Báo cáo khoa học: Differential gene expression in periportal and perivenous mouse hepatocytes potx

Differential gene expression in periportal and perivenous mouse hepatocytes Albert Braeuning1, Carina Ittrich2, Christoph Kohle1, Stephan Hailnger1, Michael Bonin3, ă Albrecht Buchmann1 and Michael Schwarz1 Institute of Pharmacology and Toxicology, Department of Toxicology, University of Tuebingen, Germany Central Unit of Biostatistics, German Cancer Research Center, Heidelberg, Germany Institute for Human Genetics, Microarray Facility, Tuebingen, Germany Keywords metabolic zonation; microarray analysis; mouse liver; zonal gene expression Correspondence M Schwarz, Institute of Pharmacology and Toxicology, Department of Toxicology, University of Tuebingen, Wilhelmstr 56, 72074 Tuebingen, Germany Fax: +49 7071 29 2273 Tel: +49 7071 29 77398 E-mail: michael.schwarz@uni-tuebingen.de (Received 24 July 2006, revised 15 September 2006, accepted 18 September 2006) doi:10.1111/j.1742-4658.2006.05503.x Hepatocytes located in the periportal and perivenous zones of the liver lobule show remarkable differences in the levels and activities of various enzymes and other proteins To analyze global gene expression patterns of periportal and perivenous hepatocytes, enriched populations of the two cell types were isolated by combined collagenase ⁄ digitonin perfusion from mouse liver and used for microarray analysis In total, 198 genes and expressed sequences were identified that demonstrated a ‡ 2-fold difference in expression between hepatocytes from the two different zones of the liver A subset of 20 genes was additionally analyzed by real-time RT-PCR, validating the results obtained by the microarray analysis Several of the differentially expressed genes encoded key enzymes of intermediary metabolism, including those involved in glycolysis and gluconeogenesis, fatty acid degradation, cholesterol and bile acid metabolism, amino acid degradation and ammonia utilization In addition, several enzymes of phase I and phase II of xenobiotic metabolism were differentially expressed in periportal and perivenous hepatocytes Our results confirm previous findings on metabolic zonation in liver, and extend our knowledge of the regulatory mechanisms at the transcriptional level Hepatocytes play a pivotal role in both the synthesis and degradation of numerous endogenous biomolecules, thus maintaining metabolic homeostasis, as well as in the conversion and detoxification of xenobiotic compounds Based on the location of the blood vessels, the terminal branches of the portal and the hepatic (central) veins and on the direction of the blood flow, hepatocytes of each liver lobule can be divided into two subpopulations, an upstream ‘periportal’ and a downstream ‘perivenous’ (pericentral) population Zonal-specific differences in the metabolic capacities of many enzymes or other proteins, and – to a lesser extent ) of their corresponding messenger RNAs, have been subject to extensive studies throughout the last decades Many enzymes of intermediary metabolism are not distributed uniformly throughout the liver, but are preferentially expressed in either the periportal or the perivenous hepatocyte subpopulation [1–3] Hence, hepatocytes located in either of the two regions have different, often complementary, functions Whereas, for example, glycolysis is exclusively active in perivenous hepatocytes, key enzymes of gluconeogenesis, the antagonist pathway, are preferentially expressed in periportal hepatocytes [1] Zonal-specific expression has also been established for enzymes of amino acid and ammonia metabolism, showing, for example, a higher activity of the urea cycle in periportal cells compared to perivenous hepatocytes [3], whereas glutamine synthesis is exclusively active in the perivenous Abbreviations GS, glutamine synthetase FEBS Journal 273 (2006) 5051–5061 ª 2006 The Authors Journal compilation ª 2006 FEBS 5051 Zonal gene expression in mouse liver A Braeuning et al subpopulation [4] The list of zonally expressed enzymes can be further extended to metabolic pathways such as glycogen synthesis, lipid metabolism and bile acid formation [1] Many enzymes of xenobiotic metabolism also exhibit zonal-specific differences in protein or mRNA levels, with preferential perivenous expression of the main detoxification enzymes such as the cytochrome P450 monooxygenase isoforms [5] Two different types of zonation can be distinguished, so-called ‘dynamic zonation’ and ‘stable zonation’ Whereas some zonally expressed genes, particularly those encoding enzymes of carbohydrate metabolism, undergo dynamic changes in expression as an adaptive response to changes in hormonal or nutritional status [6], a second group of genes is more or less stably expressed within only a few layers of hepatocytes of the liver lobule, either perivenous or periportal, and can hardly be affected by external stimuli One of the best-known examples of proteins with stable zonal expression is the enzyme glutamine synthetase (GS), which is expressed at high levels within only one to two layers of hepatocytes surrounding the central veins [4] Previous studies on zonation of metabolic pathways in the liver were mainly focused on analysis of protein expression or measurements of enzyme activities in rat liver, but comparatively few data are available on mRNA expression levels, especially in mice It is therefore largely unknown whether zonal gene expression is regulated primarily