methods We have been able to identify specific surface features on PfFabG that are critical for these interactions In PfFabG, Arg187 and Arg230 are located in a hydrophobic patch adjacent to the active site entrance of PfFabG, whereas Arg190 is located away from the active site Hence, to characterize the role played by these residues in the interactions of PfFabG and PfACP, we generated the following mutants: R187E, R230E, R187A ⁄ R230A, R187E ⁄ R230E, R190E, Interactions of PfFabG with PfACP R190A and R230K We also generated R187K, as this is conservatively substituted throughout the apicomplexan group (present as Lys187 in other species of Plasmodium) In the type II FAS pathway, the growing acyl intermediates are attached to the terminal sulfhydryl of the 4¢-phosphopentatheine prosthetic group [13], which is attached via a phosphodiester linkage to the Ser37 located at the beginning of helix II The primary gene product is an apoprotein that is converted to holo-ACP (ACP) by the transfer of the 4¢-phosphopentatheine moiety of CoA to Ser37 by holo-ACP synthase ACP performs two functions: first, it sequesters the growing acyl chain from the aqueous environment; and second, upon binding to one of the type II FAS proteins, it releases its grip on the fatty acid, which is inserted into the active site of the enzyme ACPs from various natural sources share significant primary sequence similarity, particularly at the prosthetic group attachment site, extending to helix II However, the individual ACP-binding partners not share any common ACP-binding motif The molecular details that govern the specific interactions between Plasmodium ACP and type II FAS enzymes are poorly understood Here, we report subtle aspects of the interactions between PfFabG and PfACP, with emphasis on association constants and number of binding sites with reference to the cofactor NADPH The site-directed mutagenesis studies reveal that both electrostatic and hydrophobic interactions play important roles in PfFabG–PfACP complex formation Results Identification of residues putatively involved in the PfFabG–PfACP interaction Multiple sequence alignment indicates that the FabG sequences from different species, including plants and bacteria, share a high degree of sequence identity (Fig 1A) The crystal structures of FabG enzymes from Escherichia coli [14], Brassica napus [15] and P falciparum [12] are also homologous, and show FabG to be a tetramer consisting of two homodimers of monomers arranged in a head-to-tail configuration The crystal structure of FabG from E coli shows that there is a conserved positively charged patch on its surface [14,16] This positively charged patch is positioned at the entrance of the active site and is involved in recognition of the highly conserved and negatively charged a2 helix of ACP This patch is identical in E coli FabG, Plasmodium FabG and counterparts FEBS Journal 275 (2008) 4756–4766 ª 2008 The Authors Journal compilation ª 2008 FEBS 4757 Interactions of PfFabG with PfACP K Karmodiya et al A B C Fig Multiple sequence alignment of FabG sequences: (A) P falciparum (P falc) (accession number PFI1125c), Bacillus subtilis (B subt) (accession number AAC44307), Cuphea lanceolata (C lanc) (accession number P28643), B napus (accession number CAC41363), and E coli (accession number NP_415611) (B) P falciparum (P falc) (accession number PFI1125c), Plasmodium berghei (P ber) (accession number PB000052.00.0) and Plasmodium chabaudi (P cha) (accession number PC000242.01.0) *Residues thought to be involved in the FabG–ACP interaction Color scheme: conserved residues blocked in gray, negatively charged residues in red characters, positively charged residues in blue characters, aliphatic residues blocked in yellow, and aromatic residues in green (C) Electrostatic potential surface of the Plasmodium FabG adjacent to the active site entrance Red indicates negative charge, blue indicates positive charge, and white is hydrophobic Arg187 and Arg230 are located adjacent to the active site entrance from plants Mutagenesis of E coli FabG showed that two arginine residues (Arg29 and Arg172) present in this patch are central to the binding of ACP [16] 4758 Multiple sequence alignment of FabG sequences from different species shows that these residues are conserved in PfFabG too (Arg187 and Arg230, FEBS Journal 275 (2008) 4756–4766 ª 2008 The Authors Journal compilation ª 2008 FEBS K Karmodiya et al Interactions of PfFabG with PfACP respectively) (Fig 1A) Three residues of PfFabG selected for the mutagenesis studies, namely Arg187, Agr190 and Arg230, were highly conserved in all species of Plasmodium Analysis of the Plasmodium FabG crystal structure shows that the conserved residues Arg187 and Arg230 are located at the surface, near its active site entrance (Fig 1C) We replaced the positively charged arginines with glutamates to introduce electrostatic repulsion between PfFabG and PfACP and to test whether PfACP associates with PfFabG over