Báo cáo khoa học: Long-term extracellular signal-related kinase activation following cadmium intoxication is negatively regulated by a protein kinase C-dependent pathway affecting cadmium transport ppt

Long-term extracellular signal-related kinase activation following cadmium intoxication is negatively regulated by a protein kinase C-dependent pathway affecting cadmium transport Patrick Martin, Kim E Boulukos, Marie C Poggi and Philippe Pognonec ´ CNRS FRE3094, Universite de Nice Sophia Antipolis, France Keywords cadmium; extracellular signal-related kinase (ERK); protein kinase C (PKC); sustained activation; ZIP8 Correspondence P Pognonec, Transcriptional Regulation and ´ Differentiation, CNRS FRE3094, Universite de Nice, Parc Valrose, 06108 Nice cedex 2, France Fax ⁄ Tel: +33 492 07 64 13 E-mail: pognonec@unice.fr (Received 16 September 2008, revised 12 December 2008, accepted 12 January 2009) doi:10.1111/j.1742-4658.2009.06899.x Extracellular signal-related kinase (ERK) is a well-known kinase taking part in a signal transduction cascade in response to extracellular stimuli ERK is generally viewed as a kinase that is rapidly and transiently phosphorylated following mitogenic stimulation This activation results in ERK phosphorylating further downstream targets, thus transmitting and amplifying the original stimulus, and ultimately resulting in the onset of cellular proliferation and ⁄ or protection against apoptosis More recently, several groups have identified a strikingly new type of ERK activation that results in cell death This activation is very different from conventional ERK activation, as it occurs several hours after the original stimulation, and results in the sustained phosphorylation of ERK, which can be observed for up to several days One way of inducing this delayed ERK activation is by lowdose cadmium treatment We show here that sustained ERK activation induced by cadmium in human kidney-derived cells is inhibited following protein kinase C (PKC) activation, even when this activation occurs hours before intoxication Furthermore, PKC inhibition results in an enhanced ERK activation in response to cadmium, even when inhibition is induced hours before intoxication PKCe appears to be the most implicated isotype in this phenomenon Finally, we present evidence suggesting that the ZIP8 transporter is involved in this process, as multiple small interfering RNAs against ZIP8 have a protective effect against cadmium treatment Our results indicate that PKC activation negatively affects ZIP8 transporter activity, thus protecting cells against cadmium poisoning Among the proteins known to play key roles in cell physiology, extracellular signal-related kinase (ERK) is one of the most widely studied Originally characterized as a protein responding to mitogenic stimulation by phosphorylation on tyrosine residues [1], ERK is a downstream substrate of the proto-oncogene Raf [2] ERK rapidly became identified as a central kinase involved in signal transduction pathways [3] ERK is predominantly viewed as a kinase responsible for cell growth [4] and ⁄ or protection against apoptosis [5] Typical ERK activation is associated with strong and rapid phosphorylation within minutes following stimulation, and with a more modest but persistent activation that can last for up to a few hours [6] More recently, a new type of ERK activity has been reported that surprisingly links ERK activation to cell death This novel function of ERK in cell death has been observed in certain cell types and organs, including Abbreviations eGFP, enhanced green fluorescent protein; ERK, extracellular signal-related kinase; GFP, green fluorescent protein; P-ERK, phosphorylated extracellular signal-related kinase; PKC, protein kinase C; PMA, 4b-phorbol 12-myristate 13-acetate; siRNA, small interfering RNA FEBS Journal 276 (2009) 1667–1679 ª 2009 The Authors Journal compilation ª 2009 FEBS 1667 Cd-induced ERK activation is inhibited by PKC P Martin et al neurons in various neurodegeneration models, brain injury resulting from ischemia–reperfusion [7–9], and myeloid leukemic cells following cisplatin chemotherapy [10] An elegant study relying on a Raf-estrogen receptor (Raf–ER) chimera also demonstrated that induced sustained ERK activation indeed results in apoptosis in vitro [11] The common point found in ERK-associated cell death appears to be an unconventional activation of ERK, which can remain phosphorylated for up to several days We recently identified another way of activating ERK-induced cell death by treating cells with cadmium [12] Low concentrations of cadmium result in a delayed but sustained phosphorylation of ERK that is ultimately accompanied by cell death, suggesting that ERK functions differ depending upon its kinetics of activation Supporting this hypothesis are earlier studies concerning proliferation versus neuronal differentiation of PC12 cells [13,14], in which the classic transient activation is linked to cell proliferation, whereas a more sustained activation (lasting for a few hours) is the trademark of differentiation Rapid, transient activation is thus associated with cell proliferation and protection against apoptosis, whereas delayed, sustained activation is associated with cell death The difference in signaling events leading to these two distinct patterns of ERK activation remains largely unexplored In this study, we began to address the molecular differences involved in rapid, transient activation versus sustained activation, following cadmium exposure To explore this, we treated cultured cells with low doses of cadmium in order to induce long-term ERK activation, as previously reported [12] We then compared this activation with that obtained after treatment with both cadmium and phorbol ester, a well-known activator of conventional and novel protein kinase Cs (PKCs) that induces transient ERK activation We show that the delayed and sustained cadmium-dependent ERK activation is strongly inhibited by concomitant treatment or pretreatment of cells with phorbol ester, and that this inhibition is associated with better cell survival Furthermore, we found that PKCe is the isotype predominantly associated with the delayed ERK activation in HEK cells Surprisingly, we show that