at the transcriptional or post-translational level We have now investigated by microarray analysis the global gene expression patterns of periportal and perivenous hepatocytes to identify those proteins that are subject to differential transcriptional regulation in the two hepatocyte subpopulations Results Expression profiles of perivenous and periportal hepatocytes Perivenous and periportal mouse hepatocyte fractions were obtained by combined digitonin ⁄ collagenase perfusion of liver of male C3H ⁄ He mice The efficiency of hepatocyte separation was monitored by western analysis of marker proteins with well-known zonal differences in expression, e.g GS, a perivenous marker, and E-cadherin, a periportal marker; this demonstrated the expected differences in levels between periportal and perivenous hepatocytes (Fig 1) The RNA expression patterns of hepatocyte fractions were analyzed by use of the Affymetrix GeneChip MOE-430A, which contains approximately 22 600 probe sets, including more 5052 pv pp GS E-Cad Gpr49 Cyp1A GAPDH Fig Western analysis of marker protein levels in protein extracts from perivenous (pv) and periportal (pp) hepatocyte subpopulations enriched by digitonin ⁄ collagenase perfusion The indicated proteins are known to show marked zonal differences in expression in liver and were therefore chosen as ‘markers’ for periportal and perivenous hepatocytes Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a loading control GS, glutamine synthetase; E-cad, E-cadherin; Gpr49, G-protein-coupled receptor 49; Cyp1A, cytochrome P450 1A than 14 000 well-characterized mouse genes Genes were stratified into two groups according to their preferential perivenous or preferential periportal expression, using as discriminators a Œlog2 expression ratio Œ ‡ (corresponding to a ‡ 2-fold difference in expression) and an adjusted P-value £ 0.1 In total, we identified 198 genes and expressed sequences that were differentially regulated in hepatocytes from the two different zones of the liver; 99 of these were predominantly expressed in perivenous cells, whereas another 99 were mainly expressed in periportal hepatocytes A detailed list of the differentially expressed genes is provided in supplementary Table S1 Note that the number of probe sets with significant differences in expression was somewhat higher than 198, because several genes were represented more than once on the array Figure shows a so-called Volcano plot, where, for each of the  22 600 probe sets, the mean of the adjusted P-values is plotted against its corresponding mean log2 ratio Probe sets meeting the criteria of significance are shown in the gray areas of the plot Genes with preferential perivenous expression FEBS Journal 273 (2006) 5051–5061 ª 2006 The Authors Journal compilation ª 2006 FEBS A Braeuning et al Zonal gene expression in mouse liver Fig Volcano plot demonstrating differences in gene expression between periportal and perivenous hepatocytes Each of the  22 600 transcripts is represented by a single dot Discriminators (P ¼ 0.1 for the adjusted P-value and |log2 expression ratio| ‡ 1) are indicated by horizontal and vertical lines; these were chosen to identify genes with significant alterations in expression (areas indicated by gray) One hundred and twenty-nine probe sets (corresponding to 99 transcripts) were predominantly expressed in perivenous cells, showing positive log2 ratios, whereas another 114 probe sets (corresponding to another 99 transcripts) were mainly expressed in periportal hepatocytes, showing negative log2 ratios show positive log2 ratios in the plot, whereas genes with preferential periportal expression show negative log2 ratios To validate these data, the expression of 20 (10%) of the zonated genes found in the microarray experiment was additionally analyzed by real-time RT-PCR The PCR data closely resembled the findings of the microarray analysis A comparison of the results obtained with the two methods is shown in Table Differences in genes encoding enzymes of intermediary metabolism The results of our present microarray analysis clearly demonstrate differences between perivenous and periportal hepatocytes in the expression of genes encoding key enzymes of zonated pathways of intermediary metabolism This holds particularly true for genes encoding enzymes playing a role in pathways that are known to be stably zonated within the liver lobule A schematic representation of the observed differences in selected metabolic pathways is given in Figs and perivenous cells These include the genes encoding sorbitol dehydrogenase (EC 1.1.1.14), aldehyde reductase (EC 1.1.1.21), 6-phosphofructo-2-kinase (EC 2.7.1.105), dihydrolipoamide-S-transferase (EC 2.3.1.2), and isocitrate dehydrogenase (EC 1.1.1.41) Only one gene of this pathway, that encoding pyruvate kinase (EC 2.7.1.40), was found to be mainly expressed in periportal hepatocytes The gene encoding phosphoenolpyruvate carboxykinase (EC 4.1.1.32), one of the key enzymes in gluconeogenesis, is primarily expressed in periportal hepatocytes The same holds true for the gene encooding ATP citrate lyase (EC 2.3.3.8), an enzyme forming oxaloacetate and acetyl-CoA from citrate for further utilization in gluconeogenesis and cholesterol synthesis, respectively When the discrimination level was lowered to a Œlog2 expression ratio Œ‡ 0.5, additional genes encoding enzymes involved in glucose metabolism were found to be zonated, such as the gene encoding the tricarboxylic