Báo cáo khoa học: VEGF gene expression is regulated post-transcriptionally in macrophages pdf

VEGF gene expression is regulated post-transcriptionally in macrophages Min Du1, Kristen M Roy1, Lihui Zhong1, Zheng Shen1, Hannah E Meyers1 and Ralph C Nichols1,2,3 Department of Microbiology and Immunology, Dartmouth Medical School, Hanover, NH, USA Veterans Administration Research Service, White River Junction, VT, USA Department of Medicine, Dartmouth Medical School, Hanover, NH, USA Keywords VEGF; mRNA stability; 3¢ UTR; AURE; macrophage Correspondence R.C Nichols, Mailstop 151, Veterans Administration Research Service, 215 North Main Street, White River Junction, VT 05009-0001, USA Fax: +1 802 296 6308 Tel: +1 802 295 9363 extn 5891 E-mail: ralph.c.nichols@dartmouth.edu (Received April 2005, revised 12 December 2005, accepted 16 December 2005) doi:10.1111/j.1742-4658.2006.05106.x The macrophage is critical to the innate immune response and contributes to human diseases, including inflammatory arthritis and plaque formation in atherosclerosis Vascular endothelial growth factor (VEGF) is an angiogenic cytokine that is produced by macrophages To study the regulation of VEGF production in macrophages we show that stimulation of monocyte-macrophage-like RAW-264.7 cells by lipopolysaccharide (LPS) increases expression of VEGF mRNA and protein Three alternative splicing VEGF mRNA isoforms are produced, and the stability of VEGF mRNA increases following cellular activation To study post-transcriptional regulation of the VEGF gene the 3¢-untranslated region (3¢ UTR) was introduced into the 3¢ UTR of the luciferase gene in a reporter construct In both RAW-264.7 cells and thioglycollate-elicited macrophages, the 3¢ UTR sequence dramatically reduces reporter expression Treatment with activators of macrophages, including LPS, lipoteichoic acid, and VEGF protein, stimulates expression of 3¢ UTR reporters Finally, mapping studies of the 3¢ UTR of VEGF mRNA show that deletion of the heterogeneous nuclear ribonucleoprotein l binding site affects basal reporter expression in RAW264.7 cells, but does not affect reporter activation with LPS Together these results demonstrate that a post-transcriptional mechanism contributes to VEGF gene expression in activated macrophage cells The angiogenic cytokine vascular endothelial growth factor (VEGF) is associated with macrophage cell infiltration in inflammation Both VEGF and macrophage cells play a critical role in inflammatory processes including synovial joint inflammation [1–3], atherosclerosis [4], tumorigenesis [5], nephritis [6], corneal [7] and diabetic [8] neovascularization The relationship between macrophages and VEGF protein is important to the inflammatory response for several reasons: (1) macrophages produce VEGF protein [9,10]; (2) neo-vascularization induced by VEGF contributes to disease in the inflamed joint [11,12] and other inflammatory diseases [13]; (3) macrophages express VEGFR-1 (Flt-1) and respond to VEGF protein [14] To better understand the contribution of VEGF to inflammatory disease we investigated regulation of VEGF gene expression in macrophages The relationship between macrophage activation and VEGF has been poorly explored in part because the macrophage cell expresses the VEGFR-1 receptor but Abbreviations AURE, adenosine-uridine-rich element; CAURE, cytidine-adenosine-uridine-rich element; CSD ⁄ PTB, cold shock domain ⁄ polypyrimidine tract binding protein; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GLUT1, glucose transporter-1; hnRNP, heterogeneous nuclear ribonucleoprotein; HuR, ELAV protein HuA; hVEGF, human vascular endothelial growth factor; LPS, lipopolysaccharide; LTA, lipoteichoic acid; mVEGF, mouse vascular endothelial growth factor; TG-Mac, thioglycollate-elicited macrophages; TNFa, tumor necrosis factor-alpha; UTR, untranslated region 732 FEBS Journal 273 (2006) 732–745 ª 2006 FEBS No claim to original US government works M Du et al not the VEGFR-2 (Flk-1) receptor [14] The VEGFR-1 receptor has been considered a decoy receptor on endothelial cells where VEGFR-1 is considerably less active (low kinase activity) than VEGFR-2 [15] However, critical new reports show that the blockade of VEGFR-1, but not VEGFR-2, reverses joint destruction in the K ⁄ BxN mouse model of arthritis [16,17] In separate studies we show that the VEGFR-1 receptor is upregulated in activated macrophages (K Roy, R Fava, R.C Nichols, unpublished data), suggesting that macrophages both produce and respond to VEGF in inflamed tissues Although an autocrine mechanism of macrophage activation is suggested, VEGFR-1 is also the target of placental growth factor [17], and the role of VEGF in macrophage stimulation is not fully understood Regulation of VEGF gene expression is controlled by both transcriptional and post-transcriptional mechanisms [18], and post-transcriptional regulation is responsible for a major increase in VEGF production under hypoxia [18–25] Post-transcriptional regulation is mediated by mRNA binding proteins that act on defined cis-acting elements, usually found in the 3¢-untranslated region (3¢ UTR) of the targeted mRNA [26,27] Several reports have identified cis elements in the 3¢ UTR of VEGF mRNA that are recognized by heterogeneous nuclear ribonucleoprotein (hnRNP) L [25], ELAV protein HuA (HuR) [23] and the cold shock domain ⁄ polypyrimidine tract binding protein (CSD ⁄ PTB) complex [28] To extend these studies, we now show that the 3¢ UTR of VEGF mRNA plays a role in VEGF gene expression in mouse macrophages under inflammatory conditions We have introduced the 3¢ UTR of mouse VEGF (mVEGF) into the 3¢ UTR of the luciferase reporter gene and show that reporter activity increases when cells are treated with lipopolysaccharide (LPS), lipoteichoic acid (LTA) or VEGF protein Finally, mapping studies of the 3¢ UTR suggests that the proximal region of the 3¢ UTR contains cis elements important in activated macrophage cells Together, these findings demonstrate that VEGF gene expression in macrophages is controlled by a post-transcriptional mechanism Results Macrophage-like RAW-264.7 cells produce three VEGF isoforms Alternative splicing of VEGF mRNA produces multiple VEGF isoforms [29] To determine which isoforms are produced in macrophage cells we designed PCR primers homologous to sequences in exons and Post-transcriptional regulation of VEGF in macrophages Three PCR products are produced from cDNA isolated from RAW-264.7 cells (Fig 1A) These PCR products were sequenced and show that RAW-264.7 cells produce three VEGF isoforms, VEGF188, VEGF164 (exon skipped), and VEGF120 (exons and skipped) The same isoforms were expressed by thioglycollate-elicited macrophages (TG-mac) from C3H ⁄ HeN cells (data not shown) The VEGF120 isoform is the most abundant PCR product The PCR reaction is more efficient for smaller PCR products and the abundance of the smallest VEGF isoform may reflect this In separate experiments we found that immunoblotting of whole-cell RAW-264.7 lysates with anti-VEGF antibody did not detect VEGF protein (data not