the entire predicted surface We also changed these positively charged residues to alanines to determine which of the electrostatic interactions are important for promoting the binding to PfACP Interestingly, within the Plasmodium genus, Arg187 is substituted (Fig 1B) with a lysine 200 gel filtration column [17] The PfFabG mutants were also eluted at the retention volume of their wild-type counterpart The elution positions of the wild-type and mutants of PfFabG corresponded to a relative molecular mass of 110 kDa (± 10 kDa), indicating that the enzymes are homotetramers and that the mutations did not alter the overall shape or the quaternary structure of PfFabG CD spectroscopy was used to investigate potential perturbations in the secondary and tertiary structure of PfFabG mutants CD spectra of wild-type PfFabG and the PfFabG mutants were superimposable (Fig S1), suggesting that the relative contents of a-helical and b-sheet secondary structure in the PfFabG mutants are not changed as a result of the individual point mutations Kinetic analyses of the PfFabG mutants Expression and purification of PfFabG, PfFabG mutants and PfACP The recombinant wild-type PfFabG, its mutants and PfACP were purified to homogeneity using an Ni2+– nitrilotriacetic acid affinity column as previously described [17,18] Figure shows the apparent electrophoretic homogeneity of the purified proteins The purified proteins on SDS ⁄ PAGE yielded a monomeric Mr of 31 000 ± 1000 for PfFabG as well as for PfFabG mutants Gel filtration and CD analyses of the mutants Changes in the overall shape or the quaternary structure of the molecule, potentially introduced by mutagenesis, were first probed using size exclusion chromatography Wild-type PfFabG was eluted as a single peak at a volume of 13.67 mL on a Superdex- kDa 45 In order to evaluate the effects of the mutations on the specific activity of PfFabG, we used an ACP-independent spectrophotometric assay, where acetoacetyl-CoA was used as a substrate in place of acetoacetyl-ACP, and the disappearance of NADPH was monitored at 340 nm As can be seen in Table 1, the kinetic constants (Km and ACP-independent specific activities) of the R187A, R187E, R230A, R230E, R187A ⁄ R230A and R187E ⁄ R230E mutants remained largely unchanged with respect to wild-type PfFabG Wildtype PfFabG shows less activity with acetoacetyl-CoA than with acetoacetyl-ACP All the mutants exhibited very poor activity in the ACP-dependent spectroscopic assay, but not in the ACP-independent spectroscopic assay, which shows that PfFabG mutants are selectively compromised for utilization of the acyl-ACP substrate (acetoacetyl-ACP) The R230E and R187E ⁄ R230E mutants had higher Km values of Table Specific activity of wild-type PfFabG and the PfACP binding site mutants in ACP-dependent and ACP-independent spectroscopic assays Enzyme activity was monitored spectrophotometrically at 340 nm as described in Experimental procedures Values in brace are presented as percentages 35 25 Fig Purification of PfFabG mutants by Ni2 + –nitrilotriacetic acid chromatography SDS ⁄ PAGE of recombinant PfFabG and PfFabG mutants Lane 1: purified wild-type PfFabG Lane 2: protein molecular weight markers (MBI Fermentas) Lane 3: R187A Lane 4: R187E Lane 5: R230A Lane 6: R230E Lane 7: R187A ⁄ R230A Lane 8: R187E ⁄ R230E PfFabG Km (mM) AcAcCoA Specific activity ACP-independent spectroscopic assay (mg)1) Wild-type R187A R187E R230A R230E R187A ⁄ R230A R187E ⁄ R230E 0.43 0.45 0.47 0.44 0.49 0.47 0.58 59.8 57.9 54.5 55.3 54.2 45.6 42.6 FEBS Journal 275 (2008) 4756–4766 ª 2008 The Authors Journal compilation ª 2008 FEBS Specific activity ACP-dependent spectroscopic assay (mg)1) 70.6 6.9 6.3 6.1 4.0 3.0 2.0 (100) (9.77) (8.92) (8.64) (5.66) (4.24) (2.83) 4759 Interactions of PfFabG with PfACP K Karmodiya et al Table Binding constants (Ka) for interaction of wild-type PfACP with mutant PfFabG, in the absence and in the presence of reduced cofactor NADPH at 20 °C, obtained using the changes in protein fluorescence intensity at 334 nm and SPR Experimental details are provided in Experimental procedures n, number of binding sites for the best value of r2; Ka, association constant for the best value of r2, determined using protein fluorescence (334 nm); ND, not determined Percent activity 120 90 60 30 Serial no 0 40 80 ACP conc (µM) 120 160 Fig Inhibition of PfFabG activity by PfACP The ability of PfACP to function as an inhibitor of the condensing enzyme reaction was evaluated using the spectrophotometric assay utilizing acetoacetylCoA as described in Experimental procedures with lg of PfFabG (d) or lg of the mutants R230E (.), R187E ⁄ R230E (Ñ) and R187A ⁄ R230A (s) The activities of the mutant enzymes were not significantly affected by the addition of PfACP, suggesting that the mutation reduced PfACP binding to PfFabG 0.49 mm and 0.57 mm, respectively, than wild-type PfFabG for acetoacetyl-CoA (0.43 mm) [17] Moreover, the point mutation R187K gives similar results to