acid cycle component citrate synthase (EC 2.3.3.1), which is preferentially expressed in perivenous hepatocytes Glycolysis and gluconeogenesis Fatty acid degradation and cholesterol metabolism As shown in Fig 3A, several genes encoding enzymes participating in glycolysis are preferentially expressed in Zonal-specific differences in the expression of genes encoding enzymes involved in fatty acid degradation FEBS Journal 273 (2006) 5051–5061 ª 2006 The Authors Journal compilation ª 2006 FEBS 5053 Zonal gene expression in mouse liver A Braeuning et al Table Validation of microarray analysis data by real-time RT-PCR If genes are represented by more than one probe set on the chip, their individual log2 ratios are shown Genes preferentially expressed in perivenous (pv) hepatocytes are indicated by positive log2 ratios, and periportal (pp) expression is indicated by negative log2 ratios Log2 ratios of PCR analysis represent the mean log2 ratios from comparison of the same three periportal and perivenous hepatocyte isolates that were used for the microarray analysis Gene Glutamine synthetase (glul) Ornithine aminotransferase (oat) Serine dehydratase (Sds) 6-Phosphofructo-2-kinase ⁄ fructose-2,6-bisphosphatase (Pfkfb1) Phosphoenolpyruvate carboxykinase 1, cytosolic (Pck1) Cytochrome P450 1a2 (Cyp1a2) Cytochrome P450 2e1 (Cyp2e1) Cytochrome P450 2f2 (Cyp2f2) Sulfotransferase 5a1 (Sult5a1) Aldehyde dehydrogenase 1B1 (Aldh1b1) Cytochrome P450 7a1 (Cyp7a1) ATP citrate lyase (Acly) Cathepsin C (Ctsc) G protein-coupled receptor 49 (Gpr49) Constitutive androstane receptor (Nr1i3) Aryl-hydrocarbon receptor (Ahr) Hairy and enhancer of split (Hes1) Catenin beta interacting protein (Ctnnbip1) Cadherin (Cdh1) Rhesus blood group-associated B glycoprotein (Rhbg) Log2 ratio(s) pv versus pp (microarray) Log2 ratio pv versus pp (PCR) 6.23 ⁄ 3.72 5.91 ) 6.04 1.41 4.21 5.56 ) 5.55 1.29 ) 2.63 ) 3.12 2.53 1.69 ) 2.67 ) 3.03 ) 6.07 3.04 4.12 ) 4.58 ) 3.39 ) 4.98 3.42 ⁄ 2.55 ) 1.36 ⁄ ) 1.44 ⁄ ) 1.63 ) 3.77 2.63 1.65 2.69 ) 1.83 1.53 ) 1.90 ) 1.81 1.19 ) 1.49 ) 3.48 ) 4.39 4.12 ) 5.58 4.86 ) 3.17 8.10 1.39 and cholesterol metabolism are shown in Fig 3B For example, mRNAs coding for phosphatide phosphatase (EC 3.1.3.4) and apoliprotein C-II, an essential cofactor for the activation of lipoprotein lipase (EC 3.1.1.34), are preferentially expressed in periportal hepatocytes As mentioned above, preferential periportal expression is also observed for the acetyl-CoAforming enzyme ATP citrate lyase (EC 2.3.3.8), which provides acetyl-CoA for cholesterol synthesis However, the mRNAs for HMG-CoA synthase and HMGCoA reductase, the enzymes catalyzing the initial steps in cholesterol formation from acetyl-CoA, failed the criteria of significance in our microarray analysis Bile acid synthesis is another pathway known to be active only in perivenous hepatocytes [2] The key enzyme in this pathway is cytochrome P450 7A1 (EC 1.14.13.17) This enzyme, catalyzing the rate-limiting step in bile 5054 acid formation, is regulated at the level of mRNA, which was found to be expressed to a much greater extent in perivenous than in periportal hepatocytes At a lower cutoff ( Œlog2 expression ratio Œ‡ 0.5) cytochrome P450 27A1 (EC 1.14.13.15), an enzyme involved in side chain oxidation of sterol intermediates during bile acid formation, appeared to be zonated (preferentially perivenous) Amino acid degradation Figure 3C demonstrates differences in expression of the genes encoding enzymes of histidine and serine ⁄ glycine catabolism Three genes encoding enzymes of histidine catabolism, histidine ammonia lyase (EC 4.3.1.3), urocanate hydratase (EC 4.2.1.49) and glutamate formiminotransferase (EC 2.1.2.5), are exclusively expressed in periportal hepatocytes Additionally, mRNA for histamine-N-methyltransferase (EC 2.1.1.8), an enzyme of histamine metabolism, is also mainly expressed in the periportal hepatocyte subpopulation A comparable periportal zonation on the mRNA level can be observed for genes encoding enzymes of serine ⁄ glycine metabolism, including glycine decarboxylase (EC 1.4.4.2), serine dehydratase (EC 4.3.1.17), and serine dehydratase-like (EC 4.3.1.19) Oxaloacetate, the product of the reaction catalyzed by the latter enzymes, can be used for gluconeogenesis, a pathway that is also mainly located in periportal hepatocytes [1] Ammonia utilization As shown in Fig 3D, ammonia is used in perivenous hepatocytes for glutamine synthesis, as GS (EC 6.3.1.2), the key enzyme, is specifically expressed in this hepatocyte subpopulation Comparable zonation is found for transporters participating in ammonia (rhesus blood group-associated B glycoprotein) and glutamate uptake (solute carriers 1A2 and 1A4), thus providing the substrates for GS In contrast, periportal hepatocytes are lacking GS and use ammonia for urea synthesis With less stringent cutoff conditions, the mRNAs of four enzymes of the urea cycle were found to be preferentially localized in the periportal area, namely ornithine transcarbamylase (EC 2.1.3.3), argininosuccinate synthetase (EC 6.3.4.5), argininosuccinate lyase (EC 4.3.2.1), and arginase (EC 3.5.3.1), showing log2 expression ratios between 0.58 and 0.82 Xenobiotic metabolism As expected, many genes encoding enzymes of xenobiotic metabolism were mainly expressed in perivenous FEBS Journal 273 (2006) 5051–5061 ª 2006 The Authors Journal compilation ª 2006 FEBS A Braeuning et al Zonal gene expression in mouse liver 1.1.1.14 sugar