shown), suggesting that most of the VEGF protein is not cell associated and is exported from macrophages Finally, in experiments where RAW-264.7 or thioglycollate-elicited macrophages were stimulated, the VEGF mRNA levels of all three isoforms increased but the relative amount of each isoform did not change, suggesting that alternative splicing of VEGF mRNA is not affected by cellular activation Effects of stimulation of RAW-264.7 cells on VEGF protein Rheumatoid tissue is populated by macrophages, and these cells produce VEGF mRNA and protein [1] To show that stimulated RAW-264.7 cells increase production of VEGF we plated cells overnight, and then treated cells with the Toll-like receptor-4 activator LPS (100 ngỈmL)1) in fresh media for h Levels of VEGF protein in culture media were measured by ELISA As shown in Fig 1B, VEGF production increased by 60% with LPS treatment Treatment of RAW-264.7 cells with tumour necrosis factor-a (TNFa) also increased VEGF production (3.1 ± 0.6-fold increase with 10 ngỈmL)1 TNFa for h; mean ± SD for four experiments) Finally we measured the effects of human VEGF (hVEGF) on VEGF production by RAW-264.7 cells Human VEGF is cross-reactive with mouse antibodies (R & D Systems, Minneapolis, MN) used for ELISA measurement To correct for contaminating hVEGF, parallel wells of were treated with cycloheximide (CHX), as described in Experimental procedures Cells were treated overnight without or with VEGF protein (2 lgỈmL)1), media was replaced with media not containing hVEGF protein, and mVEGF was measured in the media after h As shown in Fig 1C, treatment with hVEGF (NCI Clinical Repository, Frederick, MD) protein stimulated de novo protein synthesis fivefold FEBS Journal 273 (2006) 732–745 ª 2006 FEBS No claim to original US government works 733 Post-transcriptional regulation of VEGF in macrophages M Du et al Effects of stimulation of RAW-264.7 cells on VEGF mRNA We next measured the effects of cellular activation on levels of endogenous VEGF mRNA and on the stability of VEGF mRNA Lipopolysaccharide activates Toll-4 receptor; RAW-264.7 cells were untreated or treated with LPS (100 ngỈmL)1 for h) and mRNA levels were measured by RT ⁄ PCR As shown in Fig 2A, levels of endogenous VEGF mRNA increased by 45% in cells treated with LPS To evaluate whether VEGF mRNA was stabilized following LPS treatment, A RAW-264.7 cells were treated with LPS for h followed by no treatment or treatment with Actinomycin D for or h The levels of VEGF mRNA were determined by RT ⁄ PCR and normalized to 18S rRNA We found that the half-life of VEGF mRNA was increased in activated cells (Fig 2B) The estimated mRNA half-lives at h were 0.86 h (untreated) and 1.6 h (LPS treated) This finding is comparable to the 45 half-life of VEGF mRNA reported in unstimulated monocyte-derived macrophages [30] This result shows that mRNA stabilization is one mechanism that increases VEGF production in stimulated macrophages The stability of VEGF mRNA is affected by cis elements in the 3¢ UTR in other cell types [19,23,25,28,31] and we next tested the activity of AU-rich elements in macrophage cells Effects of AU-rich sequences on reporter activity in macrophages B C 734 Post-transcriptional regulation is mediated by mRNA binding proteins that act on cis elements in the 3¢ UTR [26–28,32] Previous studies have shown that both AU-rich elements (AURE) and non-AURE elements are active in the regulation of VEGF [19,23, 25,31] To study AURE we created the AUUUA-luc luciferase reporter that contains a 30-nt sequence with multiple tandem repeats of the AUUUA pentamer and includes six overlapping UUAUUUAUU nonamers Four hours after transfection in RAW-264.7 cells, the activity of the AUUUA-luc reporter was 75% less than the parent reporter pGL3 (Fig 3) The activity of a control reporter (AUGUA-luc), in which guanosine Fig Production of VEGF by RAW-264.7 cells (A) VEGF isoforms Primers specific to exons and were designed to amplify all known mouse VEGF alternative splice isoforms from cDNA The PCR products for three isoforms (VEGF188, VEGF164, VEGF120) were found Bars show DNA size standards (B) Effects of LPS on VEGF protein production To measure VEGF production, RAW264.7 were untreated or treated in fresh media for h with LPS (100 ngỈmL)1) Levels of VEGF protein (mean ± SD; P < 0.03) were measured in the media from triplicate wells by ELISA Results are from one of two experiments with similar results (C) Effects of human VEGF protein on de novo VEGF protein production To measure the effects of human VEGF on VEGF production, RAW264.7 were untreated or treated with human VEGF (2 lgỈmL)1) overnight Medium was replaced with fresh media without VEGF, and levels of VEGF protein (mean ± SD; P < 0.02) were measured in the media from triplicate wells by ELISA To correct for contaminating hVEGF, parallel wells were treated with CHX (20 lM), as described in Experimental procedures Results are from one of two experiments with similar results FEBS Journal 273 (2006) 732–745 ª 2006 FEBS No claim to original US government works M Du et al A B Fig Effects of macrophage activation on VEGF mRNA (A) VEGF mRNA levels RAW-264.7 cells were not treated or treated with LPS for h and VEGF mRNA levels determined by RT ⁄ PCR The levels of the three VEGF isoform PCR products from each sample were combined, and the sum was normalized to the level of 18S rRNA PCR product from the same sample Results are relative values, three samples per condition (mean ± SD; P < 0.04) and are representative of two experiments (B) Half-life determination of VEGF mRNA Decay of VEGF mRNA was measured in cells nottreated or treated with actinomycin D for or h Levels of VEGF PCR products were normalized to levels of 18S rRNA from the same sample Results are set to unity for the zero time point, and the mean ± SD of triplicate determinations are shown VEGF mRNA levels at h were significantly less than at zero hour (untreated, P < 0.005; LPS treated, P < 0.002) VEGF mRNA levels were significantly greater in LPS-treated samples than in untreated samples at h (P < 0.015) residues were substituted for uridine residues in each pentamer, was only 10% less than the parent construct The 30-nt AURE from glucose transporter-1 (AURE ⁄ GLUT1-luc) [33], which contains no AUUUA pentamers, was 85% less than the parent reporter These results show that both AUUUA and nonAUUUA AURE elements are active in RAW-264.7 cells The 3¢ UTR of VEGF mRNA contains AURE and we next tested the activity of the full-length 3¢ UTR using reporter constructs Post-transcriptional regulation of VEGF in macrophages The effects of the 3¢-untranslated region of mouse VEGF mRNA on gene expression in a heterologous reporter We evaluated the role of the 3¢ UTR in gene expression by introducing the SmaI ⁄ XbaI fragment (nt 209–1747) of the mouse 3¢ UTR into the 3¢ UTR of the luciferase gene The structure of the full-length reporter (VEGF-FL-luc) and related 3¢ UTR reporters is shown in Fig 4A The VEGF-FL-luc reporter contains all regulatory elements (or homologous regions) reported in rat, mouse, and hVEGF 3¢ UTR The native polyadenylation signal identified by Dibbens et al [34] was removed, and we used the more efficient bovine growth hormone poly(A) signal [35] present in the pcDNA-3.1 reporter construct The poly(A) sequence and poly(A) binding protein mediate translation of mRNA, and are not thought to affect mRNA stability [36–38] Further studies are needed to determine if the native poly(A) signal affects VEGF mRNA stability We transfected the parental reporter (3.1-luc) or the VEGF-FL-luc reporter into nonactivated cells and measured luciferase levels after h The basal level of expression of the full-length 3¢ UTR reporter was dramatically less than that of the parent vector in both RAW-264.7 cells (80% reduction) and in TG-Mac cells (65% reduction) (Fig 4B and C) Wellto-well variation was large in primary TG-Mac cells Therefore, we cotransfected TG-Mac cells with sea pansy luciferase (renilla) and we express these results as ‘normalized luciferase units.’ Together, these results demonstrate that the 3¢ UTR of VEGF mRNA inhibits expression of a heterologous reporter gene in macrophages Effects of the 3¢ UTR of VEGF mRNA on luciferase reporter mRNA levels Regulation by cis elements in the 3¢ UTR can affect mRNA levels or may affect translational efficiency [39] To determine how the introduction of the 3¢ UTR of VEGF mRNA affected luciferase mRNA levels, we transfected RAW-264.7 cells with either the parental reporter, 3.1-luc, or the VEGF-FL-luc reporter and measured luciferase mRNA levels by RT ⁄ PCR As shown in Fig 4D, luciferase mRNA was reduced by 40% in cells expressing the VEGF-FL-luc as compared to the parental luciferase mRNA It is important to note that the parental 3.1-luc and VEGF-FL-luc constructs are driven by the same promoter, and any differences between the luciferase mRNA levels are due to actions on the 3¢ UTR sequence of VEGF mRNA FEBS Journal 273 (2006) 732–745 ª 2006 FEBS No claim to original US government works 735 Post-transcriptional regulation of VEGF in macrophages M Du et al Fig AU-rich sequences reduce reporter activity Sequences were introduced into the 3¢ UTR of the luciferase gene of the eukaryotic expression vector pGL3-Control (Promega) Luciferase activity was measured in cell lysates h after transfection of RAW-264.7 cells On the right are diagrams of the reporter constructs showing the nucleotide sequence of an artificial AU-rich element (AUUUA), a negative control (AUGUA) and the non-AUUUA AURE identified in the 3¢ UTR of GLUT1 mRNA (AURE ⁄ GLUT1) [33] Error bars are SD Results shown are representative of five experiments Results from cells transfected for 24 h were similar (data not shown) Effects of agents that activate macrophages on VEGF-FL-luc reporter activity We show in Fig that stimulated macrophages increase production of VEGF mRNA and protein We next tested the effects of macrophage activating agents on VEGF-FL-luc reporter activity in RAW-264.7 cells Dose–response treatment with LPS showed that reporter activity was maximal with 100 ngỈmL)1 (1.82 ± 0.25-fold greater than untreated, mean ± SD) Reporter activity increased for up to h and did not increase further after 24 h (data not shown) Because LPS acts on the Toll-4 receptor, we next determined if the Toll-2 receptor ligand, LTA [40], could affect the VEGF-FL-luc reporter activity When RAW-264.7 cells were treated with LTA (1 lgỈmL)1, 24 h), VEGFFL-luc reporter activity increased 1.69 ± 0.17-fold over untreated controls Next, we tested the effects of VEGF protein on activation of VEGF-FL-luc reporter activity Macrophage cells express the VEGFR-1 (Flt-1) receptor [41] and macrophages migrate in response to VEGF protein at levels as low as 12 ngỈmL)1 [14] To determine if VEGF protein affects RAW-264.7 cells, we first measured production of a primary marker of macrophage activation, TNFa Cells treated with 100 ngỈmL)1 of recombinant hVEGF for 24 h increased TNFa production by 9.3 fold (untreated, 1359 ± 186 pgỈmL)1: hVEGF treated, 12 604 ± 3461 pgỈmL)1; mean ± SD) We next measured the effects of hVEGF on VEGF-FL-luc reporter expression in RAW-264.7 cells Treatments with hVEGF as low as 3.3 ngỈmL)1 increased reporter activity with maximal activity seen at 100 ngỈmL)1 (2.2 ± 0.2 fold increase over untreated; mean ± SD) Effects of activating agents on VEGF-FL-luc reporters are normal- Fig The effects of the 3¢ UTR of VEGF mRNA on reporter expression in macrophages (A) Diagram of mVEGF reporter constructs Upper-most bar shows the 3¢ UTR region studied Adenosine-uridine-rich (AU) and cytidine-adenosine-uridine-rich (CAU and CSD ⁄ PTD) regions are noted The parent construct, 3.1-luc, was created as described in Experimental procedures The full-length reporter (VEGF-FL-luc) construct contains nt-209–1747 of the 3¢ UTR of mVEGF mRNA, and the sequence is shown below The CAURE site recognized by hnRNP L (nt 322–342), the CAURE recognized by HuR (nt 1622–1665) [23], and the CSD ⁄ PTB binding site (nt 1727–39) [28] are shown in bold ⁄ underlined type Additional AU-rich sequences, including all AUUUA pentamers and nonomers, are shown in bold type Engineering of reporter constructs is described in Experimental procedures (B, C) The 3¢ UTR of VEGF mRNA suppresses reporter activity in macrophages The effects on reporter activity of the 3¢ UTR of VEGF mRNA were measured in untreated macrophage cells by transfection of either the control reporter construct (3.1-luc) or the full-length VEGF-3¢ UTR reporter (VEGF-FL-luc) RAW-264.7 cells (B) or TG-Mac cells from C3H ⁄ HeN mice (C) were lysed h after transfection, and luciferase activity was read by luminometry Similar results were seen after 24 h (data not shown) Diagrams on the right show the construct used to transfect cells Data are the mean ± SD, and are representative of at least three experiments (D) Luciferase mRNA levels RAW-264.7 cells were transfected with the parent vector (3.1-luc) or with VEGF-FL-luc for 24 h Total RNA was prepared from cell cytoplasm and RT ⁄ PCR was performed with luciferase primers or GAPDH primers as described in Experimental procedures 736 FEBS Journal 273 (2006) 732–745 ª 2006 FEBS No claim to original US government works M Du et al ized to parent reporter levels in cells treated in an identical manner (see Experimental procedures, and Fig 6) Treatment with hVEGF produced maximal VEGF-FL-luc reporter activity in h, with longer times (up to 24 h) showing similar increases Together, these results demonstrate that pro-inflammatory agents Post-transcriptional regulation of VEGF in macrophages of bacterial origin (LPS, LTA) and endogenous origin (VEGF) increase VEGF 3¢ UTR-dependent reporter expression In addition, these results show that the reporter construct is a useful tool for mapping the 3¢ UTR A B D C FEBS Journal 273 (2006) 732–745 ª 2006 FEBS No claim to original US government works 737 Post-transcriptional regulation of VEGF in macrophages M Du et al Fig Mapping of the 3¢ UTR from VEGF mRNA Reporter constructs were created that separated the proximal and distal regions of the 3¢ UTR from VEGF mRNA (see Fig 4A) The reporter