those for wild-type PfFabG The ACP-dependent activity assay clearly showed the involvement of the two surface arginine residues of PfFabG in the interaction with PfACP In order to determine the ability of PfACP to function as the inhibitor, we used a spectrophotometric assay, utilizing acetoacetyl-CoA, with the indicated concentrations of PfACP As can be seen in Fig 3, wild-type PfFabG showed inhibition with increasing concentrations of PfACP, whereas no inhibition with the R187E, R230E, R187A and R230A mutants was observed The effect was more deleterious when arginine was changed to glutamate than when it was changed to the neutral residue alanine (Table 2) Interaction of PfFabG mutants with wild-type PfACP monitored by measuring intrinsic PfFabG fluorescence The intrinsic fluorescence of PfFabG decreased when it was titrated with increasing concentrations of PfACP As reported earlier [17], binding of PfACP to PfFabG, as analyzed by quenching of its fluorescence at 334 nm, gave an association constant of 400 nm)1 with n = The value of Ka was determined for other mutants using nonlinear least squares fit of the data, using the Adair equation with one to four 4760 10 11 12 13 14 15 16 Sample Titrated with: Fluorescence n Ka (nM)1) SPR analysis Ka (nM)1) Wild-type R187A R187E R230A R230E R187A ⁄ R230A R187E ⁄ R230E R187K PfFabG-NADPH R187A-NADPH R187E-NADPH R230A-NADPH R230E-NADPH R187A ⁄ R230A-NADPH R187E ⁄ R230E-NADPH R187K-NADPH PfACP PfACP PfACP PfACP PfACP PfACP PfACP PfACP PfACP PfACP PfACP PfACP PfACP PfACP PfACP PfACP 1 1 1 1 1 1 1 350 ND ND 42 23 ND ND ND 1100 ND ND 130 160 ND ND ND 400.0 150.2 93.4 82.8 9.7 79.2 5.0 390 1100.0 350.1 270.6 210.0 110.4 205.3 92.3 992.5 equivalent and independent, as well as equivalent and interdependent, binding sites (n) The Ka values for binding of the R187A and R230A mutants were, respectively, 150 and 82 nm)1 Thus, mutation of Arg187 and Arg230 to alanine decreased the binding affinities by three-fold and five-fold respectively The Ka values for the binding decreased even more dramatically to 93 and nm)1, respectively, in the R187E and R230E mutants Apparently, mutation of Arg187 and Arg230 to an acidic residue, glutamate, diminishes the strength of the PfACP–PfFabG interaction in a relatively more significant manner than their replacement by a neutral alanine residue The effect was more drastic when both the residues were converted to glutamate, there being an 80-fold reduction in association constant (Table 2) The data shown here are in close agreement with those from the ACP-dependent assay The affinity of wild-type PfACP increased three-fold (Ka = 1.10 lm)1) in the presence of NADPH, and the number of binding sites increased from one to two, whereas in all PfFabG mutants examined except R187K, the number of binding sites remained the same, with decreased binding of the PfFabG mutants to PfACP in the presence of NADPH (Table 2) The maximum effect was observed on binding of the R230E mutant and the double mutant R187E ⁄ R230E, FEBS Journal 275 (2008) 4756–4766 ª 2008 The Authors Journal compilation ª 2008 FEBS K Karmodiya et al with association constants of 110.4 and 92 nm)1, respectively Interactions of PfFabG with PfACP A 100 The PfFabG–PfACP interaction data were further verified by direct measurement of binding of these two proteins by SPR (BIAcore) Wild-type PfFabG and its mutants were immobilized on the nitrilotriacetic acid sensor chip surface, following the manufacturer’s protocol [19] Approximately 330–350 resonance units (RU) of His-tagged PfFabG was immobilized in each channel of the sensor chip A continuous flow of buffer was maintained on the chip surface until a stable baseline was reached All of the binding studies were conducted at 20 °C Various concentrations of His-tag cleaved PfACP (ranging from to 200 lm) were passed over the surface of the chip The PfFabG immobilized surface devoid of the PfACP from a previous reaction could be regenerated by passing the buffer alone A typical sensorgram for the binding of varying concentrations of PfACP to immobilized PfFabG is shown in Fig 4A The occurrence of an enhancement in the RUs is indicative of the increase in mass on the chip surface, which indicates binding As shown in Fig 4B, wild-type PfFabG showed strong binding, whereas the R230E and R187A ⁄ R230A mutants did not show any significant binding at similar PfACP concentrations The apparent binding and association constants are shown in Table There was a three-fold enhancement in PfACP binding to wild-type PfFabG in the presence of NADPH PfACP binding to the mutant PfFabGs was also enhanced in the presence of NADPH There was a three-fold to 100-fold decrease in the affinity of binding of mutant PfFabGs to PfACP as compared to wild-type PfFabG (Table 2) The apparent binding constants determined by fluorescence quenching and SPR experiments for PfFabG and PfACP are essentially similar Fluorescence quenching corroborated with SPR experiments shows the