Báo cáo khoa học: Analyses of co-operative transitions inPlasmodium falciparumb-ketoacyl acyl carrier protein reductase upon co-factor and acyl carrier protein binding pdf

Analyses of co-operative transitions in Plasmodium falciparum b-ketoacyl acyl carrier protein reductase upon co-factor and acyl carrier protein binding Krishanpal Karmodiya and Namita Surolia Molecular Biology and Genetics Unit, Jawaharlal Nehru Centre for Advanced Scientific Research, Jakkur, Bangalore, India Malaria is one of the leading causes of morbidity and mortality in the tropics, with 300–500 million clinical cases and 1.5–2.7 million deaths per year [1,2]. Nearly all the fatal cases are caused by Plasmodium falcipa- rum. The acquisition of resistance by this parasite to conventional antimalarial drugs, such as chloroquine, is growing at an alarming rate and the increasing bur- den of malaria caused by drug-resistant parasites has led investigators to seek novel antimalarial drug targets [3]. There are two distinct architectures for fatty acid synthesis in living organisms. Our recent demonstra- tion of the occurrence of the type II fatty acid synthase (FAS) pathway in the malaria parasite and its inhibi- tion by triclosan, an inhibitor of a key enzyme (enoyl- acyl carrier protein reductase) of the type II FAS Keywords b-ketoacyl-ACP reductase; cofactor; conformational change; fluorescence quenching; Plasmodium Correspondence N. Surolia, Molecular Biology and Genetics Unit, Jawaharlal Nehru Centre for Advanced Scientific Research, Jakkur, Bangalore- 560064, India Fax: +91 80 22082766 Tel: +91 80 22082820 ⁄ 21 E-mail: surolia@jncasr.ac.in (Received 12 April 2006, revised 15 June 2006, accepted 10 July 2006) doi:10.1111/j.1742-4658.2006.05412.x The type II fatty acid synthase pathway of Plasmodium falciparum is a validated unique target for developing novel antimalarials because of its intrinsic differences from the type I pathway operating in humans. b-Ketoacyl-acyl carrier protein reductase is the only enzyme of this pathway that has no isoforms and thus selective inhibitors can be developed for this player of the pathway. We report here intensive studies on the direct inter- actions of Plasmodium b-ketoacyl-acyl carrier protein reductase with its cofactor, NADPH, acyl carrier protein, acetoacetyl-coenzyme A and other ligands in solution, by monitoring the intrinsic fluorescence (k max 334 nm) of the protein as a result of its lone tryptophan, as well as the fluorescence of NADPH (k max 450 nm) upon binding to the enzyme. Binding of the reduced cofactor makes the enzyme catalytically efficient, as it increases the binding affinity of the substrate, acetoacetyl-coenzyme A, by 16-fold. The binding affinity of acyl carrier protein to the enzyme also increases by approximately threefold upon NADPH binding. Plasmodium b-ketoacyl- acyl carrier protein reductase exhibits negative, homotropic co-operative binding for NADPH, which is enhanced in the presence of acyl carrier pro- tein. Acyl carrier protein increases the accessibility of NADPH to b-keto- acyl-acyl carrier protein reductase, as evident from the increase in the accessibility of the tryptophan of b-ketoacyl-acyl carrier protein reductase to acrylamide, from 81 to 98%. In the presence of NADP + , the reaction proceeds in the reverse direction (K a ¼ 23.17 lm )1 ). These findings provide impetus for exploring the influence of ligands on the structure–activity rela- tionship of Plasmodium b-ketoacyl-acyl carrier protein reductase. Abbreviations ACP, acyl carrier protein; apo-PfACP, Plasmodium falciparum acyl carrier protein (apo form); holo-PfACP, Plasmodium falciparum acyl carrier protein (holo form); FabG, b-ketoacyl-ACP reductase; FAS, fatty acid synthase, PfFabG, Plasmodium falciparum b-ketoacyl-ACP reductase; SDR, short-chain alcohol dehydrogenase ⁄ reductase. FEBS Journal 273 (2006) 4093–4103 ª 2006 The Authors Journal compilation ª 2006 FEBS 4093 pathway, pointed to the pivotal role of this pathway for the survival of malaria parasites [4,5]. The type II FAS pathway of Plasmodium has discrete enzymes for each step of the pathway, as opposed to the type I FAS, found in humans, which is a multifunctional enzyme [6,7]. Also, the type II fatty acid biosynthetic pathway in P. falciparum is one of the pathways speci- fic to its ‘plastid’ and has been validated as a unique target for developing new antimalarials [8–10]. During the elongation cycle of FAS II, the acyl chain covalently attached to the acyl carrier protein (ACP) is elongated successively by two carbon units by the action of four enzymes acting consecutively. First, b-ketoacyl-ACP synthase (either FabB or FabF) elongates the acyl-ACP of the C n acyl chain to a C n+2 b-ketoacyl form. The b-ketoacyl-ACP thus formed is reduced to b-hydroxyacyl-ACP by an NADPH- dependent b-ketoacyl-ACP reductase (FabG). The b-hydroxyacyl group is then dehydrated to an enoyl- ACP by a b-hydroxyacyl-ACP dehydratase (FabZ or FabA). Reduction of the enoyl group by an enoyl- ACP reductase (FabI, FabK or FabL) finally produces C n+2 acyl-ACP, which is ready to re-enter the cycle, become hydrolyzed from ACP for the synthesis of phospholipids or sphingolipids, or become diverted for other modifications [11,12]. FabG is ubiquitously expressed in bacteria [13], is highly conserved across species, and is the only known isoform that functions as a ketoacyl reductase in the FAS II system. The primary structure of FabG from the parasite reveals that it belongs to the short-chain alcohol dehydrogenase ⁄ reductase (SDR) family of enzymes, whose members catalyze a broad range of reduction and dehydrogenation reactions using a nuc- leotide cofactor [14,15]. P. falciparum FabG (PfFabG) has 48% sequence identity with its counterpart from Brassica napus, with which it shares stronger homology than with the Escherichia coli enzyme. Solution studies on detailed interactions of PfFabG with