treatment of cells with a PKC inhibitor results in an enhanced response of cells to cadmium and increased phosphorylation of ERK Thus, the sustained ERK activation observed after cadmium treatment is under the negative control of PKC We also show that this conventional PKC protective effect is probably due to a modification of the ZIP8 cadmium transporter activity Our results led us to propose a model comparing the traditional quick and transient ERK activation with the specifics of this 1668 unconventional cadmium-dependent activation, taking into account the involvement of the ZIP8 transporter in this process, as demonstrated by the protective effect of different ZIP8 small interfering RNAs (siRNAs) against cadmium intoxication Results 4b-Phorbol 12-myristate 13-acetate (PMA) protects cells from cadmium toxicity and inhibits delayed ERK activation Cell death resulting from low-dose cadmium poisoning is functionally linked to sustained ERK activation [12] As ERK is known to be efficiently and transiently activated by PKC [15], we investigated the effects of the phorbol ester PMA, a diacylglycerol analog that activates PKC isoforms, on the cell response to cadmium We found that PMA treatment paradoxically rendered cells resistant to CdCl2 (Fig 1A), as cells were dramatically protected from the toxic effects of cadmium This protective effect was readily seen 16–24 h after 0.5 and lm exposure, when intoxicated cells became rounded and started to detach from the plate, while still metabolizing as seen by 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyl-tetrazolium bromide analysis (data not shown) In contrast, PMA-cotreated cells (MTT, data not shown) remained phenotypically similar to control cells, as presented here both visually (Fig 1A) and quantitatively (Fig 1C) More than 90% of the cells became rounded following 24 h of treatment with lm CdCl2, whereas only 23% were affected in the presence of PMA When cadmium was applied in the presence of PMA, and as expected from the phenotypic observation, the absolute number of cells also remained higher than when cadmium was applied alone (see legend to Fig 1) To determine the level of cell toxicity following the different cadmium treatments used throughout this study, we measured the loss of cell integrity under these different conditions As illustrated in Fig 1C, 14% and 23% of the cells lost their integrity following 24 h of exposure to 0.5 and lm cadmium, respectively This indicates that only a small fraction of the rounded cells visible in Fig 1A lost their integrity Under the highest cadmium concentration used later in this study (20 lm cadmium for h), 9% of the cells lost their integrity after h of exposure This relatively moderate effect after h rapidly increased, as 52% of the cells became affected after h of exposure to 20 lm We next investigated whether the protective effect of PMA could affect the ERK response to CdCl2 As we previously showed that ERK activation following FEBS Journal 276 (2009) 1667–1679 ª 2009 The Authors Journal compilation ª 2009 FEBS P Martin et al Cd-induced ERK activation is inhibited by PKC A B C cadmium treatment was clearly detected after 24 h in HEK cells following exposure to lm CdCl2 [12], all ERK activation experiments were performed under these conditions As depicted in Fig 1D, PMA resulted, as expected, in the conventional early activation of ERK as seen within 15 by strong phosphorylation that progressively diminished over time to be practically undetectable 24 h later On the other hand, CdCl2 treatment resulted in the previously reported delayed activation of ERK (24 h) [12] Interestingly, when both PMA and CdCl2 were simultaneously applied to cells, early ERK activation occurred normally, but delayed ERK activation was strongly diminished This suggests that PMA treatment interferes with molecular mechanisms that participate in sustained ERK activation following CdCl2 treatment PKC isotypes implicated in cadmium-dependent delayed ERK activation are distinct from those responsible for ERK short-term activation D Fig PMA protects cells against cadmium toxicity and diminishes cadmium-induced ERK activation (A) Phenotypic observation of a PMA protective effect against cadmium toxicity HEK293 cells were cultivated and treated with 0, 0.5 or lM CdCl2 in the presence of or 100 ngỈmL)1 PMA Pictures illustrating the phenotypic modifications of the cells were taken 24 h following treatment (B) Determination of cadmium cytotoxicity on HEK293 cells HEK293 cells were treated for the indicated times with the indicated CdCl2 concentrations Loss of cell integrity was then measured as indicated in Experimental procedures The 100% value corresponds to the measurement of loss of cell integrity following total lysis of the cells with detergent (C) Graphical representation of the phenotypic modification of cells from the experiment depicted in (A) Rounded cells after PMA treatment are indicated by gray bars, and black bars represent rounded cells in the absence of PMA treatment NS, no significant difference (P > 0.05); ***highly significant (P < 0.001) Plotted values are from at least 400 counted cells for each condition, with error bars corresponding to the standard deviation from three independent counts As compared to control cells (no PMA, no Cd) set to 100%, cell numbers in the different conditions were: 0.5 lM, 81%; lM, 65%; PMA ⁄ lM, 96%; PMA ⁄ 0.5 lM, 89%; PMA ⁄ lM, 74% (D) Western blot analysis of total ERK and P-ERK HEK293 cells were treated with either lM CdCl2 (Cd), 100 ngỈmL)1 PMA (PMA) or both (PMA + Cd) for the indicated times [0 min, 15 (0.25), h (2), h (8) and day (24)] Fifteen micrograms of protein lysates was loaded onto two parallel gels, and the transferred proteins were analyzed for either P-ERK or total ERK (ERK) As PMA activates both conventional and novel PKCs, we investigated which particular isozymes are involved in the PMA protective effect reported here Three PKC isozymes are found in HEK cells: PKCa, PKCd and PKCe Using siRNA, we knocked down each of these isotypes, and followed the activation of ERK in response either to a 30 PMA treatment or to 24 h of exposure to lm CdCl2 Two prevalidated siRNAs were used for each isozyme, and gave similar results As seen in Fig 