involvement of these residues in the PfFabG–PfACP interaction Allosteric binding of NADPH to PfFabG mutants in the presence of PfACP The Ka value for the binding of NADPH to PfFabG, with n = 4, was found to be 40.90 lm)1, and the binding exhibited negative, homotropic cooperativity (with a Hill constant of nH = 0.8) [17] The association constant was nearly equal for all of the PfFabG mutants, 60 40 20 20 B Relative binding (RU) Interaction of the PfFabG mutants with wild-type PfACP monitored by surface plasmon resonance (SPR) Response (RU) 80 60 100 140 180 Time (s) 220 260 [ACP] µM vs FabG WT [ACP] µM vs R230E [ACP] µM vs R187A R230A 60 40 20 50 100 [ACP] µM 150 200 Fig (A) Sensorgram depicting the binding of PfACP to wild-type PfFabG Varying concentrations of PfACP (5, 10, 20, 50, 100 and 200 lM) in 10 mM Hepes buffer, containing 150 mM NaCl and 50 lM EDTA (pH 7.4), were passed over the immobilized PfFabG at a flow rate of 20 lLỈmin)1 The dissociation was studied subsequently by passing the same buffer at a flow rate of 20 lLỈmin)1 (B) Direct binding between PfFabG and PfACP measured by BIAcore The binding results with the fluorescence assay were confirmed with the SPR approach (BIAcore) described in Experimental procedures Wild-type PfFabG and mutants were immobilized on a nitrilotriacetic acid chip, and wild-type PfACP protein solutions were pumped across the surface Wild-type PfFabG (solid line and solid circles) exhibited a strong binding signal, whereas neither the R230E mutant (dashed line and inverted triangle) nor the R187A ⁄ R230A mutant (dotted line and open circle) exhibited significant binding to the PfACP chip at similar protein concentrations suggesting that there was no effect of point mutations on the NADPH binding (data not shown) Furthermore, the affinity (Ka) of PfFabG for its cofactor NADPH determined by fluorescence spectroscopy in the presence of 20 lm PfACP was found to be 48.36 lm)1 and n = Thus, whereas the number of cofactor-binding sites decreased in the presence of PfACP, the affinity of PfFabG for NADPH increased, indicating a negative, heterotropic cooperative effect of PfACP upon binding of NADPH This effect of FEBS Journal 275 (2008) 4756–4766 ª 2008 The Authors Journal compilation ª 2008 FEBS 4761 Interactions of PfFabG with PfACP K Karmodiya et al Table Binding constants (Ka) of reduced cofactor NADPH for PfFabG mutants in the presence of PfACP at 20 °C, using the changes in protein fluorescence intensity at 334 nm Experimental details are provided in Experimental procedures n, number of binding sites for the best value of r2; Ka, association constant for the best value of r2, determined using protein fluorescence (334 nm) Serial no Sample Titrated with: n Ka (lM)1) PfFabG-PfACP R187A-PfACP R187E-PfACP R230A-PfACP R230E-PfACP R187A ⁄ R230A-PfACP R187E ⁄ R230E-PfACP NADPH NADPH NADPH NADPH NADPH NADPH NADPH 4 4 4 48.3 42.2 41.9 40.9 38.9 33.5 32.1 PfACP was not observed with different PfFabG mutants, as there was no increase in the affinity (Ka) and also the number of NADPH-binding sites remained at four, corresponding to the number of subunits (Table 3) Discussion Our site-directed mutagenesis, kinetic analysis and binding studies provide evidence that Arg187 and Arg230 of PfFabG are involved in the interaction with PfACP These studies demonstrate that the highly conserved second a-helix of PfACP recognizes electropositive residues on the surface of PfFabG Whereas the consequences of mutating the corresponding residues in E coli FabG involved in the binding of E coli ACP have been investigated earlier, the number of binding sites and ACP-induced cooperativity for the interactions of the cofactor NADPH for these mutants have been characterized for the first time in studies reported here for Plasmodium FabG We have used ACP-dependent and ACP-independent spectrophotometric assays and a fluorescence assay to estimate the association constants and number of binding sites of different mutants of PfFabG and PfACP, as well as the interactions in the presence of the cofactor NADPH Studies with E coli FabG have identified a conserved, positively charged patch on its surface [14,16] The surface of FabG surrounding the active site tunnel is electropositive This positively charged patch is positioned at the entrance of the active site and is thought to be involved in the recognition of the highly conserved, negatively charged a2 helix of PfACP PfFabG would therefore be expected to also contain a positively charged region at the active site entrance capable of interacting with the negatively charged region of 4762 PfACP The sequences of PfFabG were compared for similarity with FabGs from other organisms, using clustalw [20] As shown in Fig 2A, the sequence of PfFabG is most similar to those of plants and bacteria, consistent with its evolutionary linkage to a photosynthetic bacterium and its location in the apicoplast of the parasite Plasmodium FabG also has the characteristic sequence motif