its cofactor, substrate and holo-acyl-carrier protein (ACP, unless otherwise indicated) to have insight into its co-opera- tivity and catalytic mechanism, are lacking. The intrin- sic fluorescence of tryptophan in a protein is sensitive to its surroundings, a characteristic that has made it an invaluable and popular tool for studying protein– ligand interactions, and FabG, with a lone tryptophan, provides an ideal system for studying ligand-induced conformational changes in it. Here, we report subtle aspects of the interactions between FabG with its co- factor, acetoacetyl-coenzyme A (acetoacetyl-CoA) and also with ACP, with emphasis on association con- stants, number of binding sites and the co-operativities involved therein. Results Cloning, expression, purification and kinetic analyses of FabG FabG (acc. no.: PFI1125c) potentially resides in the apicoplast of Plasmodium and therefore possesses a bipartite signal and transit peptide at the N terminus for correct targeting to the apicoplast. On the basis of the FabG sequence in PlasmoDB, the start site of the mature protein, from nucleotides 132 to 903, was cloned. The deduced amino acid sequence correspon- ded to the mature protein, with a predicted molecular mass of 31.0 kDa [16]. Mature FabG was expressed in E. coli BL21 (DE3) codon plus cells with a C-terminal His-tag. The soluble protein was purified to homogen- eity on a Ni-nitrilotriacetic acid affinity column. On SDS ⁄ PAGE, the purified protein yielded a monomeric M r of 31 000 (Fig. 1A) and on Superdex tm 200 yielded an M r of 110 000 ± 2500 (Fig. 1B), demonstrating that it exists as a tetramer in solution (3 mm Hepes, pH 7.5, 100 mm NaCl, 2 mm b-mercaptoethanol and 10% glycerol). The enzyme has a K m value for the sub- strate acetoacetyl-CoA of 0.43 ± 0.05 mm and a K m value for NADPH of 42.6 ± 0.05 lm. The specific activity of the enzyme with acetoacetyl-CoA is 59.8 UÆmg )1 and the k cat is 259 ± 25 s )1 , which are within the range of values reported previously [16]. Co-operative binding of the cofactor to FabG HPLC-purified, fresh NADPH (A 258 ⁄ A 340 ¼ 2.3) was used for studying the conformational changes and co-operativity in FabG. The intrinsic fluorescence of FabG, as a result of its lone tryptophan (k max ¼ 334 nm), decreased when it was titrated with increasing concentrations of NADPH (Fig. 2A,B), with simulta- neous appearance of another peak with a k max at 456 nm as a result of NADPH. The appearance of fluor- escence with a k max at 456 nm is caused by energy trans- fer from the lone tryptophan of FabG to the bound NADPH, as the emission spectrum of tryptophan in the protein has a considerable overlap with the excitation spectrum of the NADPH. Binding of NADPH to FabG, as analyzed by quenching of its fluorescence intensity at 334 nm, exhibited a negative, homotropic co-operativity (with a Hill constant of 0.8) (Fig. 2C). The NADPH-induced changes in the fluorescence of tryptophan in the protein at 334 nm were analyzed by nonlinear least-squares fit of the data, using the Adair equation with 1–4, equivalent and independent, as well as equivalent and interdependent, binding sites (n). As shown in Fig. 2D, a model of the binding site with Plasmodium falciparum b-ketoacyl ACP reductase K. Karmodiya and N. Surolia 4094 FEBS Journal 273 (2006) 4093–4103 ª 2006 The Authors Journal compilation ª 2006 FEBS n ¼ 1 does not provide a satisfactory coalescence of the fit with the data for NADPH binding. However, the fit improves dramatically as the number of sites are increased from two to four equivalent, interdependent- binding sites, with n ¼ 4(K a ¼ 40.90 lm )1 ) being clo- sest to the experimental data (Fig. S1 and Table S1). As mentioned above, binding of NADPH to the enzyme leads to the appearance of fluorescence with a maximum at 450 nm when excited at its excitation maximum (340 nm). From the NADPH concentration dependence of the increase in fluorescence intensity of NADPH at 450 nm, the K a value for its binding to FabG, with n ¼ 4, was found to be 45.2 lm )1 . Binding of other ligands to the binary complex of NADPH.FabG also alters the cofactor-specific fluorescence intensity (k max 456 nm). The K a values for all the ligands that were determined [i.e. acetoacetyl-CoA, Plasmodium falciparum acyl carrier protein (apo form) (apo-PfACP) and Plasmo- dium falciparum acyl carrier protein (holo form) (holo-PfACP)] using the cofactor-specific fluorescence intensity at 456 nm (excited at 280 nm), are identical to those obtained by measurement of the intrinsic trypto- phan fluorescence intensity at 334 nm (Table 1). Allosteric binding of NADPH to FabG in the presence of ACP The binding constant of acetoacetyl-CoA to the enzyme is increased several fold in the presence of NADPH, which motivated us to investigate allostery in its cata- lytic mechanism. The affinities (K a ) of FabG for its cofactor, NADPH, determined by quenching of the fluorescence of its tryptophan (k max 334 nm) in the absence and presence of 20 lm ACP, were found to be 40.9 lm )1 and 48.4 lm )1 , respectively (Fig. 3A and Table 1). In the presence of ACP, the affinity of FabG for NADPH increased, while the number of cofactor- binding sites decreased, indicating a negative, hetero- tropic co-operative effect of ACP upon binding of NADPH (Table 1). In addition, the degree of negative co-operativity increased in the presence of ACP (Hill constant, n H ¼ 0.5) (Fig. 2B). In the absence of ACP, as stated earlier, the binding of NADPH exhibited negat- ive, homotropic co-operativity. In the absence of ACP, four NADPH-binding sites were present, corresponding to the four equivalent subunits in FabG, which decreased to two in the presence of ACP. Altogether, the negative co-operativity and stoichiometry calcu- lations show that binding of ACP converts the four equivalent negative co-operative homotropic NADPH- binding sites to two high-affinity NADPH sites (Fig. 