alcohols A sugars Lipoproteins B APOC2 + 1.1.1.21 glucose activation 3.1.1.34 diacylglycerol-P 2.7.1.2 3.1.3.4 glucose-6-P diacylglycerol 2.7.1.105 / 3.1.3.46 fructose2,6-bis-P fructose-6-P + allosteric activation fructose1,6-bis-P 2.7.1.40 pyruvate 4.1.1.32 Phosphoenolpyruvate 4.1.1.32 2.3.1.12 cholesterol gluconeogenesis 2.7.1.11 1.14.13.17 acetyl-CoA oxaloacetate 2.3.3.8 bile acids citrate acetyl-CoA oxaloacetate 2.3.3.8 oxaloacetate citrate glutamine urea cycle ornithine citrate 1.1.1.41 ammonia histidine 4.3.1.3 glycine histamine 2.1.1.8 C 6.3.1.2 2.6.1.13 glutamate 4.2.1.49 ammonia amino acid degradation 1.4.4.2 Slc1A2 urocanate D Slc1A4 Rhbg serine N-methylhistamine 4.3.1.17 4.3.1.19 N-formiminoglutamate 2.1.2.5 glutamate pyruvate excretion periportal perivenous oxaloacetate gluconeogenesis no zonation 4.1.1.32 perivenous (only on protein level) RNA periportal, protein equally distributed Fig Zonal differences in expression of genes encoding enzymes and other proteins involved in intermediary metabolism Perivenous expression is indicated by green, and genes with preferential periportal expression are indicated by red (A) Perivenous zonation of glycolysis and periportal zonation of gluconeogenesis (B) Fatty acid degradation and cholesterol metabolism in periportal hepatocytes (C) Elevated amino acid degradation in periportal hepatocytes (D) Ammonia utilization for glutamine synthesis in perivenous hepatocytes EC 1.1.1.14, L-iditol-2-dehydrogenase (sorbitol dehydrogenase) (gene name: Sdh); EC 1.1.1.21, aldehyde reductase (Akr1b3); EC 2.7.1.2, glucokinase; EC 2.7.1.105 ⁄ EC 3.1.3.46, 6-phosphofructo-2-kinase ⁄ fructose-2,6-bisphosphatase (bifunctional enzyme) (PfkFB1); EC 2.7.1.11, 6-phosphofructokinase; EC 2.7.1.40, pyruvate kinase liver and red blood cell (Pklr); EC 2.3.1.12, dihydrolipoamide-S-transferase (E2 component of pyruvate dehydrogenase complex) (Dlat); EC 1.1.1.41, isocitrate dehydrogenase NAD+ (Idh3a); EC 4.1.1.32, phosphoenolpyruvate carboxykinase 1, cytosolic (pck1); EC 2.3.3.8, ATP citrate lyase (Acly); APOC2, apolipoprotein C-II (essential cofactor for the activation of lipoprotein lipase); EC 3.1.1.34, lipoprotein lipase; EC 3.1.3.4, phosphatide phosphatase type 2c (Ppap2c); EC 1.14.13.17, cytochrome P450 7A1 (cholesterol-7a-monooxygenase) (Cyp7a1); EC 4.3.1.3, histidine ammonia lyase (Hal); EC 4.2.1.49, urocanase domain containing (urocanate hydratase) (Uroc1); EC 2.1.2.5, glutamate formiminotransferase (Ftcd); EC 2.1.1.8, histamine-N-methyltransferase (Hnmt); EC 1.4.4.2, glycine decarboxylase (part of glycine dehydrogenase complex) (Gldc); EC 4.3.1.17, serine dehydratase (Sds); EC 4.3.1.19, serine dehydratase-like (Sdsl); EC 2.6.1.13, ornithine aminotransferase (oat); EC 6.3.1.2, glutamate ammonia ligase (glutamine synthetase) (glul); Slc1A2, solute carrier 1A2; Slc1A4, solute carrier 1A4; Rhbg, rhesus blood group-associated B glycoprotein hepatocytes A list of these genes is given in Table This holds true both for enzymes of phase I xenobiotic metabolism, e.g various cytochrome P450 monooxygenases, and for phase II enzymes, e.g several isoforms of glutathione-S-transferases and sulfotransferases Other genes involved in xenobiotic metabolism, FEBS Journal 273 (2006) 5051–5061 ª 2006 The Authors Journal compilation ª 2006 FEBS 5055 Zonal gene expression in mouse liver A Braeuning et al portal vein central vein blood flow oxygen tension O2 O2 hormones, growth factors -catenin signaling gluconeogenesis glycolysis fatty acid degradation cholesterol biosynthesis bile acid synthesis amino acid degradation glutamine synthesis metabolism of xenobiotics Fig Schematic representation of metabolic processes taking place in different hepatocyte subpopulations along the portocentral axis The figure summarizes the activities of zonated pathways shown in detail in Fig and additionally shows the gradients in oxygen tension, hormones ⁄ growth factors, and b-catenin signaling that have been suspected to influence zonal gene expression in the liver [1,5,22,25] such as cytochrome P450 oxidoreductase and receptors activating enzymes of xenobiotic metabolism, namely the constitutive androstane receptor and the aryl hydrocarbon receptor, are also preferentially expressed in hepatocytes near the central veins Some exceptions with preferential expression in periportal hepatocytes, however, were also observed, such as sulfotransferase 5a1 and glutathione-S-transferase alpha Discussion Upon separation of hepatocytes from the periportal and perivenous zones of the liver lobule,  200 genes or expressed sequence tags were identified, which were differentially expressed between the two cell subpopulations These included several genes encoding enzymes that are rate-limiting in distinct metabolic pathways of intermediary metabolism and show well-established zonal heterogeneity in liver [1–3], demonstrating that they are, at least in part, regulated by zonal differences at the transcriptional level or by zonal-specific 5056 post-transcriptional mechanisms affecting the stability of their mRNAs The zonally expressed pathways showing striking differences in mRNA levels of several genes are shown in Figs and Among them are several genes encoding enzymes participating in glycolysis that are preferentially expressed in perivenous cells, whereas mRNAs for key enzymes in gluconeogenesis, the antagonist pathway to glycolysis, are primarily expressed in periportal hepatocytes These results confirm previous