formed by a triad of Ser196, Tyr209 and Lys213 residues that is involved in the catalytic mechanisms of the enzymes of the short-chain alcohol dehydrogenase ⁄ reductase family This provides a strong indication of involvement of Arg187 and Arg230 of PfFabG in its interaction with PfACP, as these two residues are located at the entrance of the active site tunnel (Fig 1C) [12] The sequence alignment of FabG from different Plasmodium species, however, shows the presence of Lys187 instead of Arg187, so the effects of mutations of these residues on the kinetics and the ACP-induced cooperativity for the binding of NADPH were also examined To eliminate the ability of Arg187, Arg190 and Arg230 to form ionic bonds with PfACP, we mutated them to alanine or glutamate and demonstrated their moderate effect on PfFabG specific activities (Table 1) In contrast, when Arg187 and Arg230 were changed to an alanine or glutamate, the PfFabG mutants were severely impaired in the ACP-dependent spectrophotometric assay, with a decrease in activity of more than 90% (Table 2) and refractoriness to PfACP inhibition (Fig 3) To confirm the importance of Arg187 and Arg230, we used a fluorescence assay to directly monitor the interactions between PfFabG and PfACP The PfFabG mutants show three-fold to 80-fold less binding when compared to wild-type PfFabG (Table 2) These data suggest that Arg187 and Arg230 are the most important electropositive residues involved in PfFabG– PfACP interactions Furthermore, the effect was more deleterious when Arg230 was mutated as than when Arg187 was mutated for interactions with PfACP as shown by the direct binding assay (Table 2), which might be the reason for the greater conservation of Arg230 during evolution (Fig 1) In conclusion, our results provide compelling support for the hypothesis that the highly conserved a2 helix of PfACP recognizes an electropositive ⁄ hydrophobic surface feature adjacent to the active site entrance on PfFabG Two surface residues, Arg187 and Arg230, located in a hydrophobic patch at the active site entrance on the PfFabG make contact with PfACP The hydrophobic residues on PfACP also make contacts with the hydrophobic patches on PfFabG, and in turn help in the proper positioning of PfACP near the active site FEBS Journal 275 (2008) 4756–4766 ª 2008 The Authors Journal compilation ª 2008 FEBS K Karmodiya et al Experimental procedures Materials Acetoacetyl-CoA, b-hydroxybutyryl-CoA, b-NADPH, NADP+, imidazole, kanamycin, chloramphenicol and SDS ⁄ PAGE reagents were obtained from Sigma Chemicals (St Louis, MO, USA) Protein molecular weight markers were from MBI Fermentas GmbH (St Leon-Rot, Germany) His-binding resin and anti-His-tag horseradish peroxidase conjugates were obtained from Novagen (Darmstadt, Germany) Media components were obtained from Difco (Franklin Lakes, NJ, USA) Hi-Trap desalting and Superdex 200 columns were from Amersham Biosciences (Uppsala, Sweden) All other chemicals used were of analytical grade Strains and plasmids FabG was cloned into the pET-28a(+) vector (Novagen), and BL21 (DE3) codon plus (Novagen) was used for the expression of PfFabG Construction of PfFabG mutants Mutations were introduced into the PfFabG gene in pET– FabG [17], using an overlap extension PCR method All the PfFabG mutants were prepared using the same two outer primers: FabG-NcoI-F, 5¢-CATGCCATGGGAAAA GTTGCTTTAGTAACAG GTGCAGGA-3¢; and FabG -XhoI-R, 5¢-CCGCTCGAGAGGTGATAGTCCACCGTCT ATTACGAAAACTCG-3¢ (with NcoI and XhoI sites underlined) The internal primers for all the PfFabG mutants are listed in Table To construct each mutant, Table Overview of the oligonucleotide primers used to generate PfFabG mutants The mutation sites are underlined Primer Sequence (5¢- to 3¢) FabGF FabGR CATGCCATGGGAAAAGTTGCTTTAGTAACAGGTGCAGGA CCGCTCGAGAGGTGATAGTCCACCGTCTATTACGAAAA CTCG TAATAATGCGTATGGTCGAATAATTA GACCATACGCATTATTAATCATTCTT TAATAATGAATATGGTCGAATAATTA GACCATATTCATTATTAATCATTCTT AATAATAAATACGGCCGAATAATTA TAATTATTCGGCCGTATTTATTATT AGCTTCAGCCAATATAACTGTAAATG CATTTACAGTTATATTGGCTGAAGCT AGCTTCAGAAAATATAACTGTAAATG CATTTACAGTTATATTTTCTGAAGCT TATGGTGCCATAATTAATATTTCAAGT ACTTGAAATATTAATTATGGCACCATA TATGGTGAAATAATTAATATTTCAAGT ACTTGAAATATTAATTATTTCACCATA R187AF R187AR R187EF R187ER R187KF R187KR R230AF R230AR R230EF R230ER R190AF R190AR R190ER R190ER Interactions of PfFabG with PfACP two PCR reactions with pET–FabG as the template, consisting of one outer primer and the respective internal primers, were performed, and the products were then pooled and used as a template for a second PCR using the outer primers The PCR products were purified from a 1% agarose gel using the QIAquick gel extraction kit (Qiagen, Hilden, Germany) and cloned in the NcoI and XhoI sites of the pET-28a(+) vector (Novagen) The clone thus obtained was confirmed by DNA sequencing Expression and purification was as for the wild-type protein as reported earlier [17] CD spectroscopy The correct folding of the mutant proteins was verified by