3B). Interaction of FabG with ACP Fluorescence titration of a fixed concentration of FabG with varying concentrations of ACP gave an associ- PfFabG (31 kDa) 12 kDa 118 66 45 35 25 18 14 A log molecular mass 456 Ve/Vo 1 2 3 B Elution Volume (ml) 01020 A 280 (mAU) 0 10 20 Fig. 1. Purification and determination of the molecular mass of b-ketoacyl-acyl carrier protein reductase (FabG) by gel filtration chro- matography. (A) SDS ⁄ PAGE of recombinant FabG. Lane 1, protein molecular mass markers (MBI Fermentas); lane 2, purified FabG. (B) The standard curve, Ve ⁄ V 0 versus log molecular mass (mol. mass) was derived from the elution profiles of the standard molecular weight markers on a Superdex 200 gel filtration column. Ve, peak elution volume of the protein; V 0 , void volume of the col- umn. The position of FabG elution (2 mgÆmL )1 ) is indicated by (.). The standards used were 1, cytochrome c (12 kDa); 2, carbonic anhydrase (29 kDa); 3, ovalbumin (45 kDa); 4, BSA (66 kDa); and 5, aldolase (158 kDa). Inset, elution profile of FabG. K. Karmodiya and N. Surolia Plasmodium falciparum b-ketoacyl ACP reductase FEBS Journal 273 (2006) 4093–4103 ª 2006 The Authors Journal compilation ª 2006 FEBS 4095 ation constant of 0.40 lm )1 with n ¼ 1. The affinity (K a ¼ 1.1 lm )1 ) and the number of binding sites increased to two for ACP in the presence of NADPH. FabG activity was monitored spectrophotometri- cally at 340 nm in the presence of NADPH and ACP. The maximum activity was observed when the Fig. 2. Emission spectra for the intrinsic protein fluorescence (k max 334 nm) of b-ketoacyl-acyl carrier protein reductase (FabG) and increase in fluorescence of NADPH (k max 456 nm) upon titration of the enzyme with NADPH at 20 °C. Aliquots of 3 lL of NADPH from stock solu- tions of 5 m M were added to 1 mL of FabG (2 lM tetramer in 3 mM Hepes, pH 7.5, 100 mM NaCl, 2 mM b-mercaptoethenol and 10% gly- cerol) and the changes in fluorescence intensities were monitored between 300 and 500 nm. Samples were excited at 280 nm. A fluorescence spectrum with a maximum at 334 nm is caused by the fluorescence of tryptophan in the protein. In addition, there was acquisi- tion of the fluorescence by NADPH, with a maximum at 456 nm, upon the binding of NADPH to the enzyme, as a consequence of energy transfer between the lone tryptophan (k max 334 nm) in the protein and bound NADPH (k max 456 nm). (A) Quenching of tryptophan fluores- cence of FabG (300–400 nm range; k max 334 nm) occurred as a function of increasing concentration of the reduced cofactor. The arrow indi- cates the direction in which the change in tryptophan fluorescence (quenching) occurs with an increase in NADPH concentration. There is an increase in NADPH fluorescence (400–500 nm range; k max 456 nm) as a function of increasing concentration of NADPH. The upward direction of the arrow indicates that the cofactor fluorescence (k max 456 nm) increases as a function of its concentration. (B) The fractional fluorescence changes at 334 nm (d) and 456 nm (s) are plotted versus the varying concentrations of NADPH. Inset: quenching of trypto- phan fluorescence at 334 nm (d) and the enhancement of NADPH fluorescence at 456 nm (s) as a function of increasing concentrations of NADPH. (C) Hill plot of the data obtained as a result of the changes in fluorescence intensity of tryptophan of the enzyme at 334 nm, as a function of NADPH concentration, with a Hill constant (n H ) of 0.8 (s). In the presence of acyl carrier protein (ACP), the n H ¼ 0.5 (d). (D) Fit- ting with the Adair equation corresponding to four sites (dotted line) for NADPH yields the best r 2 value of 0.949, with an excellent fit of the experimental values (d). Fit with one site (thin line) diverges significantly from the experimental points (d). Error bars for the fit with n ¼ 1 are not shown in the figure in the interest of clarity, but are shown in Fig. S1. Likewise, fits with n ¼ 2andn ¼ 3, together with the associ- ated error bars, are shown in Fig. S1. Plasmodium falciparum b-ketoacyl ACP reductase K. Karmodiya and N. Surolia 4096 FEBS Journal 273 (2006) 4093–4103 ª 2006 The Authors Journal compilation ª 2006 FEBS cofactor was preincubated with the enzyme before adding acetoacetyl-CoA and ACP. The enzyme was catalytically less efficient in the presence of ACP (Table 2). Binding of acetoacetyl-CoA and b-hydroxybutyryl- CoA to FabG The association constant for the substrate, acetoace- tyl-CoA, is 12.3 lm )1 with four equivalent and independent sites. In the presence of NADPH (Fig. S2A), the K a for acetoacetyl-CoA is increased by 16-fold to 189.2 lm )1 (Table 1). Thus, acetoace- tyl-CoA now has a larger number of favorable inter- actions at the active site of the enzyme in the presence of NADPH. b-hydroxybutyryl-CoA, the product of the reaction, has affinity (23.2 lm )1 ) (Fig. S2B) comparable with that of acetoacetyl-CoA (18.8 lm )1 ) in the absence of NADPH. Binding of b-hydroxybutyryl-CoA in the presence of NADP + is enhanced by 1.7-fold. Effect of the cofactor and acetoacetyl-CoA on the far-UV CD spectrum of FabG The presence of NADPH has a considerable effect on the conformation of FabG. While the helicity of the protein increased from 30 to 35%, the b-sheet content increased from 27 to 33%, as evident by the CD Table 1. Binding constants (K a ) of various ligands to b-ketoacyl-acyl carrier protein reductase (FabG) at 20 °C, using the changes in pro- tein and ⁄ or cofactor fluorescence intensity at 334 and 450 nm, respectively. (Experimental details are provided in the respective figure legends a ). Apo-PfACP, Plasmodium falciparum acyl carrier protein (apo form); Holo-PfACP, Plasmodium falciparum-acyl carrier protein (holo form); n, number of binding sites for the best value of r 2 ; ND, not determined; SN, serial number. SN Titrated with ligand Saturated with n K a (lM )1 ) b K a (lM )1 ) c 1 NADPH None 4 40.9 45.2 2 NADPH Holo-PfACP 2 48.4 43.6 