2A, we observed that PKCa knockdown had the most severe effect on the rapid and transient ERK response to PMA, whereas PKCd and PKCe knockdown had a less marked effect as compared to a control experiment using a green fluorescent protein (GFP) siRNA This result is in good agreement with a previous report [16], and demonstrates the validity of the siRNA used in our study In parallel, we monitored the activation of PKC using a pan-PKC antibody directed against the Ser657 hydrophobic site found in the C-terminal part of PKCa, which detects the three isotypes present in HEK cells, with an apparent molecular mass in the 80 kDa range The level of activated PKC matched the level of phosphorylated ERK (P-ERK) detected Interestingly, we found that in cells treated with CdCl2 (Fig 2B), PKCe had the most dramatic effect on delayed ERK activation, whereas PKCa and PKCd had more modest effects This indicates that the signal transduction cascade leading to ERK activation following CdCl2 exposure is molecularly distinct from the one resulting in shortterm ERK activation, and that PKCe is the most activated PKC isotype following cadmium exposure FEBS Journal 276 (2009) 1667–1679 ª 2009 The Authors Journal compilation ª 2009 FEBS 1669 Cd-induced ERK activation is inhibited by PKC P Martin et al from cells exposed to CdCl2, PMA or a combination of both were analyzed by western blotting to investigate the status of ERK and PKC activation As indicated in Fig 2C, the PMA-induced PKC phosphorylation became practically undetectable after 24 h [17], and strong activation of PKC was observed 24 h after CdCl2 treatment There is a clear correlation between PKC activation and ERK activation Interestingly, at least two reports have already demonstrated that 24 h of treatment with cadmium activates PKC [18,19] Our work confirms these observations, and indicates that this activation is the likely cause for the ERK cadmium-dependent delayed activation reported earlier [12] A B PMA-driven PKC activity inhibits cadmium-dependent delayed ERK activation C Fig PKCe is the predominant PKC isotype associated with cadmium response in HEK cells, in contrast to phorbol ester activation Western blot analysis of total ERK, P-ERK and activated PKCs HEK293 cells transfected 48 h earlier with siRNA against PKCa, PKCb, PKCe or GFP were treated either with (A) 100 ngỈmL)1 phorbol ester for 30 (+) or nothing ()), or with (B) lM CdCl2 for 24 h, lM CdCl2 and 100 ngỈmL)1 PMA for 24 h, or nothing Fifteen micrograms of protein lysates was loaded onto two parallel gels, and the transferred proteins were analyzed for either P-ERK and phosphorylated PKC (P-PKC), or total ERK (ERK) (C) Delayed PKC activation in response to cadmium treatment Cells treated with either lM CdCl2 for 24 h, 100 ngỈmL)1 phorbol ester for 24 h or 30 min, or nothing After lysis, 15 lg of total protein was loaded onto two parallel gels, and the transferred proteins were analyzed for either P-ERK and activated PKC (P-PKC) or total ERK (ERK) Cadmium treatment results in delayed PKC activation We found a delayed and sustained activation of ERK following CdCl2 treatment As PKC is an upstream kinase in the mitogen-activated protein kinase pathway, we investigated the possibility that CdCl2 treatment could directly affect PKC activation Lysates 1670 To determine whether the PMA protective effect requires PKC kinase function, we analyzed the effect of GF 109203X, a specific, broad-spectrum PKC inhibitor [20], on the ERK response to cadmium GF 109203X is very effective in inhibiting the ERK response, as 0.3 lm significantly reduced ERK activation following a 30 exposure of cells to PMA, whereas lm totally inhibited ERK activation (data not shown) Surprisingly, the GF 109203X effect on delayed ERK activation following cadmium exposure was a mirror image of its effect on ERK activation following PMA treatment: increasing concentrations of GF 109203X resulted in a specific and dose-dependent increase in ERK activation, which was already detectable at 0.3 lm and was maximal at lm, whereas 10 lm GF 109203X treatment in the absence of cadmium did not result in any ERK activation (Fig 3A) GF 109203X concentrations in the low micromolar range are known to be specific for PKC [20] Furthermore, we found that the effect of GF 109203X on the cell response to cadmium dominated that of PMA, as cotreatment with PMA, GF 109203X and cadmium gave results similar to those obtained with GF 109203X and cadmium (Fig and data not shown), as expected from the GF 109203X mode of action on the catalytic site of PKC [20] Finally, we found that when GF 109203X was applied up to 24 h before cadmium (Fig 3B, ‘)24’), ERK activation was also stronger than in the absence of the inhibitor, whereas the addition of the inhibitor h after cadmium treatment no longer resulted in strong ERK activation Taken together, these results suggest an inhibitory role for PKC activation in delayed ERK activation, as blocking of PKC activity resulted in increased ERK activation in response to cadmium, FEBS Journal 276 (2009) 1667–1679 ª 2009 The Authors Journal compilation ª 2009 FEBS P Martin et al Cd-induced ERK activation is inhibited by PKC A B C D Fig Pharmacological inhibition of PKC enhances delayed and sustained ERK phosphorylation, whereas PMA pretreatment reduces the ERK response to cadmium (A) Western blot analysis of P-ERK and total ERK (ERK) in HEK293 cells, following a 24 h treatment with lM CdCl2 (Cd, +) in the presence of the indicated GF 109203X concentrations (GFX, lM) Fifteen micrograms of protein lysate was loaded onto two parallel gels, and the transferred proteins were analyzed for either P-ERK or total ERK (B) Western blot analysis of P-ERK and total ERK in HEK293 cells in the presence (+) or absence ()) of lM CdCl2, and treated or not treated with lM GF 109203X 24 h before ()24), simultaneously (0) or h (+4) after cadmium addition (C) Western blot analysis of P-ERK and total ERK in HEK293 cells following no treatment (Ø), 24 h in the presence of lM CdCl2 (Cd), pretreatment with 100 ngỈmL)1 PMA for h followed by lM CdCl2 for 24 h (PMA then Cd), or treatment with 100 ngỈmL)1 PMA and lM CdCl2 for 24 h (PMA and Cd) Fifteen micrograms of protein lysate was loaded on two parallel gels, and