analysis of their CD spectrum between 200 and 250 nm (2 nm bandpass) using a JASCO J-810 (Tokyo, Japan) spectropolarimeter at 20 °C and a 0.1 cm path length quartz cuvette The protein concentration was determined by measuring the absorbance at 280 nm, immediately prior to collecting the spectrum The extinction coefficient of Histagged PfFabG was 17 690 cm)1Ỉm)1, using the ‘peptide properties calculator’ (http://www.basic.northwestern.edu/ biotools/proteincalc.html) The measured ellipticity was converted to molar values for direct comparison of the mutants with the wild-type protein Expression and purification of PfACP PfACP was purified as described previously [18] ACP-dependent spectrophotometric assay of PfFabG activity PfFabG activity was tested in an ACP-dependent assay by analyzing the formation of b-hydroxybutyryl-ACP, measuring the disappearance of its cofactor NADPH, spectrophotometrically, at 340 nm The gel reconstitution assay reported for E coli [16] could not be used for measuring ACP-dependent PfFabG activity, as the substrate acetoacetyl-ACP and product b-hydroxybutyryl-ACP were not separable by electrophoresis under nonreducing conditions The reaction mixture contained 25 lm PfACP, mm b-mercaptoethanol, 65 lm malonyl-CoA, 45 lm acetyl-CoA, 200 lm NADPH, lg of purified E coli FabD, 0.5 lg of purified PfFabH in 0.1 m sodium phosphate buffer (pH 7.0), and 0.2–1 lg of PfFabG (or PfFabG mutant) in a final volume of 95 lL The PfACP, b-mercaptoethanol and buffer were preincubated at 37 °C for 30 to ensure the complete reduction of PfACP The substrate for the PfFabG reaction was generated by using E coli FabD to transfer the malonyl group from CoA to PfACP to produce malonyl-ACP, and subsequently PfFabH to condense acetyl-CoA and malonyl-ACP to FEBS Journal 275 (2008) 4756–4766 ª 2008 The Authors Journal compilation ª 2008 FEBS 4763 Interactions of PfFabG with PfACP K Karmodiya et al form b-ketobutyryl-ACP The reaction was initiated by the addition of NADPH A decrease in the absorbance at 340 nm was recorded for The initial rate was used to calculate the enzyme activity Correction for the inner filter effect was performed according to the equation Fc ẳ F antilogẵAex þ Aem Þ=2Š The activity of PfFabG was assayed at 25 °C by monitoring spectrophotometrically the decrease in absorbance at 340 nm due to the oxidation of NADPH to NADP+ (Jasco V-530 UV–visible spectrophotometer) The standard reaction mixture in a final volume of 100 lL contained 50 mm sodium phosphate buffer (pH 6.8) containing 0.25 m NaCl, 200 lm NADPH, 0.5 mm acetoacetyl-CoA and 0.2–0.8 lg of PfFabG [17] The assay mixture was preincubated for at room temperature before the reaction was initiated by the addition of substrate or enzyme Reactions with appropriate blanks were also performed The kinetic parameters were determined by nonlinear regression analyses The data were also evaluated by double reciprocal plots The ability of PfACP to inhibit PfFabG activity in the spectrophotometric assay was tested by incubation of varying concentrations of PfACP with PfFabG protein at room temperature for before the addition of acetoacetyl-CoA to initiate the reaction where Fc and F are the corrected and measured fluorescence intensities, respectively [21], and Aex and Aem are the solution absorbance values at the excitation and emission wavelengths, respectively The fluorescence data were fitted by the Adair equation [22], with number of sites n = to 4, K being the association constants: for a single site, Y = K[X] ⁄ (1 + K[X]); for two equivalent and independent sites, Y = (K1[X] + 2K1K2[X]2) ⁄ (1 + K1[X] + K1K2[X]2); for two equivalent and interdependent sites, Y = (2K1[X] + K1K2[X]2) ⁄ (1 + K1[X] + K1K2[X]2); for three equivalent and independent sites, Y = (K1[X] + 2K1K2[X]2 + 3K1K2K3[X]3) ⁄ (1 + K1[X] + K1K2[X2] + K1K2K3[X]3); for three equivalent and interdependent sites, Y = (3K1[X] + 2K1K2[X]2 + K1K2K3[X]3) ⁄ (1 + K1[X] + K1K2[X]2 + K1K2K3[X]3); for four equivalent and independent sites, (K1[X] + 2K1K2[X]2 + 3K1K2K3[X]3 + 4K1K2K3K4[X]4) ⁄ (1 + K1[X] + K1K2[X]2 + K1K2K3[X]3 + K1K2K3K4[X]4); and four equivalent and interdependent sites, Y = (4K1[X] + 3K1K2[X]2 + 2K1K2K3[X]3 + K1K2K3K4[X]4) ⁄ (1 + K1[X] + K1K2[X]2 + K1K2K3[X]3 + K1K2K3K4[X]4) All calculations were carried out with sigma plot 2000 software Fluorescence titration of PfFabG–PfACP binding Analysis of PfFabG–PfACP interaction by SPR Equilibrium binding of various ligands to PfFabG was measured by fluorescence titration [17] at 20 °C using a Jobin-Yvon Horiba spectrofluorimeter (bandpass of and nm for the excitation and emission monochromator, respectively) The fluorescence spectrum of PfFabG was studied by exciting the samples at 280 nm and recording the emission spectrum in the range 300–400 nm, with an emission maximum at 334 nm, due to its lone tryptophan Aliquots of lL of PfACP (from the stock solutions of 100 lm) were added to 0.5 lm PfFabG in mm Hepes (pH 7.5), 100 mm NaCl, mm