3 NADP + None 4 2.2 ND 4 Apo-PfACP None 1 0.31 ND 5 Apo-PfACP NADPH 1 0.36 0.35 6 Apo-PfACP NADP + 1 0.32 ND 7 Holo-PfACP None 1 0.40 ND 8 Holo-PfACP NADP + 1 0.31 ND 9 Holo-PfACP NADPH 2 1.1 1.2 10 Acetoacetyl-CoA None 4 12.3 ND 11 Acetoacetyl-CoA NADPH 2 189.2 172.6 12 b-hydroxybutyryl-CoA None 4 23.2 ND 13 b-hydroxybutyryl-CoA NADP + 4 39.4 ND a Table S1 provides the residuals for each value of n, for each ligand, to support the given value of n chosen by us for interpret- ation of our data. Also, for a given value of n, the resultant values of association constants are listed in Table S1. A footnote provides the rationale for the selection of a particular value of K a from these. b K a , association constant for the best value of r 2 , determined using protein fluorescence (334 nm). c K a , association constant for the best value of r 2 , determined using cofactor fluorescence (450 nm). Fig. 3. Negative co-operative binding of NADPH to b-ketoacyl-acyl carrier protein reductase (FabG). (A) Binding of NADPH to FabG (2 l M of the tetramer) was studied in the absence (s), and pres- ence of 20 l M acyl carrier protein (ACP) (d) by monitoring fluores- cence with excitation at 280 nm and emission at 334 nm, as described in the Experimental procedures. Relative fluorescence intensity (observed fluorescence intensity minus fluorescence inten- sity at infinite ligand concentration) values are plotted versus NADPH concentration. Identical results were obtained when the reaction was monitored by following the changes in the NADPH fluorescence intensity at 456 nm. (B) Intrinsic fluorescence quench- ing of FabG by NADPH with a saturating concentration of ACP (20 l M). Relative fluorescence intensity values are plotted versus NADPH concentration. A fit according to the Adair equation corres- ponding to two sites (dashed line) for NADPH in the presence of ACP gave the best value for residuals (0.965). Also, for comparison, the fit for one site (thin line) with the original data (d) is also shown. K. Karmodiya and N. Surolia Plasmodium falciparum b-ketoacyl ACP reductase FEBS Journal 273 (2006) 4093–4103 ª 2006 The Authors Journal compilation ª 2006 FEBS 4097 spectrum of FabG (Fig. 4). Interestingly, the negative gain in ellipticity brought about by NADPH decreased with the addition of acetoacetyl-CoA. Analyses of the accessibility of the lone tryptophan of FabG by Stern–Volmer plots The oxidized cofactor, NADP + , is 20 times weaker as a ligand than its reduced counterpart (Fig. S3). Plots of F0 ‚ (F0 ) F) versus 1 ‚ [Q], for calculating the accessibility of the fluorescence of the lone tryptophan in FabG for NADP + and NADPH, are shown in Fig. 5 as representative examples. A cursory examina- tion of the plots reveal a greater accessibility of the tryptophan to the quencher when NADPH is bound to enzyme compared with that in the presence of NADP + . In Table 2, Stern–Volmer analyses of the data are summarized for the interactions of various ligands with FabG. These data for NADPH yield a value of 1.23, indicating that 81% of the total FabG fluorescence is accessible to it, whereas f )1 with NADP + is 2.37, showing that only 42% of the total fluorescence of the enzyme is accessible to the oxidized cofactor. Likewise, binding of other ligands also exert subtle molecular effects on the exposure of the unique tryptophan in FabG (Table 3). Stern–Volmer analysis of the interaction of ACP with FabG revealed an f )1 of 1.35, indicating that 74% of the total fluorescence of FabG is accessible when Table 2. Catalytic efficiency of b -ketoacyl-acyl carrier protein reduc- tase (FabG) with acetoacetyl-CoA as substrate, with varying con- centrations of acyl carrier protein (ACP). SN, serial number. conc., concentration. SN ACP conc. (l M) k cat ⁄ K m (s )1 ÆM )1 ) 1 0 6.02 · 10 5 (100) a 2 25.0 5.55 · 10 5 (92.5) 3 50.0 2.86 · 10 5 (79.8) 4 75.0 2.55 · 10 5 (71.4) 6 100.0 2.27 · 10 5 (63.3) 7 125.0 1.86 · 10 5 (52.1) 8 150.0 1.79 · 10 5 (49.8) a The percentage catalytic efficiency is given in parenthesis. Enzyme activity was monitored spectrophotometrically at 340 nm, as described in the Experimental procedures. Fig. 4. The far-UV CD spectra of b-ketoacyl-acyl carrier protein reductase (FabG). The figure shows the CD spectrum of FabG alone (14 · 10 )6 molÆl )1 (s), the CD spectrum in the presence of NADPH alone (200 l M)(.) and the CD spectrum in the presence of NADPH (200 l M) and a saturating concentration of acetoacetyl- CoA (200 l M)(d). Fig. 5. Fraction of initial fluorescence accessible to NADPH and NADP + . Accessibility was calculated by the Stern–Volmer equation. b-Ketoacyl-acyl carrier protein reductase (FabG) (0.5 l M,in3mM Hepes, pH 7.5) was preincubated for 15 min with aliquots of 5 mM NADPH (n)or5mM NADP + (s) in a total volume of 1 mL and was titrated with 10 lL aliquots of 3 M acrylamide solution. The fluores- cence intensity was monitored at 334 nm with excitation at 280 nm. Table 3. Fluorescence quenching parameters determined from modified Stern–Volmer plots of b-ketoacyl-acyl carrier protein reduc- tase (FabG) with acrylamide, at room temperature. a ACP, acyl car- rier protein; f, slope of the SV plot; f )1 , fluorescence accessibility; SN, serial number. SN Ligands f )1 %fAccessible 1 None 1.06 94.3 2 NADPH 1.23 81.3 3 NADPH + ACP 1.02 98.0 4 NADPH + acetoacetyl-CoA 1.01 97.8 6 ACP 1.35 74.0 7 Acetoacetyl-CoA 1.39 71.5 8 NADP 2.37 42.1 9 b-Hydroxybutyryl-CoA 1.22 81.9 10 NADP + b-hydroxybutyryl-CoA 1.10 90.9 a Samples were excited at 280 nm and the fluorescence intensity was monitored at 334 nm. Experiments were carried out at 20 °C. Plasmodium falciparum b-ketoacyl ACP reductase K. Karmodiya and N. Surolia 4098 FEBS Journal 273 (2006) 4093–4103 ª 2006 The Authors Journal compilation ª 2006 FEBS ACP is bound to it, which increases to 98% in the pres- ence of both ACP and NADPH. NADPH therefore increases the affinity of ACP by increasing its