observations on the zonation of glycolysis and gluconeogenesis in the liver, but also reveal zonal expression of genes involved in glucose metabolism that have not previously been reported as zonated For example, perivenous localization was demonstrated for the mRNAs of sorbitol dehydrogenase and aldehyde reductase, which are involved in carbohydrate conversion processes that provide glucose for further metabolism in glycolysis Neither of these enzymes has been previously reported to be differentially expressed between perivenous and periportal hepatocytes However, the FEBS Journal 273 (2006) 5051–5061 ª 2006 The Authors Journal compilation ª 2006 FEBS A Braeuning et al Zonal gene expression in mouse liver Table Zonated genes involved in xenobiotic metabolism If genes are represented by more than one probe set on the chip, their individual log2 ratios are shown Genes preferentially expressed in perivenous (pv) hepatocytes are indicated by positive log2 ratios, and periportal (pp) expression is indicated by negative log2 ratios Gene Cytochrome P450 2a4 ⁄ 2a5 Glutathione-S-transferase mu Glutathione-S-transferase mu Carboxylesterase Glutathione-S-transferase mu Cytochrome P450 2c50 ⁄ 2c54 Cytochrome P450 1a2 Cytochrome P450 2c55 Cytochrome P450 2c29 Cytochrome P450 2g1 Cytochrome P450 oxidoreductase Cytochrome P450 2e1 Constitutive androstane receptor Aryl-hydrocarbon receptor Cytochrome P450 2c38 Glutathione-S-transferase alpha Sulfotransferase 1B1 Sulfotransferase 1D1 Glutathione-S-transferase mu Glutathione-S-transferase alpha Arsenic methyltransferase Cytochrome P450 2f2 Sulfotransferase 5a1 Aldehyde dehydrogenase 1b1 Log2 ratio(s) pv versus pp ) ) ) ) ) 6.43 4.36 ⁄ 2.31 4.19 3.59 3.13 2.98 2.53 2.35 2.34 2.00 1.85 1.69 1.65 1.53 1.48 1.34 1.16 1.03 ⁄ 1.01 1.01 1.09 1.51 2.67 3.03 6.07 mRNA for glucokinase, the key enzyme in initiation of glucose degradation, was not found to be zonated in our microarray analysis, which is in line with previous observations that the preferential perivenous localization of glucokinase activity is regulated on a posttranslational level [7] Other mRNAs, mainly expressed in perivenous cells, code for 6-phosphofructo-2-kinase, which produces fructose-2,6-bisphosphate, an allosteric activator of the glycolytic enzyme 6-phosphofructo-1kinase and an inhibitor of the gluconeogenic enzyme fructose-1,6-bisphosphatase [8] The mRNA for the latter enzyme was not zonated in our analysis, confirming a previous study describing homogeneous distribution of 6-phosphofructo-1-kinase in the liver [9] Dihydrolipoamide-S-transferase, the core component of the pyruvate dehydrogenase complex, and isocitrate dehydrogenase, an enzyme of the tricarboxylic acid cycle, were also preferentially expressed in perivenous hepatocytes Perivenous zonation of citrate synthase is in line with previous observations describing higher perivenous activity of the enzyme in rat liver [10] Although there are no previous reports describing zonation of dihydrolipoamide-S-transferase, the preferential mRNA expression of isocitrate dehydrogenase in perivenous hepatocytes is in accordance with the known perivenous activity of this enzyme [11,12] The only gene of the glycolytic pathway that is mainly expressed in periportal hepatocytes is that encoding pyruvate kinase The metabolic capacity of the respective protein, however, was found to be equally distributed throughout the liver lobuli [13], or to be even higher in the perivenous zone [14], suggesting a post-transcriptional regulation mechanism for this enzyme On the other hand, periportal zonation of gluconeogenesis and particularly of phosphoenolpyruvate carboxykinase, has been reported before [1] Fatty acid degradation is another metabolic pathway underlying zonal expression in liver, as two genes, those encoding phosphatide phosphatase and apolipoprotein C2, a cofactor for activation of lipoprotein lipase, were found in our study to be preferentially expressed in the periportal hepatocyte subpopulation Zonal-specific expression of these genes has not been reported so far, but our findings are in line with previous observations of the periportal localization of fatty acid degradation [15] Bile acid synthesis from cholesterol takes place in perivenous hepatocytes, as the key enzyme of this metabolic pathway, cholesterol-7-amonooxygenase, is preferentially expressed in hepatocytes surrounding the central veins [16] Our analysis confirms previous findings on the zonation of cholesterol-7-a-monooxygenase protein [17] and mRNA [16] The mRNA levels for ATP citrate lyase, an enzyme forming acetyl-CoA from citrate, thus providing substrate molecules for cholesterol synthesis, were higher in periportal hepatocytes, which is in line with a report by Evans et al [18] describing periportal localization of the protein However, another study found ATP citrate lyase protein to be more active in the perivenous zone [19] Our microarray data, confirmed by real-time PCR experiments, clearly demonstrate periportal localization of the mRNA for this enzyme The metabolism of several amino acids has also been reported to be differentially regulated in the two zones of the liver [1–3] Our present results indicate that histidine degradation seems to take place mainly in periportal hepatocytes, as mRNAs for several enzymes of histidine catabolism, namely histidine ammonia lyase, urocanate hydratase, glutamate formiminotransferase and histamine-N-methyltransferase, are preferentially