b-mercaptoethanol and 10% glycerol The solution was mixed after the addition of each aliquot, and the fluorescence intensity in the range 300–400 nm was recorded as the average of three readings Samples were excited at 280 nm The effect of NADPH on PfACP binding to PfFabG was studied by titration of NADPH (3 lL) into 0.5 lm PfFabG (in mm Hepes, pH 7.5, 100 mm NaCl, mm b-mercaptoethanol and 10% glycerol), from a stock solution of mm, and the corresponding decrease in the fluorescence intensity of its lone tryptophan was monitored at 334 nm A double reciprocal plot of the fluorescence intensities and ligand concentrations, from the data obtained by titration of a fixed concentration of PfFabG with ligand, gave the fluorescence intensity at infinite ligand concentration (Fa) Biospecific-interaction analysis was performed using a BIAcore 2000 biosensor system (Amersham Pharmacia Biotech, Uppsala, Sweden) The immobilization of PfFabG on the flow cell of a nitrilotriacetic acid sensor chip involved regeneration of the sensor surface with a flow of 350 mm EDTA in 10 mm Hepes (pH 8.3), 150 mm NaCl and 10% glycerol at a rate of 20 lLỈmin)1 on the sensor surface This was followed by injection of 500 lm NiCl2 in 10 mm Hepes (pH 7.4), 150 mm NaCl, 10% glycerol and 50 lm EDTA for at a rate of lLỈmin)1 on the sensor surface Nearly 70 RU were coupled Wild-type and mutant PfFabG were immobilized on different flow cells of the activated sensor chip by injecting 125 nm protein in 10 mm Hepes (pH 7.4), 150 mm NaCl, 10% glycerol and 50 lm EDTA at a rate of lLỈmin)1 Nearly 350 RU were coupled, where RU corresponds to an immobilized protein concentration of approximately pgỈmm)2 One flow cell was kept as the reference surface The reference surface was treated in the same way as the ligand surface, except that the PfFabG was not passed over this surface This is important to normalize the chemistries between the two flow cells All measurements were carried out in 10 mm Hepes (pH 7.4), 150 mm NaCl, 10% glycerol and 50 lm EDTA (HBS buffer) [23] In order to determine the association rate constant for the binding of PfACP to the immobilized PfFabG, PfACP without His-tag was passed over the surfaces at various concentrations at ACP-independent spectrophotometric assay of PfFabG activity 4764 FEBS Journal 275 (2008) 4756–4766 ª 2008 The Authors Journal compilation ª 2008 FEBS K Karmodiya et al Interactions of PfFabG with PfACP 20 °C in Hepes buffer at a flow rate of 20 lLỈmin)1 For the determination of dissociation rate constant, the same buffer was passed at a flow rate of 20 lLỈmin)1 To study the effect of NADPH on the PfFabG–PfACP interaction, PfACP was diluted to the desired concentrations in HBS buffer containing 200 lm NADPH, and the binding studies were performed in the same buffer with NADPH Evaluation of kinetic parameters The association (k1) and dissociation (k)1) rate constants are obtained by nonlinear fitting of the primary sensorgram data using bia evaluation software version 3.0 The sensorgrams were fitted globally to the : Langmuir dissociation model (Eqn 1) to obtain the k)1 values: Rt ẳ Rto ek1 tt0 ị ð1Þ where Rt is the response at time t, and Rt0 is the amplitude of the initial response The measured k)1 values were used to determine the k1 values using the : Langmuir association model (Eqn 2): Rt ẳ Rmax ẵ1 ek1 Cỵk1 ịtt0 ị 2ị where Rmax is the maximum response, and C is the concentration of the analyte in the solution The ratio of k1 and k)1 yields the value of the association constant Ka (k1 ⁄ k)1) v2 and residual values were used to evaluate the quality of fit between the experimental data and the binding model [24] Acknowledgements We thank the Department of Biotechnology (DBT), Government of India for their financial support to N Surolia K Karmodiya acknowledges the CSIR, Government of India, for a senior research fellowship References Surolia N & Surolia A (2001) Triclosan offers protection against blood stages of malaria by inhibiting enoyl-ACP reductase of Plasmodium falciparum Nat Med 7, 167–173 Waller RF, Keeling PJ, Donald RG, Striepen B, Handman E, Lang-Unnasch N, Cowman AF, Besra GS, Roos DS & McFadden GI (1998) Nuclear-encoded proteins target to the plastid in Toxoplasma gondii and Plasmodium falciparum Proc Natl Acad Sci USA 95, 12352–12357 Witkowski A, Ghosal A, Joshi AK, Witkowska HE, Asturias FJ & Smith S (2004) Head-to-head arrangement of the subunits of the animal fatty acid synthase Chem Biol 11, 1667–1676 Ramya TNC, Surolia N & Surolia A (2002) Survival strategies of the malarial parasite Plasmodium falciparum Curr Sci 83, 101–108 Surolia A, Ramya TNC, Ramya V & Surolia N (2004) FAS’t inhibition of malaria Biochem J 383, 1–12 Sharma S, Ramya TNC, Surolia A & Surolia N (2003) Triclosan as a systemic antibacterial agent in a mouse model of acute bacterial challenge Antimicrob Agents Chemother 47, 3859–3866 Ramya TN, Mishra S, Karmodiya K, Surolia N & Surolia A (2007) Inhibitors of nonhousekeeping functions of