accessi- bility to FabG. In the presence of ACP, the accessibil- ity of the lone tryptophan of FabG for NADPH binding increases from 81 to 98%, explaining, likewise, the increase in affinity of NADPH by ACP. Discussion Our biophysical and biochemical data provide evidence that the binding of the cofactor NADPH to Plasmo- dium FabG induces major conformational change in the enzyme. This change promotes ACP binding as well as negative co-operativity, which forms the basis of the mechanism for catalytic activation of FabG. We propose a model to illustrate how PfFabG binds the cofactor, substrate and other ligands. The model also shows the active ⁄ inactive status of each monomer with the number of binding sites for various ligands in solution. FabG, an allosteric enzyme, is a catalytically nonproductive homotetramer in the absence of NADPH, as neither acetoacetyl-CoA, nor ACP (the substrate mimics of the physiological substrate aceto- acetyl-ACP) can access the active sites completely (Scheme 1A,D). ACP has a single binding site, whereas acetoacetyl-CoA has four independent binding sites in the tetramer in the absence of NADPH (Table 1). The binding of NADPH, which has four equivalent and interdependent binding sites in FabG, results in con- formational changes (Scheme 1B), which improves the accessibility of ACP and acetoacetyl-CoA to the active sites (Scheme 1C). While only one molecule of ACP can bind to FabG at one of the two dimeric interfaces of the enzyme in the absence of NADPH, the binding of NADPH to FabG results into two high-affinity sites for ACP and acetoacetyl-CoA (Scheme 1C). Thus, NADPH binding increases the affinity, as well as the number, of binding sites for ACP. Analyses of the data obtained from Adair equations and Hill coefficients for the interactions of various ligands with FabG, indi- cate that the binding of ACP not only increases the affinity, but also the negative co-operativity, of NADPH to the enzyme, fine tuning its catalytic mech- anism. Once NADPH and ACP bind to FabG, each can access two active sites from the opposite or adja- cent subunits (Scheme 1C). FabG holds NADPH and ACP close to each other in an orientation which stabil- izes the transition state that leads to the substrate delivery across the dimer interface via the pantetheine arm of the ACP. This provides an example of catalysis by approximation [17]. Our studies also demonstrate that holo-PfACP, as compared with its apo form, binds more strongly to FabG in the presence of NADPH, attesting the importance of the 4¢ phospho- pantetheine moiety for the binding of holo-PfACP (Table 1). As evident from the CD data (Fig. 4), the FabG secondary structure increases in the presence of NADPH and decreases in the presence of acetoacetyl- CoA. These conformational changes appear to be directly related to the binding and oxidation of NADPH to the enzyme at equilibrium. Such a mech- anism seems to be unique to the FabG members of the SDR family and are consistent with B. napus and E. coli counterparts, as demonstrated by crystallo- graphic studies [18–21]. These conformational changes point to the need for an open FabG active site to accept the acyl-ACP substrates. ABCDE ACP binding site +NADPH +ACP +ACP Active site Active site Inactive FabG homo-tetramer in the absence of NADPH Active FabG tetramer Conformational change in the active sites in presence of NADPH ACP binding site Phospho-pantetheine arm of ACP to which acyl moiety is attached +NADPH Scheme 1. Proposed model for b-ketoacyl-acyl carrier protein reductase (FabG) repositioning and allosteric regulation by the binding of NADPH and acyl carrier protein (ACP). K. Karmodiya and N. Surolia Plasmodium falciparum b-ketoacyl ACP reductase FEBS Journal 273 (2006) 4093–4103 ª 2006 The Authors Journal compilation ª 2006 FEBS 4099 Our studies highlight the importance of PfFabG in regulating the flux of the substrates during the elonga- tion phase of FAS in the parasite. This phase will pro- ceed when the NADPH ⁄ NADP ratio is high; on the other hand, when the NADPH ⁄ NADP ratio is low, b-hydroxyacyl-ACPs are converted to b-ketoacyl-ACPs. Hence, b-ketoacyl-ACPs will accumulate and the elon- gation phase of FAS will become regulated at this step. FabG exhibits negative co-operativity, and the bind- ing of NADPH to one site increases the affinity at that site for the ACP-bound substrate and simultaneously decreases the affinity for cofactor at the other site. This, in turn, indicates a greater sensitivity for the low ligand (NADPH) concentration and is probably associ- ated with conformational changes that have occurred in the transition from one state of co-operativity to the other. Furthermore, the increase in negative co-opera- tivity for NADPH in the presence of ACP might be useful, as the concentration of NADPH may change in the cell as a result of reactions other than FAS, where FabG is not participating. Under such circumstances, it may be of benefit if the enzyme does not react to changes in the substrate [22]. In summary, the data for the interactions of PfFabG with the reduced and oxid- ized cofactor, substrate and product, allow us to rationalize the importance of this enzyme in regulating the flux of substrates in the elongation cycle of parasite FAS. Our major focus for future research will be to identify and compare the various acyl-ACP thioester intermediates of Plasmodium FAS, as well as to have a deeper understanding of the regulation of FAS by this enzyme in P. falciparum. Experimental procedures Materials Acetoacetyl-CoA, b-hydroxybutyryl-CoA, b-NADPH, NADP + , imidazole, kanamycin, chloramphenicol and SDS ⁄ PAGE reagents were obtained from Sigma Chemicals (St Louis, MO, USA). Protein molecular weight markers were from MBI Fermentas GmbH (St Leon-Rot, Germany). His-binding resin and anti-His tag horseradish peroxidase conjugates were obtained from Novagen (Darmstadt, Ger- many). Media components