expressed in periportal hepatocytes Zonal-specific expression of these genes in mouse liver has not been reported in the literature so far Comparable periportal zonation on the mRNA level can be observed for the FEBS Journal 273 (2006) 5051–5061 ª 2006 The Authors Journal compilation ª 2006 FEBS 5057 Zonal gene expression in mouse liver A Braeuning et al enzymes of serine ⁄ glycine metabolism: Glycine decarboxylase, a component of the glycine dehydrogenase complex that converts glycine to serine, is predominantly expressed in periportal cells; the same holds true for the enzymes of serine catabolism, namely serine dehydratase and serine dehydratase-like This is in agreement with results of previous studies describing periportal localization of serine dehydratase at the mRNA level [20] Enhanced serine metabolism in periportal hepatocytes may contribute to the availability of substrates for gluconeogenesis, a pathway that is also located mainly in periportal hepatocytes [1] By contrast, glutamine synthesis occurs mainly in perivenous hepatocytes, as mRNA for GS, the key enzyme, is specifically expressed in this hepatocyte subpopulation, which is in accordance with previous observations [4] Notably, mRNAs for transporters participating in ammonia and glutamate uptake also show preferential perivenous localization, thus providing the substrates for GS The ammonium transporter rhesus blood group-associated B glycoprotein has been previously reported to be expressed only in perivenous hepatocytes at both the protein [21] and mRNA [22] levels Zonation of the glutamate transporter solute carrier 1A2 has already been established [23], whereas the preferential perivenous localization of solute carrier 1A4 has not been described so far The urea cycle has been reported to be mainly localized in periportal hepatocytes [1,2] Our data now suggest that this localization is based on differences in mRNA levels of four enzymes of the urea cycle Whereas the zonal-specific expression of the main enzymes of drug and xenobiotic metabolism has been the subject of extensive research (e.g cytochrome P450 zonation [5]), the zonal expression profiles of the more uncommon cytochrome P450 isoforms have mostly not been described in the literature For example, up to now cytochrome P450 2G1 (Cyp2g1) has been considered to be exclusively expressed in the olfactory mucosa in mammals [24] Whereas the mRNAs for most xenobiotic-metabolizing enzymes are mainly expressed in hepatocytes near the central veins, a small number of these enzymes exhibit preferential periportal expression The periportal localization of these mRNAs has not been reported in the literature so far The mechanisms underlying zonal gene expression in the liver are not yet fully understood Based on comparisons of mRNA ⁄ protein expression patterns of perivenous and periportal hepatocytes with those of liver tumors containing activating mutations in either the Ha-ras or ctnnb1 (catnb; b-catenin) gene, we developed the hypothesis that two opposing signaling pathways triggered by Ha-ras- and b-catenin-dependent factors 5058 may determine zonal differences in gene expression in murine liver [22] In addition, the adenomatous polyposis coli (APC) tumor suppressor gene, an important regulator of b-catenin signaling, has also been established as a ‘zonation-keeper’ in mouse liver [25] Further studies, however, are required to unravel the molecular details and interplay of the various players involved In summary, our findings show that several of the well-documented zonal differences in the levels and activities of key enzymes of various pathways of intermediary metabolism can be explained, at least in part, by corresponding differences at the mRNA level in periportal and perivenous hepatocytes, indicating that regulation at the transcriptional level or by mechanisms controlling mRNA stability are important factors determining their zonal expression in liver In addition, we found that several other genes with unknown localization in the liver show distinct expression differences between periportal and perivenous hepatocytes Among these are genes coding for proteins involved in well-established zonated but also other pathways that have not been described so far as being differentially expressed in murine liver Experimental procedures Animal experiments For microarray analysis of mRNA expression patterns in periportal and perivenous hepatocyte subpopulations, male C3H ⁄ He mice were killed at 10 weeks of age and hepatocyte fractions were isolated as described below Mice were kept on a 12 h dark ⁄ light cycle and were killed between and 11 a.m to avoid circadian influences Animals received humane care, and protocols complied with institutional guidelines Isolation of hepatocytes Periportal and perivenous subpopulations of hepatocytes were isolated and enriched by combined digitonin ⁄ collagenase perfusion of the liver according to Taniai et al [26], with minor modifications as described previously [22] First, the liver was perfused for 10 with Krebs ⁄ Henseleit buffer at 37 °C To obtain periportal hepatocyte subpopulations, a mm digitonin solution was infused for 10 s through the vena cava and then immediately flushed out from the opposite direction To obtain perivenous hepatocytes, the digitonin solution was infused through the portal vein After digitonin treatment, the liver was perfused with collagenase solution Subsequently, viable hepatocytes were separated by density