VEGF-209–750-luc contains the proximal region (nt 209–750) The reporter VEGF-751– 1747-luc contains the distal region (nt 751–1747) Reporter constructs were transfected into RAW-264.7 cells and luciferase activity measured in cell lysates after h Similar results were seen at 24 h (data not shown) Results are mean ± SD and are representative of five independent experiments Mapping of the 3¢ UTR of VEGF mRNA As shown in Fig 4A, the 3¢ UTR of mVEGF mRNA is complex The region proximal to the coding region contains a CAU-element [19,25] but no AUUUA pentamers The distal region contains: (1) two active CAU-rich elements [23,28]; and (2) six AUUUA pentamers and two nonomers, some of which are active [31] To isolate these regions we created luciferase reporters that contain either the proximal region (VEGF-209–750-luc) or the distal region (VEGF-751– 1747-luc) (see Fig 4A) When transfected into RAW264.7 cells, neither construct displayed the level of inhibition found with the full-length construct (Fig 5) Although we cannot rule out the possibility that a cis element at nt 750 has been interrupted, this region contains no AU- or CAU-rich sequence motifs The reporter activity of the proximal VEGF-209–750-luc construct was most similar to the full-length construct In addition, the activity of the VEGF-209–750-luc reporter increased in LPS-treated cells whereas the VEGF-751–1747-luc was minimally affected by LPS treatment (data not shown) For this reason we examined candidate elements in the proximal region of the 3¢ UTR The hnRNP L element Shih and Claffey identified a cis element in the proximal region of hVEGF that was recognized by the mRNA binding protein, hnRNP L [25] The hnRNP L element is highly conserved between human and mouse and we used site-directed mutagenesis to delete the sequence (nt 322–42, CACCCACCCACAUACACA 738 CAU) from the full-length reporter As shown in Fig 6, deletion of the hnRNP L element (VEGF-dLluc) reduced reporter activity by 25% in untreated RAW-264.7 cells (compare columns and 3) In cells treated with LPS (100 ngỈmL)1), VEGF-FL-luc and VEGF-dL-luc responded with similar increases in reporter activity (VEGF-FL-luc increased 2.1-fold, VEGF-dL-luc increased 2.5-fold) Treatment of RAW264.7 cells with hVEGF protein produced similar effects on these reporters (data not shown) We conclude that the hnRNP L element affects basal levels of VEGF reporter activity but does not affect increases in VEGF reporter found in activated cells We are currently extending this mapping analysis to identify additional 3¢ UTR regulatory elements that are active in macrophages Discussion The VEGF cytokine plays a major role in cancer by controlling neo-vascularization in solid tumours [13] In arthritis, VEGF stimulates vascularization that supports the ’tumour-like’ phenotype of the inflamed synovium [12] However, VEGF also plays a role in vascular permeability and as a chemoattractant [11,12,14], suggesting that the role of VEGF in inflamed joints may be complex Macrophages in rheumatoid joints produce VEGF [1], and we have found that VEGFR-1 is upregulated in activated macrophages (K Roy, R Fava, R.C Nichols, unpublished data) Together these facts suggest that macrophages at the site of inflammation both respond to VEGF and contribute to the inflammatory response by producing VEGF protein In this report we confirm that macro- FEBS Journal 273 (2006) 732–745 ª 2006 FEBS No claim to original US government works M Du et al Post-transcriptional regulation of VEGF in macrophages Fig The effects of the hnRNP L element on reporter activity To test the activity of the cis element recognized by hnRNP L [25], the sequence (CACCCACCCACAUACACACAU) was deleted from the full-length reporter construct The deletant reporter, VEGF-dL-luc, produced less activity in untreated RAW-264.7 cells (compare columns and 3) In macrophages treated with LPS (100 ngỈmL)1 for 24 h), both the VEGF-FL-luc and VEGF-dL-luc reporters showed similar increases in reporter activity Treatment with LPS affects the promoter of the reporter construct To account for this effect, luciferase units (mean ± SD) are normalized to luciferase units of the 3.1-luc parental construct treated in parallel wells For example, the reporter values without LPS treatment were: 3.1-luc, 693 000 ± 97 000 luc units; VEGF-FL-luc, 104 000 ± 4000 luc units Reporter values with LPS treatment were: 1157 000 ± 16 000 (3.1-luc) and 369 000 ± 24 000 (VEGF-FL-luc) The normalized value for VEGF-FL-luc reporter activity is set at unity (column 1) phages respond to VEGF and other inflammatory mediators by increasing VEGF production We also show that macrophages produce multiple mRNA VEGF isoforms, and the stability of VEGF mRNA increases in activated cells We demonstrate that macrophage activation increases expression of VEGF luciferase reporters containing the mouse VEGF 3¢ UTR region, and we present mapping analysis of the VEGF 3¢ UTR Together, these results demonstrate that, as in cancer models, VEGF expression is controlled at the post-transcriptional level in macrophage-like cells Increased production of VEGF has been shown to act by both transcriptional and post-transcriptional mechanisms [13] Post-transcriptional regulation involves mRNA binding proteins acting on cis elements to alter mRNA stability or the efficiency of translation [32] Post-transcriptional regulation affects VEGF production in a cancer model [18], but it is unclear whether post-transcriptional regulation affects VEGF gene expression in macrophage cells To address this, we show here that under conditions in which VEGF protein production increases: (a) VEGF mRNA levels increased (Fig 2A); and (b) VEGF mRNA stability increased (Fig 2B) However, these increases in VEGF mRNA and protein production may also result in part from increased transcription We are currently assessing transcriptional regulation in activated macrophages, and only report here studies of 3¢ UTR-mediated regulation To study regulatory cis elements in VEGF mRNA we introduced the 3¢ UTR of mVEGF mRNA into the 3¢ UTR of the luciferase gene in a reporter construct Using this method, we can segregate posttranscriptional regulation from both transcriptional regulation of the native VEGF promoter, and posttranslational regulation acting on the VEGF protein We show in both monocyte-macrophage-like RAW-264.7 cells and thioglycollate-elicited macrophages that introduction of the full-length 3¢ UTR construct significantly reduced luciferase mRNA levels, and reduced basal reporter activity (Fig 4B, C, D) Next, we show that, under conditions in which VEGF mRNA is stabilized (LPS activation), luciferase reporter activity increased These results suggest that the 3¢ UTR in VEGF mRNA contributes to the increases in VEGF mRNA and protein found when macrophages are stimulated We are the first to show that the 3¢ UTR of VEGF mRNA affects gene expression in macrophages Post-transcriptional regulation of mRNA is mediated by mRNA binding proteins that recognize cis-acting elements, most frequently found in the 3¢ UTR region [26–28] The most studied cis-acting