were obtained from Difco TM (Detroit, MI, USA). Hi-Trap desalting and Superdex TM 200 columns were from Amersham Biosciences (Uppsala, Swe- den). All other chemicals used were of analytical grade. Strains and plasmids E. coli DH5a cells were used for cloning the b-ketoacyl- ACP reductase. The pET-28a (+) vector (Novagen) and BL21 (DE3) codon plus (Novagen) were used for the expression of FabG. Cloning of PfFabG Total RNA isolated from asynchronous cultures of P. falci- parum, treated for 45 min at 37 °C with RNase-free DNase (Promega, Madison, WI, USA; 1 UÆ l g )1 RNA), was phe- nol ⁄ chloroform extracted and ethanol precipitated, then sub- jected to RT-PCR using a one step RT-PCR kit (Qiagen, Hilden, Germany). The primers were designed to clone the protein (encompassing a 771 bp fragment, starting at posi- tion 132 and ending at position 903). The primers used for PCR were 5¢-CATG CCATGGGAAAAGTTGCTTTA GTAACAGGTGCAGGA-3¢ (NcoI site underlined) and 5¢-CCG CTCGAGAGGTGATAGTCCACCGTCTATTACG AAAACTCG-3¢ (XhoI site underlined) using PlatinumÒ Pfx DNA polymerase (Invitrogen, Carlsbad, CA, USA). The DNA sequence encoding the mature protein was amplified using the above gene-specific primers and cloned in NcoI and XhoI sites of the pET-28a (+) vector (Novagen). The PCR conditions consisted of an initial denaturation at 95 °C for 5 min, followed by amplification for 25 cycles (95 °C for 1 min, 50 °C for 50 s and 72 °C for 1 min), followed by a final extension at 72 °C for 5 min. The clone thus obtained was confirmed by DNA sequencing. The protein obtained from this clone showed higher specific activity than that from the earlier clone [23]. The specific activity of this protein pre- paration is comparable to that reported by Wickramasinghe et al. [16] and was used all throughout these studies. Expression of FabG The plasmid construct, pET-28a (+), was transformed into E. coli BL21 (DE3) codon plus competent cells. The bac- teria were grown in Luria–Bertani broth, with vigorous shaking (200 r.p.m.) at 25 °C, to an attenuance (D) of 0.6. Cells were then induced with 0.2 mm isopropyl thio-b-d- galactoside and further incubated at 15 °C for 9 h. Cells were harvested at 1500 g for 15 min at 4 °C, washed twice with LB broth and the resultant pellet was resuspended in 20 mm sodium phosphate, pH 6.8, containing 0.5 m NaCl and supplemented with a protease inhibitor cocktail tab- let, according to the manufacturer’s instructions (Roche, Mannheim, Germany). Purification of FabG The cell suspension was sonicated (Vibra-Cells; Sonics and Materials, Newtown, CT, USA). Cell debris was removed by centrifugation (10 000 g, 30 min, 4 °C). The superna- tant obtained was applied to a Ni-nitrilotriacetic acid metal-affinity column pre-equilibrated with the lysis buffer (the same as the buffer used to resuspend the pellet). The Plasmodium falciparum b-ketoacyl ACP reductase K. Karmodiya and N. Surolia 4100 FEBS Journal 273 (2006) 4093–4103 ª 2006 The Authors Journal compilation ª 2006 FEBS protein was eluted with a step gradient of 50–500 mm imi- dazole, and fractions were tested for protein purity by SDS ⁄ PAGE (12% gels). The purified protein fractions were applied onto a Hi-Trap desalting column to remove imidaz- ole, followed by concentration of the protein. Protein was determined by the Bradford method [24]. Molecular size and oligomeric status of P. falciparum FabG The subunit molecular size and oligomeric status of FabG was determined by SDS ⁄ PAGE and gel filtration, respect- ively. Purified FabG (2 mgÆmL )1 ) was loaded onto a Superdex TM 200 (1 · 30 cm) AKTA TM column, pre-equili- brated with 3 mm Hepes (pH 7.5), 100 mm NaCl, 2 mm b-mercaptoethanol and 10% glycerol. The flow rate was maintained at 0.4 mLÆ min )1 . The column was calibrated with a mixture of BSA (66 kDa), aldolase (158 kDa), cyto- chrome c (12 kDa), carbonic anhydrase (29 kDa) and chicken ovalbumin (45 kDa). The molecular weight of FabG was determined by plotting Ve ⁄ V 0 versus log of molecular mass of standard proteins. Ve corresponds to the elution vol- ume of the protein and V 0 represents the void volume of the column, determined using blue dextran (M r < 2 000 000). Enzyme assay The activity of FabG was assayed at 25 °C by monitoring the decrease in absorbance at 340 nm, spectrophotometrically, as a result of the oxidation of NADPH to NADP + (Jasco V-530 UV-visible spectrophotometer; Tokyo, Japan). The standard reaction mixture in a final volume of 100 lL con- tained 50 mm sodium phosphate buffer, pH 6.8, 0.25 m NaCl, 200 lm NADPH, 0.5 mm acetoacetyl-CoA and 0.2– 0.8 lg of FabG. The assay mixture was preincubated for 5 min at room temperature before initiating the reaction by the addition of substrate or enzyme. The reverse reaction (i.e. oxidation of b-hydroxybutyryl-CoA to acetoacetyl-CoA) was also characterized by monitoring the reduction of NADP + to NADPH, by following the increase in absorbance at 340 nm. Reactions with appropriate blanks were also per- formed. The kinetic parameters were determined by non- linear regression analyses. The data were also evaluated by double reciprocal plots. The ability of ACP to inhibit FabG activity in the spectrophotometric assay was tested by incu- bating varying concentrations of ACP with the protein at room temperature for 5 min before adding acetoacetyl-CoA to initiate the reaction. Expression and purification of holo-PfACP and apo-PfACP Holo-PfACP and apo-PfACP were obtained as described previously [25]. Purification of NADPH In order to obtain an accurate picture of negative co-opera- tivity, NADPH was purified (free of contaminating amounts of NADP + ) using a standard protocol [26]. Fluorescence titration of FabG–NADPH binding Equilibrium binding of ligands to FabG was measured by fluorescence titration at 20 °C using a Jobin-Yvon Horiba spectrofluorimeter (Edison, NJ, USA) (band-pass of 3 and 5 nm), for the excitation and emission