gradient centrifugation Viability of the resulting hepatocyte fractions was always  80–90% as determined by trypan blue staining The efficiency of FEBS Journal 273 (2006) 5051–5061 ª 2006 The Authors Journal compilation ª 2006 FEBS A Braeuning et al Zonal gene expression in mouse liver separation of hepatocytes into periportal and perivenous subfractions was determined by real-time RT-PCR analysis of GS expression and western blotting for marker proteins as described below Microarray analysis and statistical evaluation of data The Affymetrix GeneChip MOE-430A (Affymetrix, Santa Clara, CA, USA) was used for mRNA expression profiling Six chips were hybridized with cRNA from three periportal and three perivenous hepatocyte isolates, obtained from independent liver perfusions RNA quality was controlled with the Laboratory-on-Chip-System Bioanalyzer 2100 (Agilent, Palo Alto, CA, USA) Data normalization and statistical analysis was carried out essentially as previously described [27] To analyze expression differences in the two cell populations, we used a threshold of 0.1 for the false discovery rate adjusted P-values and selected only those probe sets that showed Œlog2 expression ratios Œ‡ (equivalent to a ‡ 2-fold change) The former cutoff was chosen to keep the expected proportion of false-positives below 10% The latter was chosen because expression differences smaller than two-fold are very difficult to detect by quantitative RT-PCR, which was used in this study for verification of the microarray results We additionally investigated our dataset, however, using less stringent conditions (Œlog2 expression ratio Œ ‡ 0.5), but the results are only mentioned in the text in those instances when genes are affected encoding enzymes within pathways that were found to show significant differences in mRNA levels when analyzed at the more stringent cutoff Western analysis Cells were homogenized in WCE [50 mm Hepes, 150 mm NaCl, 10% (v ⁄ v) glycerol, 1% (v ⁄ v) Triton X-100, 1.5 mm MgCl2, mm EGTA, 100 mm NaF, 10 mm NaP2O7, 200 lm Na3VO4] buffer plus protease inhibitor cocktail (Complete Mini, Roche, Mannheim, Germany) Protein concentrations were estimated using the Bradford assay Western blotting was carried out as recently described [22] using antibodies against GS (1 : 5000 dilution; Sigma, Taufkirchen, Germany), E-cadherin (1 : 1000; Transduction Laboratories, Lexington, KY, USA), G-protein-coupled receptor 49 (1 : 1000; Affinity BioReagents, Golden, CO, USA), glyceraldehyde-3-phosphate dehydrogenase (1 : 1,000; Chemicon, Hampshire, Chandler’s Ford, UK) and cytochrome P450 1A (1 : 1000; gift of R Wolf, Biomedical Research Centre, University of Dundee, UK) Antibody binding was visualized using appropriate alkaline phosphatase-conjugated secondary antibodies (1 : 10 000; Tropix, Applied Biosystems, Weiterstadt, Germany) and CDP-Star as a substrate Chemoluminescence signals were monitored by use of a CCD camera system Quantitative determination of mRNAs by RT-PCR Total RNA was isolated with Trizol reagent (Invitrogen, Karlsruhe, Germany) RNA was purified using the RNeasy Table PCR primers Gene Forward (5¢- to 3¢) Reverse (5¢- to 3¢) Glul Oat Sds Pfkfb1 Pck1 Cyp1a2 Cyp2e1 Cyp2f2 Sult5a1 Aldh1b1 Cyp7a1 Acly Ctsc Gpr49 Nr1i3 Ahr Hes1 Ctnnbip1 Cdh1 Rhbg 18S rRNA GCGAAGACTTTGGGGTGATA TGGCGGTTTATACCCTGTG CACAGTTGAAGTGGTGGGAGA GACCACGTTCAAAGCCGTAC ATTGAACTGACAGACTCGCCCTAT GAGCGCTGTATCTACATAAACCA TCCCTAAGTATCCTCCGTGA AAAGAAGCATCGAGGAGC TCACCTCCCACTTGAACGC GACCGGAGAACGCTGATACTAGA TCCCTGTCATACCACAAAGTCT GAACTTTCTCATTGAACCCTTCG GAAGTTCCCGAAGCGACATTA AATCGCGGTAGTGGACATTC AACAACAGTCTCGGCTCCAAA GTCAAATCCTTCTAAGCGACACA GACTGTGAAGCACCTCCGG ACCGCCAGTGAGGAGGAATT TCTACCAAAGTGACGCTGAA TACAACCACGAAACCGACG CGGCTACCACATCCAAGGAA GTGCCTCTTGCTCAGTTTGTC CATTTAGCAACCCTTTCCCT CCACAGACAGCACGATAGCC TCTTCACAGAGCCCCGCATC TTCCCACCATATCCGCTTCC GGGTGAACATGATAGACACTATTGT GTAATCGAAGCGTTTGTTGA CGAAGACGACAGAGCAGAT AACCAGGAGCCGAAGAAGC GGGATTGGGTTCGGGAGA GGTAGCAGAAGGCATACATCC CCTCAGGTGCATGGACCAAC CACCTTCTTGCCAACAAAGC GATTCGGAAGCAAAAATGGA AGCATTTCATTGCCACTCCC AACCAGCACAAAGCCATTCA GGTAGGTCATGGCGTTGATC GGTGCAAAGGGTAAGAAGACG GCTGATGGGAGGGATGAC CAAACTCTCCACGCCAACA GCTGGAATTACCGCGGCT FEBS Journal 273 (2006) 5051–5061 ª 2006 The Authors Journal compilation ª 2006 FEBS 5059 Zonal gene expression in mouse liver A Braeuning et al Mini Kit (Qiagen, Hilden, Germany) Five hundred nanograms of total RNA were reverse transcribed into cDNA by avian myeloblastosis virus-RT (Promega, Mannheim, Germany) using standard methods and oligo(dT)18 and random(dN)6 primers Expression analysis was performed using the LightCycler real-time PCR system (Roche, Mannheim, Germany) Expression of 18S rRNA was used for normalization The primer pairs used for PCR amplification are given in Table 11 12 13 Acknowledgements We gratefully acknowledge the excellent technical assistance of Elke Zabinsky and Silvia Vetter We also thank Dr R Wolf for the gift of Cyp1A antibody This study was supported by the Deutsche Krebshilfe (grant 106356) 14 References Jungermann K & Katz N (1989) Functional specialization of different hepatocyte populations Physiol Rev 69, 708–764 Gebhardt R (1992) Metabolic zonation of the liver: regulation and implications for liver function Pharmacol Ther 53, 275–354 Jungermann K & Kietzmann T (1996) Zonation of parenchymal and nonparenchymal metabolism in liver Annu Rev Nutr 16, 179–203 Gebhardt R & Mecke D (1983) Heterogeneous distribution of glutamine synthetase