the transferred proteins were analyzed for either P-ERK or total ERK (D) Western blot analysis of P-ERK and total ERK in HEK293 cells following treatment for min, 15 (0.25), 30 (0.5), 1, and h with 20 lM CdCl2 (20 lM Cd) or with 100 ngỈmL)1 PMA (PMA 16 h then Cd) whereas activating of PKC resulted in reduced ERK activation in response to cadmium PKC initiates a hit-and-run process resulting in cell protection against cadmium toxicity As GF 109203X enhanced ERK activation even when applied several hours before cadmium, we investigated whether PMA could also inhibit ERK activation when applied several hours before cadmium Cells were pretreated with PMA for h, and then exposed to cadmium for 24 h This resulted in strongly reduced activation of ERK as compared to treatment with cadmium alone, as shown in Fig 3C (compare ‘Cd’ to ‘PMA then Cd’) This inhibition was similar, if not stronger, than that observed when PMA and cadmium were applied simultaneously (Fig 3C, ‘PMA and Cd’) This suggests that transient PKC activation following PMA addition can occur at least h before cadmium addition, without affecting PMA inhibitory potential when CdCl2 is finally added several hours later Although the above experiment clearly demonstrates that PKC activation can occur h before cadmium addition and still inhibit delayed ERK activation, we wanted to determine whether PKC downregulation, known to occur following PMA treatment [21], participates in the ERK response to cadmium To answer this question, we needed to perform a 16 h PMA pretreatment of cells, which is known to completely downregulate PKC [21] However, our lm cadmium condition required a 24 h delay before ERK activation could be detected, which could be long enough for PKC to regain its steady-state level after these combined 40 h In order to stay within a time frame in which PKC is completely downregulated, we used a higher cadmium concentration In the presence of 20 lm cadmium, faster intracellular cadmium accumulation resulted in faster ERK activation, which was already strong after h (Fig 3D, left-hand panel), whereas cytotoxicity remained low (9%; Fig 1B) When this higher-concentration cadmium treatment was performed after a 16 h PMA pretreatment, the remaining PMA-driven ERK activation seen after 16 h was still easily detectable (Fig 3D, ‘0’ in the righthand panel), but remained unaffected by the h 20 lm cadmium treatment These results indicate that the strong inhibition of the ERK response to cadmium observed with an h pretreatment with PMA was also present when PMA was applied up to 16 h before cadmium, even with a 10-fold higher cadmium exposure As, at this time, PKC was completely downregulated, as seen by the total absence of immediate ERK activation following a second treatment with PMA (data not shown), the PMA-driven inhibition of the ERK delayed response to cadmium is likely to reflect a PKC ‘hit-and-run’ effect, whose consequences will protect cells from subsequent cadmium treatment This is confirmed by GF 109203X, which enhanced the ERK response to cadmium, even when the inhibitor was applied up to 24 h before cadmium In the PKC siRNA experiment presented in Fig 2, we nevertheless observed inhibition of ERK activation following FEBS Journal 276 (2009) 1667–1679 ª 2009 The Authors Journal compilation ª 2009 FEBS 1671 Cd-induced ERK activation is inhibited by PKC P Martin et al A B Fig Inhibition of PKC sensitizes cells to cadmium (A) Phenotypic observation of increased cellular sensibility to cadmium after PKC inhibition HEK293 cells were cultivated in DMEM and 10% fetal bovine serum (Ø), in the presence of: 2.5 lM GF 109203X (GFX); lM CdCl2 (Cd), lM CdCl2 and 2.5 lM GF 109203X (Cd GFX); 100 ngỈmL)1 PMA (PMA); lM CdCl2 and 100 ngỈmL)1 PMA (Cd P); lM CdCl2 and 100 ngỈmL)1 PMA, and 2.5 lM GF 109203X (Cd P GFX) Pictures illustrating the phenotypic modifications of the cells were taken 24 h after treatment As compared to control cells (Ø) set to 100%, cell numbers in the different conditions were: Cd, 52%; Cd GFX, 47%; GFX, 82%; PMA, 94%; Cd PMA, 63%, Cd PMA GFX, 44% (B) Graphic representation of phenotypic modifications of the cells from the experiment depicted in (A) Percentages of rounded cells are represented by black bars Plotted values are from at least 300 counted cells from each condition, with error bars corresponding to standard deviation from three different counts ***Difference highly significant (P < 0.001) Legends are as in (A) cadmium–PMA cotreatment, despite the substantial knockdown of the different active PKC isozymes It is likely that the remaining fractions of phosphorylated PKC detected were sufficient to drive the hit-and-run protective effect reported here In other words, whereas PMA treatment, which activates PKC, protects cells from cadmium-induced cell death and diminishes ERK activation, GF 109203X treatment, which completely inhibits PKC activity, results in an increased response of ERK to cadmium treatment This rules out the possibility that the PMAmediated downregulation of PKC could be responsible for the inhibition of the sustained ERK activation, and suggests that a hit-and-run process initiated by PKC activation is involved This is reinforced by the observation that the siRNA against PKCe, which was quite effective in diminishing the level of activated ERK after 24 h in the presence of cadmium (Fig 2), 1672 did not significantly protect cells from cadmium toxicity, unless PMA was applied (data not shown) Pharmaceutical inhibition of PKC renders cells hypersensitive to cadmium treatment As we have previously linked the cellular response to cadmium with sustained ERK activation, we wanted to determine the effect of GF 109203X on the morphology of cells exposed to cadmium This is illustrated in Fig 4A, where the phenotypic response of cells to cadmium was even more dramatic in the presence of GF 109203X, whereas GF 109203X alone did not result in any significant morphological modification of the cells Quantification of this experiment indicated that whereas a 24 h cadmium treatment left 12% of the cells still adhering to the culture dishes, cotreatment with cadmium and GF 109203X resulted in FEBS Journal 276 (2009) 1667–1679 ª 2009 The Authors Journal compilation ª 2009 FEBS P Martin