monochromator, respectively. The fluorescence spectrum of FabG was stud- ied by exciting the samples at 280 nm and recording the emission spectrum in the range of 300–500 nm. In the absence of NADPH, fluorescence, caused by its lone trypto- phan residue, was observed in the range of 300–400 nm, with a maximum at 334 nm. However, in the presence of NADPH, while the fluorescence in the region 300–400 nm declined as a result of the quenching of its tryptophan fluorescence (k max 334 nm), fluorescence in the 400–500 nm range, with a maximum at 456 nm, appeared. When the FabG.NADPH complex was excited at 340 nm (excitation maximum of enzyme-bound NADPH), fluorescence in the same range (400–500 nm) was observed; however, its k max was 450 nm. Aliquots of 3 l L of NADPH (from stock solutions of 2, 100 and 500 lm) were added to 0.5 lm FabG in 3 mm Hepes (pH 7.5), 100 mm NaCl, 2 mm b-mercaptoethenol and 10% glycerol. The solution was mixed after the addition of each aliquot, and the fluores- cence intensity in the range of the 300–400 nm region was recorded as the average of three readings. Samples were excited at 280 nm. The effect of ACP and other ligands on NADPH binding to FabG was studied by titration of NADPH and other ligands (3 lL) into 0.5 lm FabG (3 mm Hepes, pH 7.5, 100 mm NaCl, 2 mm b-mercaptoethenol and 10% glycerol), from a stock solution of 5 mm, and the corresponding decrease in the fluorescence intensity of its lone tryptophan was monitored at 334 nm. A double-recip- rocal plot of the fluorescence intensity and ligand concen- tration, from the data obtained by titration of a fixed concentration of FabG with ligand, gave the fluorescence intensity at infinite ligand concentration (F a ). Correction for the inner filter effect was performed according to the following equation: F C ¼ F antilog½ðA ex þ A em ÞÄ2; where Fc and F are the corrected and measured fluores- cence intensities, respectively [27], and A ex and A em are the solution absorbance values at the excitation and emission wavelengths, respectively. The fluorescence data were fitted by the Adair equation [28] with number of sites n ¼ 1–4, K being the association constants: for a single site, Y ¼ KÆ[X] ⁄ (1 + KÆ[X]); for K. Karmodiya and N. Surolia Plasmodium falciparum b-ketoacyl ACP reductase FEBS Journal 273 (2006) 4093–4103 ª 2006 The Authors Journal compilation ª 2006 FEBS 4101 two sites equivalent and independent, Y ¼ (K1Æ[X] + 2K 1 Æ K 2 Æ[X] 2 ) ⁄ (1 + K 1 Æ[X] + K 1 ÆK 2 Æ[X] 2 ); for two sites equivalent and interdependent, Y ¼ (2K 1 ÆX+K 1 ÆK 2 Æ[X] 2 ) ⁄ (1 + K 1 ÆX+ K 1 ÆK 2 Æ[X] 2 ); for three sites equivalent and independent, Y ¼ (K 1 Æ[X] + 2K 1 ÆK 2 Æ[X] 2 +3K 1 ÆK 2 ÆK 3 Æ[X] 3 ) ⁄ (1 + K 1 Æ[X] + K 1 ÆK 2 Æ[X 2 ]+ K 1 ÆK 2 ÆK 3 Æ[X] 3 ); for three sites equivalent and interdependent, Y ¼ (3 K 1 Æ[X] + 2 K 1 ÆK 2 Æ[X] 2 + K 1 ÆK 2 ÆK 3 Æ[X] 3 ) ⁄ (1 + K 1 Æ[X] + K 1 ÆK 2 Æ[X] 2 + K 1 ÆK 2 ÆK 3 Æ[X] 3 ); for four sites equivalent and independent, (K 1 Æ[X] + 2K 1 ÆK 2 Æ[X] 2 + 3K 1 ÆK 2 ÆK 3 Æ[X] 3 +4K 1 ÆK 2 ÆK 3 ÆK 4 Æ[X] 4 )⁄(1 + K 1 Æ[X] + K 1 ÆK 2 Æ[X] 2 + K 1 ÆK 2 ÆK 3 Æ[X] 3 + K 1 ÆK 2 ÆK 3 ÆK 4 Æ[X] 4 ); and for four sites equiv- alent and interdependent, Y ¼ (4K 1 Æ[X] + 3 K 1 ÆK 2 Æ[X] 2 + 2K 1 ÆK 2 ÆK 3 Æ[X] 3 + K 1 ÆK 2 ÆK 3 ÆK 4 Æ[X] 4 ) ⁄(1 + K 1 Æ[X] + K 1 ÆK 2 Æ[X] 2 + K 1 ÆK 2 ÆK 3 Æ[X] 3 + K 1 ÆK 2 ÆK 3 ÆK 4 Æ[X] 4 ). All calculations were car- ried out with sigmaplot 2000 software (Systat Software Inc., CA, USA). The measure of co-operativity for cofactor binding to FabG was calculated with the Hill equation, as follows: logðY=1 À YÞ¼n H log½SÀlog K d ; where Y is the fraction of the enzyme with the bound cofactor, Y ⁄ 1 ) Y is the fraction of binding sites that are occupied for an enzyme-binding substrate, K d is the dissoci- ation constant, [S] is the cofactor concentration and n H is the Hill coefficient. Fluorescence quenching Quenching of the fluorescence of FabG by acrylamide was monitored at 334 nm. Samples were excited at 280 nm. A fresh 3 m acrylamide (14.2%) solution was made in 3 mm Hepes (pH 7.5), 100 mm NaCl, 2 mm b-mercaptoethenol and 10% glycerol. Protein (2 lm)in3mm Hepes (pH 7.5), 100 mm NaCl, 2 mm b-mercaptoethenol and 10% glycerol, was titrated with 10 lL aliquots of acrylamide from a 3 m stock. Corrections were made [29], especially applicable to proteins containing a single tryptophan [30]: Fo Fo À F ¼ 1 fK½Q þ 1 f Where F 0 and F are the initial fluorescence and the observed fluorescence in the presence of the given concen- tration of the quencher, respectively, K is the Stern–Volmer quenching constant, [Q] is the concentration of the acryl- amide (quencher) and f is the fraction of initial fluorescence which is accessible to the quencher. The plot of F 0 ⁄ (F 0 –F) versus 1 ⁄ [Q] yields f )1 as the intercept. CD measurements CD measurements were performed on a JASCO J-810 (Tokyo, Japan) spectropolarimeter at 20 °C using a 0.1 cm path length quartz cuvette, with FabG (14 · 10 ) 6 molÆl ) 1 ), NADPH (200 lm) and acetoacetyl-CoA (200 lm). Each spectrum was an accumulation of four to six consecutive scans over a wavelength range of 200 ) 250 nm (2 nm band-pass). Results are expressed as molar ellipticity (h) in deg cm 2 Ædmol ) 1 . The a-helical and b-sheet content of FabG were calculated from the [h] value at 208 nm and 217 nm, respectively, using the following equation [31]: Percentage helicity ¼ fðÀ½h 208 À 4000ÞÄð33000 À 4000Þg  100: Acknowledgements We thank the Department of Science and Technology, India, for their financial support to N.S., and the Chairman, MBU, Indian Institute of Science, for the use of the Jobin–Yvon Horiba spectrofluorimeter for these studies. References 1 World Health Organization (1999) Rolling back malaria. World Health Report 4, 49–63. 2 Moore SA, Surgey EG & Cadwgan AM (2002) Malaria vaccines: where are we and where are we going? Lancet Infect Dis 2, 737–743. 