elements are AURE Analysis of the human genome estimates that 8% of human mRNAs contain AURE [42] Three classes of AURE have been identified [26,27], and the 3¢ UTR of VEGF mRNA contains two of these AURE classes: (a) Class I, nonoverlapping AUUUA FEBS Journal 273 (2006) 732–745 ª 2006 FEBS No claim to original US government works 739 Post-transcriptional regulation of VEGF in macrophages M Du et al pentamers and UUAUUUAA/UA/U nonamers; (b) Class III, adenosine-uridine rich and uridine-rich sequences that lack AURE pentamers Several reports have analysed AU-rich elements in rat and human VEGF 3¢ UTR [19,21–23,43–44] One Class III AURE element that was identified in rat VEGF is not conserved in mouse or human [20] Another type of cis element, that we refer to as a CAU-rich element (CAURE), contains adenosine, uridine and cytidine residues, and CAURE have been identified in GLUT1 mRNA [45] (nt 2180–90) and in the 3¢ UTR of VEGF mRNA [23,25,28,46] The hnRNP L binding site (nt 322–342) [25], HuR binding site (nt 1622–1665) [23,46], and CSD ⁄ PTB complex binding site (nt 1727– 39) [28] in the 3¢ UTR of VEGF mRNA are CAUrich Here we present our analysis of 3¢ UTR-mediated regulation in mouse macrophage cells The 3¢ UTR of mVEGF mRNA contains cis elements in both the proximal and distal regions [21,22,25,43,47] The distal two-thirds of the mouse 3¢ UTR contains six AURE pentamers, two nonomers, two CAURE and seven additional regions of 10 or more AU nucleotides that lack AUUUA pentamers Several groups have shown that cis elements in the distal region have strong affects on VEGF gene expression under hypoxic stress [22,46] Under normoxia these distal cis elements contribute to VEGF mRNA instability It was surprising therefore to find that when the distal region of the 3¢ UTR was removed (to create VEGF-209–750-luc) reporter activity was similar to that of the full-length reporter (Fig 5) In addition, cells stimulated with LPS or with VEGF showed increased VEGF-209–750-luc reporter activity In contrast, the VEGF-751–1747-luc reporter responded poorly to cellular activation (data not shown), suggesting that regulatory elements active in macrophages reside in the proximal region of the VEGF 3¢ UTR The proximal region of the 3¢ UTR contains a CAURE in hVEGF that is recognized by hnRNP L under both normoxic and hypoxic conditions in M21 melanoma cells [25] The homologous mouse sequence is nearly identical to the human CAURE, and deletion of the hnRNP L element resulted in a decrease in reporter activity in untreated RAW-264.7 cells However, the activity of the wild-type and VEGF-dL-luc reporters both increased in cells treated with LPS (Fig 6) Treatment with hVEGF produced similar results (data not shown) Although there are no AUUUA pentamers in the nt 209–750 region there is a long AU-rich region (78-nt, 97% adenosine-uridine) that is tandem to the hnRNP L element This AURE is interesting because we found that the GLUT1740 AURE luciferase reporter, which is also a long nonAUUUA Class III, was very active in RAW-264.7 cells (Fig 3) Future studies will determine if this AURE or other noncanonical cis elements in the proximal region contribute to 3¢ UTR-dependent regulation in macrophages Three agents that stimulate macrophages (LPS, LTA and VEGF) increased VEGF 3¢ UTR-dependent reporter activity One mechanism we considered was that these agents act by initially stimulating production of TNFa, and then TNFa stimulates VEGF gene expression To investigate this, we first showed that LPS stimulated production of TNFa (data not shown) Next we determined whether TNFa affected VEGF 3¢ UTRdependent reporter activity Although TNFa treatment increased VEGF protein production, we found that TNFa treatment decreased VEGF-FL-luc reporter activity modestly but significantly (10%; data not shown) We conclude that post-transcriptional stimulation of VEGF gene expression by agents such as LPS and VEGF not act through TNFa by an autocrine mechanism Activation of VEGF gene expression in RAW-264.7 cells with LPS and VEGF was distinct from treatments with TNFa Treatment with TNFa decreased reporter activity and increased VEGF protein production Treatment with LPS or with VEGF protein increased both reporter activity and VEGF protein production However, the effect of LPS on VEGF protein production was modest compared to the effects of VEGF treatment These different profiles of VEGF gene regulation by TNFa, VEGF and LPS may result from different gene activation mechanisms Our results suggest that: (i) TNFa stimulates VEGF production by a transcriptional mechanism, but inhibits the post-transcriptional pathway; (ii) treatment with VEGF stimulates both transcriptional and post-transcriptional pathways; (iii) treatment with LPS acts solely through a post-transcriptional mechanism, and does not affect VEGF transcription Studies of the effects by these agents on transcription are on going If LPS acts solely by a post-transcriptional mechanism, then long-term studies are needed to determine if the modest effects by LPS result in sufficient production of VEGF to initiate VEGF-driven autocrine production of VEGF Importantly, our results suggest that posttranscriptional regulation of VEGF may be important under conditions in which TNFa is not active, including under therapeutic conditions where TNFa action is blocked Originally identified as a permeability factor, VEGF is now known to play an essential role in arteriogenesis [13], neo-vascularization in cancer [13], and FEBS Journal 273 (2006) 732–745 ª 2006 FEBS No claim to original US government works M Du et al inflammatory diseases [12] Our studies with macrophages demonstrate that the 3¢ UTR of VEGF contributes to gene expression and provides a novel target to treat active disease Post-transcriptional regulation of VEGF in macrophages is mediated by the action of VEGF on its cognate receptor, VEGFR-1 Regulation of VEGF by an autocrine mechanism in cancer has been reviewed [48] It is possible that VEGF and its receptor interact intracellularly to regulate VEGF gene expression [48] The mechanism of regulation of the macrophage VEGF receptor, VEGFR-1, is now under study to determine if VEGF protein and its receptor are coordinately regulated Experimental procedures Cell culture, transfection and luciferase assay The RAW-264.7 cell line was obtained from ATCC (Manassas, VA) and maintained as described Media was DMEM supplemented with 10% heat-inactivated fetal bovine serum (Hyclone, Logan, VT) and penicillin-streptomycin Cultured cells were plated 24 h prior to transfection in six-well or 48-well plates Cells were adherent and were transfected at 40% confluence in Opti-MEM media (Invitrogen-Gibco, Carlsbad, CA) with luciferase constructs (plasmid constructs are described below) For cell transfection, plasmid DNA was complexed with Lipofectamine-2000, as described by the manufacturer (Invitrogen-Gibco) Cells in 48-well plates were lysed with 100 lL cell culture lysis reagent lysis buffer (Promega) After or 24 h, luciferase activity in 20 lL of lysate was measured following addition