et al Cd-induced ERK activation is inhibited by PKC virtually all of the cells floating The PMA protective effect was also substantially reduced in the presence of GF 109203X, as over 85% of the cells were rounded when treated with cadmium, PMA and GF 109203X, whereas only 25% of the cells were rounded in the presence of cadmium and PMA (Fig 4B) This indicates that PKC inhibition by GF 109203X is dominant over PMA activation, as predicted by the GF 109203X target on PKC, which is distinct from the PMA-interacting domain [20] This confirms that PKC is indeed the central actor in the observation reported here PMA downregulation of delayed ERK activation is not dependent upon protein synthesis As transient PKC activation up to 16 h before cadmium treatment inhibited delayed ERK activation, we investigated the possibility that protein synthesis could be required in the follow-up of this hit-and-run process To this end, we concomitantly treated cells with cadmium and emetine, a protein synthesis inhibitor As seen in Fig 5B, short-term ERK activation in response to a 15 PMA treatment alone was, as expected, unaffected by emetine However, in the presence of emetine, ERK activation in response to a A B Fig Blocking protein synthesis negatively affects ERK sustained activation in response to cadmium treatment, but does not affect PMA inhibitory effect (A) Western blot analysis of P-ERK and total ERK (ERK) in HEK293 cells, following a 24 h treatment with lM CdCl2 (Cd, +) in the presence of 10 lM emetine (Em, +) and 100 ngỈmL)1 PMA (PMA, +) Fifteen micrograms of protein lysate was loaded onto two parallel gels, and the transferred proteins were analyzed for either P-ERK or total ERK (B) Western blot analysis of P-ERK and total ERK in HEK293 cells, after a 10 10 lM emetine treatment (Em, +), followed by a 15 treatment with 100 ngỈmL)1 PMA (PMA, +) Fifteen micrograms of protein lysate was loaded onto two parallel gels, and the transferred proteins were analyzed for either P-ERK or total ERK 24 h cadmium treatment was substantially blunted as compared to cadmium alone (Fig 5A), as it was in the presence of PMA Interestingly, when PMA and emetine were added together, the overall ERK activation in response to cadmium was further decreased as compared to the effect of each individually The emetine effect is thus likely to represent the natural degradation of a protein involved in the cellular response to cadmium, whereas PMA treatment is still able to inhibit delayed ERK activation, but only through the remainder of the factor whose neosynthesis is blocked by emetine This strongly suggests that the PKC hitand-run action is technically independent of protein neosynthesis, but acts through a relatively unstable protein Taken together, these results suggest that whereas PMA, which mimics diacylglycerol in activating PKC, protects cells from cadmium exposure and limits the associated activation of ERK, GF 109203X has the opposite effect As the protective effect of PMA was also observed when it was applied hours before cadmium addition, we reasoned that PKC activity could participate in a process that results in the modification of a pre-existing protein, leading to protection from cadmium toxicity PKC activation results in a decrease in intracellular cadmium accumulation To determine whether PMA could directly limit cadmium entry into cells, we measured cadmium accumulation using a radioactive tracer in the presence or the absence of PMA A reduction of cadmium entry was indeed observed, as in the presence of PMA, the internal cadmium concentration was reduced by approximately 30% (Fig 6A) No significant cadmium release from cells was detected, either in the presence or in the absence of PMA (data not shown) To determine whether this reduction in cadmium accumulation caused by PMA could be sufficient to explain the protective effect observed, we incubated cells with a higher concentration of cadmium in the medium (3 lm) in the presence of PMA, and measured cadmium accumulation Despite the higher extracellular concentration of cadmium, we still obtained a 27.5 ± 7.7% reduction in the intracellular cadmium accumulation as compared to what we observed after incubation in lm cadmium alone (Fig 6B) We then compared ERK activation under these two conditions, and again found a strong correlation between a reduction in cadmium entry and ERK phosphorylation (Fig 6B, insert) Total ERK was unchanged (data not shown) This indicates that modulation of cadmium FEBS Journal 276 (2009) 1667–1679 ª 2009 The Authors Journal compilation ª 2009 FEBS 1673 Cd-induced ERK activation is inhibited by PKC A P Martin et al B C Fig Quantification of cadmium accumulation in cells (A) Comparison of intracellular cadmium accumulation from medium containing lM CdCl2 between control cells (Ø) and 100 ngỈmL)1 PMA-treated cells (PMA) Control cells are set as 100% (B) Comparison of intracellular cadmium accumulation between lM CdCl2-treated cells and lM CdCl2 + 100 ngỈmL)1 PMA-treated cells Cells treated with lM CdCl2 are set as 100% Upper part: corresponding western blot showing P-ERK activation status (C) Comparison of intracellular cadmium accumulation from medium containing lM CdCl2 between control cells (Ø), 100 ngỈmL)1-PMA treated cells (PMA), 10 lM emetine-treated cells (Em), and 100 ngỈmL)1 PMA + 10 lM emetine-treated cells (PMA + Em) Control cells are set as 100% Cells were incubated for 24 h, lysed, and counted as described in Experimental procedures **Significant difference (P < 0.01), ***highly significant difference (P < 0.001) entry following PMA treatment is likely to be the main reason for the protective effect of PMA reported here ZIP8 transporter knockdown protects cells from cadmium toxicity In parallel, and because we found that emetine also limited ERK activation by cadmium, we investigated the net effect of protein synthesis on cadmium entry into cells As shown in Fig 6C, the presence of emetine resulted in a close to 50% decrease in cadmium accumulation after a 24 h treatment This decrease in cadmium accumulation is very likely to be the direct result of the cadmium transporter(s) turnover Mathematical calculation, based on the comparison of cadmium entry measurements in the presence or in the absence