3 Asindi AA, Ekanem EE, Ibia EO & Nwangwa MA (1993) Upsurge of malaria-related convulsions in a pae- diatric emergency room in Nigeria. Consequence of emergence of chloroquine-resistant Plasmodium falci- parum. Trop Geogr Med 45, 110–113. 4 Surolia N & Surolia A (2001) Triclosan offers protec- tion against blood stages of malaria by inhibiting enoyl- ACP reductase of Plasmodium falciparum. Nat Med 7, 167–173. 5 Kapoor M, Dar MJ, Surolia A & Surolia N (2001) Kinetic determinants of the interaction of enoyl-ACP reductase from Plasmodium falciparum with its sub- strates and inhibitors. Biochem Biophys Res Commun 289, 832–837. 6 Witkowski A, Ghosal A, Joshi AK, Witkowska HE, Asturias FJ & Smith S (2004) Head-to-head arrange- ment of the subunits of the animal fatty acid synthase. Chem Biol 11, 1667–1676. 7 Smith S, Witkowski A & Joshi AK (2003) Structural and functional organization of the animal fatty acid synthase. Prog Lipid Res 42, 289–317. 8 Ramya TNC, Surolia N & Surolia A (2002) Survival strategies of the malarial parasite Plasmodium falci- parum. Curr Sci 83, 101–108. 9 Surolia A, Ramya TNC, Ramya V & Surolia N (2004) ‘FAS’t inhibition of malaria. Biochem J 383, 1–12. 10 Sharma S, Ramya TNC, Surolia A & Surolia N (2003) Triclosan as a systemic antibacterial agent in a mouse model of acute bacterial challenge. Antimicrob Agents Chemother 47, 3859–3866. Plasmodium falciparum b-ketoacyl ACP reductase K. Karmodiya and N. Surolia 4102 FEBS Journal 273 (2006) 4093–4103 ª 2006 The Authors Journal compilation ª 2006 FEBS [...]... value of 0.949, with an excellent fit to the experimental values Fig S2 Intrinsic fluorescence quenching of b-ketoacylacyl carrier protein reductase (FabG) saturated with NADPH by acetoacetyl-CoA and the product, b-hydroxybutyryl-CoA Fig S3 Intrinsic fluorescence quenching of b-ketoacylacyl carrier protein reductase (FabG) by NADP+ Table S1 Binding constants (Ka) of various ligands to b-ketoacyl -acyl carrier. .. of Brassica napus beta-keto acyl carrier protein reductase and its implications for substrate binding and catalysis Structure 8, 339–347 20 Price AC, Zhang YM, Rock CO & Stephen WW (2001) Structure of beta-ketoacyl- [acyl carrier protein] reductase from Escherichia coli: negative cooperativity and its structural basis Biochemistry 40, 12772–12781 21 Price AC, Zhang YM, Rock CO & Stephen WW (2004) Cofactor-induced... (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein util- Plasmodium falciparum b-ketoacyl ACP reductase 25 26 27 28 29 30 31 izing the principle of protein- dye binding Anal Biochem 72, 248–254 Sharma SK, Modak R, Sharma S, Sharma AK, Sarma SP, Surolia A & Surolia N (2005) A novel approach for over-expression, characterization, and isotopic enrichment of a homogeneous... inhibition of Plasmodium falciparum b-hydroxyacyl -acyl carrier protein dehydratase (FabZ) J Biol Chem 278, 45661–45671 Campanacci V, Lartigue A, Hallberg BM, Jones TA, Orticoni MTG, Tegoni M & Cambillau C (2003) Moth chemosensory protein exhibits drastic conformational changes and cooperativity on ligand binding Proc Natl Acad Sci USA 100, 5069–5074 Tyson PA & Steinberg M (1987) Accessibility of tryptophan... Karmodiya and N Surolia 11 Rock CO & Cronan JE (1996) Escherichia coli as a model for the regulation of dissociable (type II) fatty acid synthesis Biochim Biophys Acta 1302, 1–16 12 Majerus PW (1968) Acyl carrier protein: effects of acetylation and tryptic hydrolysis on function in fatty acid synthesis Science 159, 428–430 13 Zhang Y & Cronan JE Jr (1998) Transcriptional analysis of essential genes of the... species of acyl carrier protein from Plasmodium falciparum Biochim Biophys Res Commun 330, 1019–1026 Markham KA, Sikorski RS & Kohen A (2003) Purification, analysis and preservation of reduced nicotinamide adenine dinucleotide 2¢-phosphate Anal Biochem 322, 26–32 Sharma SK, Kapoor M, Ramya TNC, Kumar S, Kumar G, Modak R, Sharma S, Surolia N & Surolia A (2003) Identification, characterization, and inhibition... competent active site and a proton relay conduit in FabG Structure 12, 417–428 22 Suzuki Y, Moriyoshi E, Tsuchiya D & Jingami H (2004) Negative cooperativity of glutamate binding in the dimeric metabotropic glutamate receptor subtype 1 J Biol Chem 279, 35526–35534 23 Pillai S, Rajagopal C, Kapoor M, Kumar G, Gupta A & Surolia N (2003) Functional characterization of b-ketoacyl-ACP reductase (FabG) from... b-ketoacylacyl carrier protein reductase (FabG) by NADP+ Table S1 Binding constants (Ka) of various ligands to b-ketoacyl -acyl carrier protein reductase (FabG) at 20 °C, using the changes in protein and ⁄ or cofactor fluorescence intensity This material is available as part of the online article from http://www.blackwell-synergy.com FEBS Journal 273 (2006) 4093–4103 ª 2006 The Authors Journal compilation... 3-oxoacyl-ACP reductase from Plasmodium falciparum, a key enzyme in fatty acid biosynthesis Biochem J 393, 447–457 17 Byeon L, Shi Z & Tsai MD (1995) Mechanism of adenylate kinase The ‘essential lysine’ helps to orient the phosphates and the active site residues to proper conformations Biochemistry 34, 3172–3182 18 Fawcett T, Copse CL, Simon JW & Slabas AR (2000) Kinetic mechanism of NADH-enoyl-ACP reductase. .. tryptophan residues in Na,K-ATPase J Biol Chem 262, 4644– 4648 Eftink MR & Ghiron CA (1976) Exposure of tryptophanyl residues in proteins Quantitative determination by fluorescence quenching studies Biochemistry 15, 672–680 Liu J, Tian J, He W, Xie J, Hu Z & Chen X (2004) Spectrofluorimetric study of the binding of daphnetin to bovine serum albumin J Pharm Biomed Anal 35, 671– 677 Supplementary material The . Analyses of co-operative transitions in Plasmodium falciparum b-ketoacyl acyl carrier protein reductase upon co-factor and acyl carrier protein binding Krishanpal. in the presence of acyl carrier pro- tein. Acyl carrier protein increases the accessibility of NADPH to b-keto- acyl- acyl carrier protein reductase, as evident