the apicoplast defy delayed death in Plasmodium falciparum Antimicrob Agents Chemother 51, 307–316 Ramya TN, Karmodiya K, Surolia A & Surolia N (2007) 15-Deoxyspergualin primarily targets the trafficking of apicoplast proteins in Plasmodium falciparum J Biol Chem 282, 6388–6397 White SW, Zheng J, Zhang YM & Rock CO (2005) The structural biology of type II fatty acid biosynthesis Annu Rev Biochem 74, 791–831 10 Gardner MJ, Tettelin H, Carucci DJ, Cummings LM, Aravind L, Koonin EV, Shallom S, Mason T, Yu K, Fujii C et al (1998) Chromosome sequence of the human malaria parasite Plasmodium falciparum Science 282, 1126–1132 11 Sharma AK, Sharma SK, Surolia A, Surolia N & Sarma SP (2006) Solution structures of conformationally equilibrium forms of holo-acyl carrier protein (PfACP) from Plasmodium falciparum provides insight into the mechanism of activation of ACPs Biochemistry 45, 6904–6916 12 Wickramasinghe SR, Inglis KA, Urch JE, Muller S, Van Aalten DM & Fairlamb AH (2006) Kinetic, inhibition and structural studies on 3-oxoacyl-ACP reductase from Plasmodium falciparum, a key enzyme in fatty acid biosynthesis Biochem J 393, 447–457 13 Rock CO, Cronan JE Jr & Armitage IM (1981) Molecular properties of acyl carrier protein derivatives J Biol Chem 256, 2669–2674 14 Price AC, Zhang YM, Rock CO & Stephen WW (2001) Structure of beta-ketoacyl-[acyl carrier protein] reductase from Escherichia coli: negative cooperativity and its structural basis Biochemistry 40, 12772–12781 15 Fisher M, Kroon JTM, Martindale W, Stuitje AR, Slabas AR & Rafferty JB (2000) The X-ray structure of Brassica napus beta-keto acyl carrier protein reductase and its implications for substrate binding and catalysis Structure 8, 339–347 16 Zhang YM, Wu B, Zheng J & Rock CO (2003) Key residues responsible for acyl carrier protein and betaketoacyl-acyl carrier protein reductase (FabG) interaction J Biol Chem 278, 52935–52943 17 Karmodiya K & Surolia N (2006) Analyses of co-operative transitions in Plasmodium falciparum b-ketoacylACP reductase upon co-factor and acyl carrier protein binding FEBS J 273, 4093–4103 FEBS Journal 275 (2008) 4756–4766 ª 2008 The Authors Journal compilation ª 2008 FEBS 4765 Interactions of PfFabG with PfACP K Karmodiya et al 18 Sharma SK, Modak R, Sharma S, Sharma AK, Sarma SP, Surolia A & Surolia N (2005) A novel approach for over-expression, characterization, and isotopic enrichment of a homogeneous species of acyl carrier protein from Plasmodium falciparum Biochim Biophys Res Commun 330, 1019–1026 19 Nieba L, Nieba-Axmann SE, Persson A, Hamalainen M, Edebratt F, Hansson A, Lidholm J, Magnusson K, Karlsson AF & Pluckthun A (1997) BIACORE analysis of histidine-tagged proteins using a chelating NTA sensor chip Anal Biochem 252, 217–228 20 Higgins D, Thompson J, Gibson T, Thompson JD, Higgins DG & Gibson TJ (1993) clustal w: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice Nucleic Acids Res 22, 4673–4680 21 Sharma SK, Kapoor M, Ramya TNC, Kumar S, Kumar G, Modak R, Sharma S, Surolia N & Surolia A (2003) Identification, characterization, and inhibition of Plasmodium falciparum b-hydroxyacyl-acyl carrier protein dehydratase (FabZ) J Biol Chem 278, 45661–45671 22 Campanacci V, Lartigue A, Hallberg BM, Jones TA, Orticoni MTG, Tegoni M & Cambillau C (2003) Moth chemosensory protein exhibits drastic conformational 4766 changes and cooperativity on ligand binding Proc Natl Acad Sci USA 100, 5069–5074 23 Kapoor M, Mukhi PL, Surolia N, Suguna K & Surolia A (2004) Kinetic and structural analysis of the increased affinity of enoyl-ACP (acyl-carrier protein) reductase for triclosan in the presence of NAD+ Biochem J 381, 725–733 24 Schuck P (1997) Use of surface plasmon resonance to probe the equilibrium and dynamic aspects of interactions between biological macromolecules Annu Rev Biophys Biomol Struct 26, 541–566 Supporting information The following supplementary material is available: Fig S1 The far-UV CD spectra of wild-type PfFabG and PfFabG mutants This supplementary material can be found in the online version of this article Please note: Wiley-Blackwell are not responsible for the content or functionality of any supplementary material supplied by the authors Any queries (other than missing material) should be directed to the corresponding author for the article FEBS Journal 275 (2008) 4756–4766 ª 2008 The Authors Journal compilation ª 2008 FEBS ... changed these positively charged residues to alanines to determine which of the electrostatic interactions are important for promoting the binding to PfACP Interestingly, within the Plasmodium. .. known about the residues involved in interactions Plasmodium falciparum ACP (PfACP) is a small protein, with a flexible conformation, which shuttles the substrates between the enzymes of the pathway... those for wild-type PfFabG The ACP-dependent activity assay clearly showed the involvement of the two surface arginine residues of PfFabG in the interaction with PfACP In order to determine the