of protein synthesis inhibitor, allowed us to determine that the half-life of this cadmium transporter would be 11.5 ± 1.5 h (see Experimental procedures) ZIP8 has recently been reported to be the major cadmium transporter in cells [22], and its characteristics are in perfect agreement with our previously reported observations concerning cadmium entry into HEK cells [23] Our mathematical calculation is also in excellent agreement with preliminary data from the Nebert laboratory (D W Nebert, Department of Environmental Health, University of Cincinnati, USA, personal communication), which estimates the ZIP8 half-life to be 12 ± h In order to investigate whether ZIP8 could actually be responsible for cadmium entry, we transfected HEK cells with an 1674 enhanced GFP (eGFP) bicistronic vector (PRIG [24]) expressing or not expressing (control) the ZIP8 transporter (ZIP8) Cells that were actually transfected were unambiguously traced by fluoromicroscopy (Fig 7A) We observed that after 48 h of exposure to 120 nm CdCl2, cells remained unaffected, as expected for such a low dose of cadmium, whereas cells expressing exogenous ZIP8 transporters were all rounded and displayed very weak GFP signals, reflecting the enhanced toxic effect of this very low cadmium concentration, owing to the increased number of ZIP8 transporters in these transfected cells CdCl2 at 120 nm was used in this experiment, because titration experiments indicated that it is the lowest cadmium concentration resulting in the complete phenotypic change in cells transfected with the ZIP8 expression vector (data not shown) This demonstrates that ZIP8 is indeed able to transport cadmium into cells In order to investigate the actual contribution of endogenous ZIP8 to cadmium entry into cells, we performed ZIP8 knockdown by siRNA transfection Our ZIP8 siRNA mix was first validated on cells transiently expressing a bicistronic RNA encoding ZIP8 on the first cistron, followed by GFP on the second The ZIP8 siRNA mix substantially knocked down the GFP signal, indicating that these siRNAs result in the bicistronic RNA degradation (data not shown) As shown in Fig 7B, cells cotransfected with a GFP marker and the ZIP8 siRNA and exposed to lm CdCl2 were markedly protected from cadmium intoxication as compared to cells transfected with control eGFP siRNA, or no siRNA FEBS Journal 276 (2009) 1667–1679 ª 2009 The Authors Journal compilation ª 2009 FEBS P Martin et al A B Fig ZIP8 transports cadmium into cells and plays a role in cadmium toxicity (A) HEK cells were transfected with either an eGFP-expressing control vector (Control), or a bicistronic vector expressing ZIP8 and eGFP Twenty-four hours after transfection, cells were exposed to 0.12 lM CdCl2 (0.12 lM Cd) or regular medium (No Cd) Cells were observed by epifluorescence 48 h later, and pictures were taken using the same exposure time for all conditions Only cells expressing ZIP8 and exposed to a very low cadmium concentration died, as visualized by their weak GFP signal and their rounded phenotype As compared to control transfected cell number, set to 100%, cell numbers in the different conditions were: ZIP8, 92%; 0.12 lM, 107%; ZIP8 + 0.12 lM, 28% (and all cells were rounded and weakly fluorescent) (B) Endogenous ZIP8 is involved in cadmium entry into cells Cells were transfected with an eGFP-expressing plasmid together with no siRNA, an siRNA directed against eGFP (eGFP siRNA), or an siRNA mix directed against ZIP8 After 24 h in the presence of lM CdCl2, cells were dying in both eGFP siRNA and no siRNA conditions, whereas viable cells were still present in the well containing the ZIP8 siRNA mix Exposure time was kept constant for all conditions As compared to ZIP8 siRNA mix-transfected cells, set to 100%, cell numbers in the different conditions were: eGFP siRNA, 47% (practically all cells were rounded and not fluorescent); no siRNA, 39% (practically all cells were rounded and weakly fluorescent) siRNA knockdown commonly leaves a small proportion of the protein of interest in the cells We are thus confident that our results demonstrate that ZIP8 participates in the entry of cadmium into HEK cells Cadmium accumulation in cells concomitantly treated with PMA and emetine was also investigated As shown in Fig 6C, we found that these effects were additive, as presented in Fig for the inhibition of ERK activation Whereas emetine resulted in close to Cd-induced ERK activation is inhibited by PKC a 50% decrease in cadmium accumulation, a simultaneous PMA treatment was still able to reduce cadmium accumulation by an additional 30% The simplest explanation is that PMA has a direct negative effect on cadmium transporter function Thus, independent of the quantity of transporter present in the cell, PMA treatment would always result in a 30% decrease in cadmium accumulation as compared to conditions devoid of PMA, which is in good agreement with our results of Fig 5, suggesting that the PKC hit-and-run effect is independent of protein neosynthesis To summarize, we show here that PMA-driven PKC activation inhibits sustained ERK phosphorylation observed after cadmium exposure, and protects cells from cadmium toxicity Conversely, blockage of PKC activation enhances cadmium toxicity and ERK activation This PKC effect stems from a protein neosynthesis-independent hit-and-run phenomenon that ultimately results in decreased intracellular accumulation of cadmium Finally, ZIP8 knockdown by siRNA substantially reduces cadmium toxicity, demonstrating the pivotal role of ZIP8 in cadmium intoxication Taken together, these results suggest that a PKC-driven modification of ZIP8 decreases its transporter activity, thus reducing sustained ERK activation and consequently affecting cell response to cadmium poisoning Discussion Investigation of the molecular basis of cadmium toxicity during the last decade has resulted in the characterization of multiple pathways involved in this poisoning [25] This reflects the large panel of targets affected by cadmium Kinases such as P38, ERK and Jun N-terminal kinase have been shown to play a role in this cadmium poisoning However, differences in experimental conditions, such as high cadmium concentrations applied for short periods versus low doses for extended