among rat liver parenchymal cells in situ and in primary culture EMBO J 2, 567–570 Oinonen T & Lindros KO (1998) Zonation of hepatic cytochrome P-450 expression and regulation Biochem J 329, 17–35 Lemaigre FP & Rousseau GG (1994) Transcriptional control of genes that regulate glycolysis and gluconeogenesis in adult liver Biochem J 303, 1–14 Eilers F, Bartels H & Jungermann K (1993) Zonal expression of the glucokinase gene in rat liver Dynamics during the daily feeding rhythm and starvation–refeeding cycle demonstrated by in situ hybridization Histochemistry 99, 133–140 Rider MH, Bertrand L, Vertommen D, Michels PA, Rousseau GG & Hue L (2004) 6-Phosphofructo-2-kinase ⁄ fructose-2,6-bisphosphatase: head-to-head with a bifunctional enzyme that controls glycolysis Biochem J 381, 561–579 Frederiks WM, Marx F & van Noorden CJ (1991) Homogeneous distribution of phosphofructokinase in the rat liver acinus: a quantitative histochemical study Hepatology 14, 634–639 10 Tosh D, Alberti GM & Agius L (1988) Glucagon regulation of gluconeogenesis and ketogenesis in periportal 5060 15 16 17 18 19 20 21 22 23 and perivenous rat hepatocytes Heterogeneity of hormone action and of the mitochondrial redox state Biochem J 256, 197–204 Wimmer M & Pette D (1979) Microphotometric studies on intraacinar enzyme distribution in rat liver Histochemistry 64, 23–33 Agius L & Tosh D (1990) Acinar zonation of cytosolic but not organelle-bound activities of phosphoenolpyruvate carboxykinase and aspartate aminotransferase in guinea-pig liver Biochem J 271, 387–391 Jones CG & Titheradge MA (1996) Measurement of metabolic fluxes through pyruvate kinase, phosphoenolpyruvate carboxykinase, pyruvate dehydrogenase, and pyruvate carboxylate in hepatocytes of different acinar origin Arch Biochem Biophys 326, 202–206 Zierz S, Katz N & Jungermann K (1983) Distribution of pyruvate kinase type L and M2 in microdissected periportal and perivenous rat liver tissue with different dietary states Hoppe Seylers Z Physiol Chem 364, 1447–1453 Guzman M & Castro J (1989) Zonation of fatty acid metabolism in rat liver Biochem J 264, 107–113 Twisk J, Hoekman MF, Mager WH, Moorman AF, de Boer PA, Scheja L, Princen HM & Gebhardt R (1995) Heterogeneous expression of cholesterol alpha-hydroxylase and sterol 27-hydroxylase genes in the rat liver lobulus J Clin Invest 95, 1235–1243 Ugele B, Kempen HJ, Kempen JM, Gebhardt R, Meijer P, Burger HJ & Princen HM (1991) Heterogeneity of rat liver parenchyma in cholesterol alpha-hydroxylase and bile acid synthesis Biochem J 276, 73–77 Evans JL, Quistorff B & Witters LA (1989) Zonation of hepatic lipogenic enzymes identified by dual-digitoninpulse perfusion Biochem J 259, 821–829 Katz NR, Fischer W & Ick M (1983) Heterogeneous distribution of ATP citrate lyase in rat-liver parenchyma Microradiochemical determination in microdissected periportal and perivenous liver tissue Eur J Biochem 130, 297–301 Ogawa H & Kawamata S (1995) Periportal expression of the serine dehydratase gene in rat liver Histochem J 27, 380–387 Weiner ID, Miller RT & Verlander JW (2003) Localization of the ammonium transporters, Rh B glycoprotein and Rh C glycoprotein, in the mouse liver Gastroenterology 124, 1432–1440 Hailfinger S, Jaworski M, Braeuning A, Buchmann A & Schwarz M (2006) Zonal gene expression in murine liver: lessons from tumors Hepatology 43, 407–414 Cadoret A, Ovejero C, Terris B, Souil E, Levy L, Lamers WH, Kitajewski J, Kahn A & Perret C (2002) New targets of beta-catenin signaling in the liver are involved in the glutamine metabolism Oncogene 21, 8293–8301 FEBS Journal 273 (2006) 5051–5061 ª 2006 The Authors Journal compilation ª 2006 FEBS A Braeuning et al 24 Ding X & Coon MJ (1994) Steroid metabolism by rabbit olfactory-specific P450 2G1 Arch Biochem Biophys 315, 454–459 25 Benhamouche S, Decaens T, Godard C, Chambrey R, Rickman DS, Moinard C, Vasseur-Cognet M, Kuo CJ, Kahn A, Perret C et al (2006) Apc tumor suppressor gene is the ‘zonation-keeper’ of mouse liver Dev Cell 10, 759–770 26 Taniai H, Hines IN, Bharwani S, Maloney RE, Nimura Y, Gao B, Flores SC, McCord JM, Grisham MB & Aw TY (2004) Susceptibility of murine periportal hepatocytes to hypoxia-reoxygenation: role for NO and Kupffer cell-derived oxidants Hepatology 39, 1544–1552 27 Stahl S, Ittrich C, Marx-Stoelting P, Kohle C, Altugă Teber O, Riess O, Bonin M, Jobst J, Kaiser S, Buchmann Zonal gene expression in mouse liver A et al (2005) Genotype–phenotype relationships in hepatocellular tumors from mice and man Hepatology 42, 353–361 Supplementary material The following supplementary material is available online: Table S1 Gene expression in perivenous versus periportal hepatocytes This material is available as part of the online article from http://www.blackwell-synergy.com FEBS Journal 273 (2006) 5051–5061 ª 2006 The Authors Journal compilation ª 2006 FEBS 5061 ... differences in expression of genes encoding enzymes and other proteins involved in intermediary metabolism Perivenous expression is indicated by green, and genes with preferential periportal expression. .. compilation ª 2006 FEBS A Braeuning et al Zonal gene expression in mouse liver Fig Volcano plot demonstrating differences in gene expression between periportal and perivenous hepatocytes Each of the... localized in the periportal area, namely ornithine transcarbamylase (EC 2.1.3.3), argininosuccinate synthetase (EC 6.3.4.5), argininosuccinate lyase (EC 4.3.2.1), and arginase (EC 3.5.3.1), showing