of luciferin substrate (Promega, Madison, WI) in a Molecular Dynamics luminometer Each transfection condition in 48-well plates was performed in six wells Two wells were pooled (10 lLỈwell)1) to give triplicate readings for each experimental condition Results are reported as the mean ± SD All experiments are representative of two or more independent experiments performed on different days The efficiency of transfection in RAW-264.7 cells was evaluated by cotransfection with renilla luciferase (pRL-SV40 Promega) Cells in 48-well plates were transfected with 0.1 lg luciferase and 0.01 lg renilla luciferaswell)1 and lysed in Dual-Glo lysis buffer (Promega) The well-to-well variation of firefly luciferase activity in RAW-264.7 cells was not improved by normalization to renilla luciferase The effect of cell activation on 3¢ UTR reporter activity was measured by adding the activating agent (LPS, LTA, or human VEGF) h after transfection and cells were lysed or 24 h later In some experiments with macrophage activating agents the cell treatment affected the promoter of the reporter construct In these experiments parallel wells were transfecting with the parental (empty) reporter The Post-transcriptional regulation of VEGF in macrophages parallel wells were not treated ⁄ treated with activating agent in an identical manner as wells transfected with VEGF reporters To account for effects on the construct promoter, results were normalized to the parental luciferase values Thioglycollate-elicited macrophages (TG-Mac) were obtained from C3H ⁄ HeN mice as previously described [49] Briefly, mice were injected with thioglycollate and after days, mice were killed by cervical dislocation Macrophages were removed from the peritoneum and plated on 6- or 48-well tissue culture plates and maintained in the same media used for RAW-264.7 cells Nonadherent cells were removed after 24 h The well-towell efficiency of transfection of primary TG-Mac was monitored in reporter assays by cotransfection of pRLSV40 renilla luciferase Reporter activity was normalized to the value of renilla luciferase for each experimental condition All experimental procedures were carried out in accordance with NIH guidelines regarding the care and use of experimental animals Measurement of VEGF and TNFa production by ELISA The effects of LPS, TNFa and hVEGF on mVEGF protein production was measured in cells plated 24 h before treatment After treatment, medium was collected and stored at )80 °C Cells were treated with LPS (generous gift of H Yohe, Veterans Administration Research Service, White River Junction, VT) or human TNFa (generous gift of R Fava, Veterans Administration Research Service, White River Junction, VT) Human VEGF was produced in baculovirus by R & D Systems, and obtained from the NCI Clinical Repository The activity of hVEGF was lost following boiling [50] Production of mVEGF (mVEGF) was measured by ELISA (Mouse VEGF, #MMV00, R & D Systems) Due to small but significant cross-reactivity between mVEGF and hVEGF, we could not directly measure mVEGF production by cells treated with hVEGF Therefore, production of mVEGF following stimulation with hVEGF was determined as follows RAW-264.7 cells were not treated or treated with lgỈmL)1 hVEGF After 24 h, cells were rinsed and incubated with fresh media (without VEGF), and after h media were collected To account for contaminating hVEGF, all treatments were performed in parallel, and these parallel wells were treated for h with 20 lm CHX to block de novo protein synthesis Levels of de novo VEGF protein was determined by subtracting VEGF levels in parallel CHX-treated wells Similar results were found with hVEGF from another source (R & D Systems) Production of mouse TNFa was measured in media by ELISA, according to the manufacturer’s directions (Mouse TNFa, #MTA00, R & D Systems) FEBS Journal 273 (2006) 732–745 ª 2006 FEBS No claim to original US government works 741 Post-transcriptional regulation of VEGF in macrophages M Du et al Plasmid construction VEGF 3¢UTR luciferase reporter constructs The parental luciferase vector was created by introduction of the luciferase gene from pGL3 (Promega) into the multiple cloning site of pcDNA-3.1 (Invitrogen, Carlsbad, CA) to create 3.1-luc The 1549-bp SmaI ⁄ XbaI fragment of the 3¢ UTR from mVEGF was released from the Sma4 plasmid (generously provided by Pat D’Amore, Harvard University) and cloned into the 3¢ UTR of the luciferase gene of 3.1-luc The VEGF-FL-luc construct contains nt 209–1747 of the mVEGF 3¢ UTR where nt is the first base of the VEGF stop codon [34] (identical to bases 209–1747, GenBank #AF317892) The nt 1–208 region of the 3¢ UTR contains no AUUUA pentamers or other candidate cis elements and was not included in the construct The nt 1748–1894 region contains the only active mVEGF AUUAAA polyadenylation [poly(A)] signal, as described by Dibbens et al [34], and was not included in reporter constructs All reporter constructs utilized the bovine growth hormone poly(A) signal in the parent vector (pcDNA-3.1 vector) The XbaI ⁄ ApaI fragment that contained the poly(A) signal was shown by others to not affect mRNA stability [22] Construct VEGF-209–750-luc was created by deletion of the BamHI ⁄ XbaI fragment from the VEGF-FL-luc construct The VEGF-751– 1747-luc construct was created by deletion of the EcoRV ⁄ BamHI fragment from the VEGF-FL-luc construct The VEGF-dL-luc construct was created by deletion of the hnRNP L cis-acting element (CACCCACCCACAUA CACACAU nt 322–342) [25] from the VEGF-FL-luc construct using PCR-based site-directed mutagenesis (QuickChange, Stratagene, La Jolla, CA) One nucleotide (C-388, underlined) in mouse is nonhomologous to human (human U-358, GenBank #AF024710) Following mutagenesis, the sequence of the VEGF-dL-luc was verified by sequencing on both strands and then cloned into a 3.1-luc parental vector that had not been subjected to PCR The integrity of all plasmid constructs was verified by sequencing on both strands AURE luciferase constructs Two constructs were created that contain AU-rich elements (AURE) The AUUUA-luc construct contains a 30-nt AUrich sequence with pentamer repeats (5-AUUAUUUAUU UAUUUAUUUAUUUAUUUAUU-3¢) A control reporter (AUGUA-luc) was created in which AUGUA pentamers replaced AUUUA pentamers (5¢-AUUAUGUAUGUA UGUAUGUAUGUAUGUAUU-3¢) Constructs were created by designing complementary sense and antisense oligonucleotides with XbaI sites on the 5¢- and 3¢-ends The oligonucleotides were annealed and cloned into the XbaI site in the 3¢ UTR of the luciferase gene in pGL3- 742 Control (Promega) The AURE ⁄ GLUT1-luc construct contains the AU-rich sequence from the 3¢ UTR of human glucose transporter-1 (GLUT1) [33] (5¢-UUUUAUAAUU UUUUUAUUACUGAUUUUGUU-3¢ nt 1885–1914; GenBank #K03195) The AURE ⁄ GLUT1-luc construct was created by site-directed mutagenesis (QuickChange, Stratagene) of the AUUUA-luc construct Obtaining RNA Total RNA was obtained using RNeasy (Qiagen) The quantity and quality of RNA were determined spectrophotometrically at 260 and 280 nm and by analysis on formamide agarose gels