periods, have resulted in data that are sometimes hard to reconcile [26,27] Other cellular mechanisms are also affected by cadmium The homeostasis of metals that are essential for diverse biological functions, such as calcium, zinc and iron, is disturbed by cadmium [28] Similarly, oxidative mechanisms are also perturbed by cadmium [29] The experiments presented in this article, based on exposure to low cadmium concentrations, are comparable to chronic intoxications Our results link the sustained activation of ERK following low-dose cadmium treatments to PKC function, and ultimately to the activity of the ZIP8 zinc transporter Previous work has indicated that cadmium substitutes for zinc in the regulatory domain of PKC, FEBS Journal 276 (2009) 1667–1679 ª 2009 The Authors Journal compilation ª 2009 FEBS 1675 Cd-induced ERK activation is inhibited by PKC P Martin et al resulting in its activation [30,31] Furthermore, Cd2+, which is structurally similar to Ca2+, may also substitute for calcium in the activation of PKC isoforms Calcium levels are highly and rapidly modulated in cells, but those of cadmium are not, its levels remaining stable We previously demonstrated that extracellular calcium cannot compete with cadmium for entry into cells [23] We showed here that PKC isoforms are indeed subjected to sustained activation following a 24 h cadmium treatment, leading to the delayed ERK activation reported earlier [12] As PMA pretreatment results in the rapid activation ⁄ downregulation of PKC and reduces ZIP8 activity, a cadmium effect on PKC is no longer possible, resulting in the protective effect reported here In the absence of early PKC activation ⁄ downregulation, ZIP8 is fully active, and unimpaired cadmium entry into the cell results in the progressive displacement of calcium, leading to delayed PKC activation, which itself results in sustained ERK activation, and ultimately cell death Delayed PKC activation will also diminish ZIP8 activity, but as the cells have already been exposed to cadmium, they will nevertheless undergo cell death, as cadmium does not exit intact cells Further analysis will be required to unveil the molecular mechanisms involved in the cadmium-dependent delayed PKC activation reported here The results presented here led us to propose an integrative model, which is depicted in Fig Two types of ERK activation are shown On the right side of the scheme is the early and transient ERK response to the phorbol ester PMA that is efficiently abrogated by the specific broad-spectrum PKC inhibitor GF 109203X This corresponds to the conventional mitogen-activated protein kinase cascade observed, for Fig Scheme depicting the different pathways involved in the control of sustained ERK activation Cd, CdCl2 stimulation; PMA, PMA treatment; GFX, GF 109203X treatment; Em, emetine; ZIP8, ZIP8 transporter Arrows with a minus sign indicate a repression effect, and arrows with a plus sign represent an activation process The dashed line represents an indirect process 1676 example, following growth factor stimulation On the left side of the scheme is the unconventional and sustained ERK activation, like the one observed following low-dose cadmium treatment We show here that: (a) this long-term activation relies on a molecular process under the negative control of PKC, as pharmacological inhibition of PKC results in enhanced ERK activation, whereas a transient PKC activator results in reduced ERK activation; and (b) this PKC negative control does not rely on protein neosynthesis, since even though emetine treatment diminishes ERK activation following cadmium exposure, the remaining activation is still under the negative control of PKC The negative control of PKC on sustained ERK activation in response to cadmium is confirmed by PKC inhibitor treatment Indeed, GF 109203X actually enhances ERK activation following cadmium treatment in a dose-dependent manner, whereas PKC activation by PMA diminishes this activation Interestingly, among the three predominant PKC isotypes found in HEK cells (PKCa, PKCd and PKCe), siRNA knockdown of PKCe is the most effective in diminishing sustained ERK activation following cadmium treatment, whereas, as already known, siRNA knockdown of PKCa is the most effective in diminishing classic ERK activation by PMA The observation that PKC siRNAs not increase ERK activation in response to cadmium as GF 109203X does is likely to reflect the fraction of PKC still present and functional within the cells, whereas GF 109203X completely blocks all PKC function In this article we present evidence suggesting that the protective effect of PMA is probably due to modulation of the activity of the recently identified cadmium transporter ZIP8 We calculated the half-life of the factor targeted by PMA to be 11.5 ± 1.5 h, which is in perfect agreement with the 12 ± h found for ZIP8 in the Nebert laboratory (D W Nebert, Department of Environmental Health, University of Cincinnati, USA, personal communication) We also demonstrate that ZIP8 exogenous expression is capable of enhancing cadmium toxicity, whereas ZIP8 knockdown results in a diminution of cadmium toxicity PKC has already been shown to be able to affect different transporters, either by directly modifying their activities [32,33] or by affecting their stability [34] In silico analysis of the ZIP8 structure reveals that there are three putative sites that could be phosphorylated by PKC (94-SSK-96; 361-STR-363; 424TGR-426) It will be of interest to determine whether these sites are actually phosphorylated in response to PKC activation, and whether their modification affects ZIP8 function FEBS Journal 276 (2009) 1667–1679 ª 2009 The Authors Journal compilation ª 2009 FEBS P Martin et al Experimental procedures Cell culture HEK cells were grown in DMEM complemented with 10% fetal bovine serum, in water-saturated 5% CO2 37 °C incubators Cell treatments CdCl2 was purchased from Sigma (Saint-Quentin Tallavier, France), and solubilized in de-ionized water PMA and GF 109203X were purchased from Sigma, and prepared in DMSO Cd-induced ERK activation is inhibited by PKC entering the cell is Q = Ro · t When emetine is added, it is QE = Ro · T ⁄ ln · (1)exp(ln · t ⁄ T)) After 24 h, approximatively half (53 ± 2%) of