RT/PCR Oligonucleotide PCR primers for mVEGF, mouse glyceraldehyde-3-phosphate dehydrogenase (GAPDH), mouse 18S rRNA, and luciferase genes were designed using Primer3 [51] To determine levels of luciferase mRNA, total RNA from the cytoplasmic fraction (as described in the RNeasy kit, Qiagen) was treated twice with DNase to remove contaminating nuclear and plasmid DNA Primers used to measure VEGF mRNA were specific for sequences in exon (sense primer) and exon (antisense primer) For each sample, cDNA was prepared from lg of RNA using Superscript (Gibco) and PCR was performed on 10% of the cDNA in a 20-lL reaction using standard amplifying conditions with Supermix PCR cocktail (Gibco) We performed preliminary experiments to identify the range of PCR cycle reactions that produced linear increments of PCR product formation We used the cycle number within this range that produced PCR products from all samples VEGF and GAPDH PCR products were amplified from regions of mRNA that crossed exon junctions Large PCR products resulting from genomic contamination were not found All PCR products were cloned into pCR-II-Topo (Invitrogen) and sequenced on both strands Sequences of all primers used in this report are available upon request PCR products were stained with ethidium bromide, photographed, scanned into photoshop, and quantified using nih image (http://rsb.info.nih.gov/nih-image/Default.html) Levels of VEGF mRNA are presented as the level of VEGF PCR products normalized to level of 18S rRNA PCR product from the same sample Relative values are presented as mean ± SD of triplicate independent samples for each experimental condition VEGF mRNA stability Stability of mRNA was measured by not-treating (0 h) or treating cells with lm actinomycin D for or h Levels of VEGF mRNA in triplicate samples were deter- FEBS Journal 273 (2006) 732–745 ª 2006 FEBS No claim to original US government works M Du et al mined by RT ⁄ PCR and normalized to levels of 18S rRNA PCR product in the same sample Half-life of mRNA was calculated using the zero and two h time points Actinomycin D treatment did not affect levels of 18S rRNA Statistical analyses Data are presented for representative experiments that were repeated two or more times Within each experiment, treatments were performed in triplicate, as indicated in the figure legends Results were analysed by Student’s t-test A P value of < 0.05 was taken to indicate significance Acknowledgements We thank Xiao Wei Wang for excellent technical assistance We also thank Herb Yohe for mouse macrophages and Pat D’Amore for the Sma4 plasmid containing the mouse VEGF 3¢UTR We are very grateful to William Rigby and Roy Fava for advice and helpful discussions This work was supported by a Merit Review Award (to R.C.N) from the Department of Veterans Affairs, and by National Institutes of Health Grants R03AR47393 (to R.C.N) and P20RR16437 (to R.C.N) from the COBRE Program of the National Center for Research Resources References Fava RA, Olsen NJ, Spencer-Green G, Yeo KT, Yeo TK, Berse B, Jackman RW, Senger DR, Dvorak HF & Brown LF (1994) Vascular permeability factor ⁄ endothelial growth factor (VPF ⁄ VEGF): accumulation and expression in human synovial fluids and rheumatoid synovial tissue J Exp Med 18, 341–346 Firestein GS (2003) Evolving concepts of rheumatoid arthritis Nature 423, 356–361 Kinne RW, Brauer R, Stuhlmuller B, Palombo-Kinne E & Burmester GR (2000) Macrophages in rheumatoid arthritis Arthritis Res 2, 189–202 Shibata M, Suzuki H, Nakatani M, Koba S, Geshi E, Katagiri T & Takeyama Y (2001) The involvement of vascular endothelial growth factor and flt-1 in the process of neointimal proliferation in pig coronary arteries following stent implantation Histochem Cell Biol 116, 471–481 Hiratsuka S, Nakamura K, Iwai S, Murakami M, Itoh T, Kijima H, Shipley JM, Senior RM & Shibuya M (2002) MMP9 induction by vascular endothelial growth factor receptor-1 is involved in lung-specific metastasis Cancer Cell 2, 289–300 Post-transcriptional regulation of VEGF in macrophages Shihab FS, Bennett WM, Isaac J, Yi H & Andoh TF (2002) Angiotensin II regulation of vascular endothelial growth factor and receptors Flt-1 and KDR ⁄ Flk-1 in cyclosporine nephrotoxicity Kidney Int 62, 422–433 Philipp W, Speicher L & Humpel C (2000) Expression of vascular endothelial growth factor and its receptors in inflamed and vascularized human corneas Invest Ophthalmol Vis Sci 41, 2514–2522 Aiello LP, Avery RL, Arrigg PG, Keyt BA, Jampel HD, Shah ST, Pasquale LR, Thieme H, Iwamoto MA, Park JE et al (1994) Vascular endothelial growth factor in ocular fluid of patients with diabetic retinopathy and other retinal disorders N Engl J Med 33, 1480–1487 Burke B, Giannoudis A, Corke KP, Gill D, Wells M, Ziegler-Heitbrock L & Lewis CE (2003) Hypoxiainduced gene expression in human macrophages: implications for ischemic tissues and hypoxia-regulated gene therapy Am J Pathol 163, 1233–1243 10 Xiong M, Elson G, Legarda D & Leibovich SJ (1998) Production of vascular endothelial growth factor by murine macrophages, regulation by hypoxia, lactate, and the inducible nitric oxide synthase pathway Am J Pathol 153, 587–598 11 Afuwape AO, Kiriakidis S & Paleolog EM (2002) The role of the angiogenic molecule VEGF in the pathogenesis of rheumatoid arthritis Histol Histopathol 17, 961– 972 12 Paleolog EM (2002) Angiogenesis in rheumatoid arthritis Arthritis Res 4, S81–S90 13 Ferrara N (1999) Role of vascular endothelial growth factor in the regulation of angiogenesis Kidney Int 56, 794–814 14 Sawano A, Iwai S, Sakurai Y, Ito M, Shitara K, Nakahata T & Shibuya M (2001) Flt-1, vascular endothelial growth factor receptor 1, is a novel cell surface marker for the lineage of monocyte-macrophages in humans Blood 97, 785–791 15 Hiratsuka S, Maru Y, Okada A, Seiki M, Noda T & Shibuya M (2001) Involvement of Flt-1 tyrosine kinase (vascular endothelial growth factor receptor-1) in pathological angiogenesis Cancer Res 61, 1207– 1213 16 De Bandt M, Ben Mahdi MH, Ollivier V, Grossin M, Dupuis M, Gaudry M, Bohlen P, Lipson KE, Rice A, Wu Y, Gougerot-Pocidalo MA & Pasquier C (2003) Blockade of vascular endothelial growth factor receptor I (VEGF-RI), but not VEGF-RII, suppresses joint destruction in the K ⁄ BxN model of rheumatoid arthritis J Immunol 171, 4853–4859 17 Luttun A, Tjwa M, Moons L, Wu Y, Angelillo-Scherrer A, Liao F, Nagy JA, Hooper A, Priller J, De Klerck B et al (2002) Revascularization of ischemic tissues by PlGF treatment, and inhibition of tumor angiogenesis, FEBS Journal 273 (2006) 732–745 ª 2006 FEBS No claim to original US government works 743 Post-transcriptional regulation of VEGF in macrophages 18 19 20 21 22 23 24 25 26 27 28 29 30 M Du et al arthritis and atherosclerosis by anti-Flt1 Nat Med 8, 831–840 Levy AP, Levy NS, Wegner S & Goldberg MA (1995) Transcriptional regulation of the rat vascular endothelial growth factor gene by hypoxia J Biol Chem 270, 13333–13340 Claffey KP, Shih SC, Mullen A, Dziennis S, Cusick JL, Abrams KR, Lee SW & Detmar M (1998) Identification of a human VPF ⁄ VEGF 3¢ untranslated region mediating hypoxia-induced mRNA stability Mol Biol Cell 9, 469–481 Goldberg-Cohen I, Furneaux H & Levy AP (2002) A 40-bp RNA element that mediates stabilization of vascular endothelial growth factor mRNA by HuR J Biol Chem 277, 13635–13640 Levy AP, Levy NS & Goldberg MA (1996) Hypoxiainducible protein binding to vascular endothelial growth factor mRNA and its modulation by the von HippelLindau protein J Biol Chem 271, 25492–25497 Levy AP, Levy NS & Goldberg MA (1996) Post-transcriptional regulation of vascular endothelial growth factor by hypoxia J Biol Chem 271, 2746–2753 Levy NS, Chung S, Furneaux H & Levy AP (1998) Hypoxic stabilization of vascular endothelial growth factor mRNA by the RNA-binding protein HuR J Biol Chem 273, 6417–6423 Renner W, Kotschan S, Hoffmann C, ObermayerPietsch B & Pilger E (2000) A common 936 C ⁄ T mutation in the gene for vascular endothelial growth factor is associated with vascular endothelial growth factor plasma levels J Vasc Res 37, 443–448 Shih SC & Claffey KP (1999) Regulation of human vascular endothelial growth factor mRNA stability in hypoxia by heterogeneous nuclear ribonucleoprotein L J Biol Chem 274, 1359–1365 Chen CY & Shyu AB (1995) AU-rich elements: characterization and importance in mRNA degradation Trends Biochem Sci 20, 465–470 Xu N, Chen CY & Shyu AB (1997) Modulation of the fate of cytoplasmic mRNA by AU-rich elements: key sequence features controlling mRNA deadenylation and decay Mol Cell Biol 17, 4611–4621 Coles LS, Bartley MA, Bert A, Hunter J, Polyak S, Diamond P, Vadas MA & Goodall GJ (2004) A multiprotein complex containing cold shock domain (Y-box) and polypyrimidine tract binding proteins forms on the vascular endothelial growth factor mRNA Potential role in mRNA stabilization Eur J Biochem 271, 648– 660 Uthoff SM, Duchrow M, Schmidt MH, Broll R, Bruch HP, Strik MW & Galandiuk S (2002) VEGF isoforms and mutations in human colorectal cancer Int J Cancer 101, 32–36 Salomonsson L, Pettersson S, Englund MC, Wiklund O & Ohlsson BG (2002) Post-transcriptional regulation of 744 31 32 33 34 35 36 37 38 39 40 41 42 VEGF expression by oxidised LDL in human macrophages Eur J Clin Invest 32, 767–774 Ciais D, Cherradi N, Bailly S, Grenier E, Berra E, Pouyssegur J, Lamarre J & Feige JJ (2004) Destabilization of vascular endothelial growth factor mRNA by the zinc-finger protein TIS11b Oncogene 23, 8673–8680 Tourriere H, Chebli K & Tazi J (2002) mRNA degradation machines in eukaryotic cells Biochimie 84, 821–837 Griffin ME, Hamilton BJ, Roy KM, Du M, Willson AM, Keenan BJ, Wang XW & Nichols RC (2004) Posttranscriptional regulation of glucose transporter-1 by an AU-rich element in the 3¢UTR and by hnRNP A2 Biochem Biophys Res Commun 318, 977–982 Dibbens JA, Polyak SW, Damert A, Risau W, Vadas MA & Goodall GJ (2001) Nucleotide sequence of the mouse VEGF 3¢UTR and quantitative analysis of sites of polyadenylation Biochim Biophys Acta 1518, 57–62 Goodwin EC & Rottman FM (1992) The 3¢-flanking sequence of the bovine growth hormone gene contains novel elements required for efficient and accurate polyadenylation J Biol Chem 267, 16330–16334 Thomas MG, Martinez Tosar LJ, Loschi M, Pasquini JM, Correale J, Kindler S & Boccaccio GL (2005) Staufen recruitment into stress granules does not affect early mRNA transport in oligodendrocytes Mol Biol Cell 16, 405–420 Kedersha N, Stoecklin G, Ayodele M, Yacono P, Lykke-Andersen J, Fitzler MJ, Scheuner D, Kaufman RJ, Golan DE & Anderson P (2005) Stress granules and processing bodies are dynamically linked sites of mRNP remodeling J Cell Biol 169, 871–884 Mangus DA, Evans MC & Jacobson A (2003) Poly (A) -binding proteins: multifunctional scaffolds for the posttranscriptional control of gene expression Genome Biol 4, 223 Keene JD & Tenenbaum SA (2002) Eukaryotic mRNPs may represent posttranscriptional operons Mol Cell 9, 1161–1167 Iwahashi M, Yamamura M, Aita T, Okamoto A, Ueno A, Ogawa N, Akashi S, Miyake K, Godowski PJ & Makino H (2004) Expression of Toll-like receptor on CD16+ blood monocytes and synovial tissue macrophages in rheumatoid arthritis Arthritis Rheum 50, 1457–1467 Matsumoto Y, Tanaka K, Hirata G, Hanada M, Matsuda S, Shuto T & Iwamoto Y (2002) Possible involvement of the vascular endothelial growth factorFlt-1-focal adhesion kinase pathway in chemotaxis and the cell proliferation of osteoclast precursor cells in arthritic joints J Immunol 168, 5824–5831 Bakheet T, Frevel M, Williams BR, Greer W & Khabar KS (2001) ARED: human AU-rich element-containing mRNA database reveals an unexpectedly diverse func- FEBS Journal 273 (2006) 732–745 ª 2006 FEBS No claim to original US government works M Du et al 43 44 45 46 tional repertoire of encoded proteins Nucl Acids Res 29, 246–254 Levy NS, Goldberg MA & Levy AP (1997) Sequencing of the human vascular endothelial growth factor (VEGF) 3¢untranslated region (UTR): conservation of five hypoxia-inducible RNA-protein binding sites Biochim Biophys Acta 1352, 167–173 Pages G, Berra E, Milanini J, Levy AP & Pouyssegur J (2000) Stress-activated protein kinases (JNK and p38 ⁄ HOG) are essential for vascular endothelial growth factor mRNA stability J Biol Chem 275, 26484–26491 Boado RJ & Pardridge WM (2002) Glucose deprivation and hypoxia increase the expression of the GLUT1 glucose transporter via a specific mRNA-acting regulatory element Neurochemistry 80, 552–554 Tang K, Breen EC & Wagner PD (2002) Hu protein R-mediated posttranscriptional regulation of VEGF expression in rat gastrocnemius muscle Am J Physiol Heart Circ Physiol 283, 1497–1504 Post-transcriptional regulation of VEGF in macrophages 47 Sirenko OI, Lofquist AK, DeMaria CT, Morris JS, Brewer G & Haskill JS (1997) Adhesion-dependent regulation of an A+U-rich element-binding activity associated with AUF1 Mol Cell Biol 17, 3898–3906 48 Gerber HP & Ferrara N (2003) The role of VEGF in normal and neoplastic hematopoiesis J Mol Med 81, 20–31 49 Ecsedy JA, Yohe HC, Bergeron AJ & Seyfried TN (1998) Tumor-infiltrating macrophages influence the glycosphingolipid composition of murine brain tumors J Lipid Res 39, 2218–2227 50 Weihrauch D, Tessmer J, Warltier DC & Chilian WM (1998) Repetitive coronary artery occlusions induce release of growth factors into the myocardial interstitium Am J Physiol 275, H969–H976 51 Rozen S & Skaletsky H (2000) Primer3 on the WWW for general users and for biologist programmers Methods Mol Biol 132, 365–386 FEBS Journal 273 (2006) 732–745 ª 2006 FEBS No claim to original US government works 745 ... stimulation of VEGF gene expression by agents such as LPS and VEGF not act through TNFa by an autocrine mechanism Activation of VEGF gene expression in RAW-264.7 cells with LPS and VEGF was distinct from... show that the 3¢ UTR of VEGF mRNA plays a role in VEGF gene expression in mouse macrophages under in? ??ammatory conditions We have introduced the 3¢ UTR of mouse VEGF (mVEGF) into the 3¢ UTR of the... affects VEGF gene expression in macrophage cells To address this, we show here that under conditions in which VEGF protein production increases: (a) VEGF mRNA levels increased (Fig 2A); and (b) VEGF