the amount of cadmium found in cells grown in the presence of cadmium is present in cells grown in the presence of emetine and cadmium Thus, Q = · QE, and Ro · t = 2Ro · T ⁄ ln · (1)exp()ln · t ⁄ T)), with t = 24 We obtain 12 · ln ⁄ T = 1)exp(ln · 24 ⁄ T) This equation results in a final value of T = 11.5 ± 1.5 h, when taking into account the error margin of intracellular cadmium accumulation measurements The inhibitory effect of 10 lm emetine on protein synthesis was validated under our conditions by the absence of GFP expression in cells transfected with peGFP-N1; control transfections with peGFP-N1 alone gave a strong GFP signal 24 h post-transfection Internal cadmium concentration measurements Cells were seeded in quadruplicate in 24-well plates at subconfluent density and treated with different compounds as indicated in the text Cadmium was traced using lm 109 Cd at 31.6 lCiỈlmol)1 for 24 h at 37 °C in 5% CO2 After incubation, floating and adherent cells were pooled, washed three times with 20 mm Hepes, (pH 7), 150 mm NaCl, and mm EGTA, and lysed in the same buffer supplemented with 0.2 m NaOH Aliquots of these lysates were counted in scintillation liquid Measured accumulated radioactivity after 24 h of culture was, at most, 7% of the initial counts present in the culture medium The protein content of each sample was determined using a Biorad DC assay (Biorad, Marnes-La-Coquette, France), and counts were standardized relative to the amount of protein of each experimental condition Cell toxicity quantification The release of adenylate kinase from damaged cells was used as a marker of cellular toxicity Adenylate kinase activity was measured from aliquots of culture media, using a bioluminescent assay, the Toxilight Bioassay, developed by Lonza (Levallois-Perret, France) As a reference for 100% lysis, control cells were lysed in 25 mm Tris (pH 7.5), 10% glycerol, and 1% Triton X-100 Half-life calculation of the transporter This was calculated by kinetic measurement of cadmium accumulation in cells cultivated in the presence of cadmium We assumed that cadmium entry is proportional to the number of transporters and that, in the presence of emetine, this number decreases following the relationship R = Ro exp()ln · t ⁄ T), where Ro is the number of transporters before emetine addition, t is the length of the incubation, and T is the half-life of the transporter When no emetine is added, the amount of cadmium Protein concentration assay The Biorad DC Protein assay was used as recommended by the manufacturer for microplate assays Briefly, 20 lL of the cell lysate was mixed with 20 lL of reagent (A + S), and 160 lL of reagent B was then added Absorbance was measured at 750 nm, and compared to the absorbance of dilutions of a protein standard to determine the protein concentration Each sample was measured in duplicate, and the concentration determination was considered valid if the variation between duplicates was < 10% Western blot analyses Cells present in the culture supernatants were collected by centrifugation (500 g, min), and added to adherent cells that were scraped off culture dishes Lysis was performed in 60 mm Tris ⁄ HCl (pH 6.8), 10% glycerol and 2% SDS, and sonication was used to disrupt genomic DNA Protein concentrations were determined by BioRad assays Equivalent amounts of proteins were loaded onto SDS ⁄ PAGE gels, separated by electrophoresis, and transferred to poly(vinylidene difluoride) membranes When both P-ERK and total ERK were analyzed, two gels were run and processed in parallel, rather than stripping and reusing the same membrane Indeed, we observed that chemiluminescence detection is associated with the appearance of a stable precipitate that interferes with the detection of the same antigen (ERK in this case) with a second antibody, even after stripping Membranes were blocked in 5% nonfat dry milk in NaCl ⁄ Tris, and antibodies were incubated at the following concentrations: ERK (Sigma M5670) rabbit polyclonal antibodies, : 20 000; phospho-ERK (Sigma M8159) mouse monoclonal antibodies, : 10 000; and phospho-PKC (Cell Signalling #9371, Danvers, MA, USA) rabbit polyclonal antibodies, : 1000 Secondary antibodies (DAKO, Trappes, France) were used at : 4000 final dilution Signals were revealed by chemiluminescence FEBS Journal 276 (2009) 1667–1679 ª 2009 The Authors Journal compilation ª 2009 FEBS 1677 Cd-induced ERK activation is inhibited by PKC P Martin et al Plasmid constructs, siRNA and DNA transfection pPRIG ZIP8 (Asu2–Ava3) was constructed by cloning the AsuII–AvaIII fragment containing the entire human ZIP8 coding sequence from pOTB7 ZIP8, obtained from Gene Service Ltd (Cambridge, UK) (clone 4650026), into the pPRIG vector [24] digested with ClaI–Sse8387I pEGFPN1 and pDSRed-N1 are from Clontech (Mountain View, CA, USA) siRNA sequences are: ZIP8 #1, accuaaagca uuaccugccaucaau; ZIP8 #2, ccgauuucaccuucuucaugauuca; ZIP8 #3, ggauuccugucagugacgauuauua; eGFPsi, gcaagcuga cccugaaguucau; PKCa #1, ccaucggauuguucuuucuucauaa; PKCa #2, gccuccauuugauggugaagaugaa; PKCd #1, ccacu acaucaagaaccaugaguuu; and PKCd #2, ccauccacaagaaaugc aucgacaa PKCe #1, PKCe #2 and PKC siRNAs are the ‘validated Stealth RNAi duo pak’ from Invitrogen (Cergy Pontoise, France) Only one of each pair is presented in Fig Both gave similar results HEK cells were transfected at 50% confluency with the calcium phosphate coprecipitation method, as described previously [35], using lg of plasmid DNA per 60 mm dish, and when used, 150 ng of siRNA Six hours after transfection, cells were passaged to multiwell plates After 24 h (ZIP8si) or 48 h (PKCsi), cells were treated as described Statistical analysis Results were analyzed for statistical significance using a one-way anova parametric test and Turkey pairwise comparisons P-values are indicated on the figures Acknowledgements We are indebted to D W Nebert (Department of Environmental Health, University of Cincinnati, USA) for exchanging unpublished data with us, and W Koch (The Beatson Institute for Cancer Research, Glasgow, UK) and P J Parker (London Research Institute, London, UK) for their advice on PKC We also thank the anonymous referee who pointed out the possible role of cadmium in a sustained PKC activation This work was supported by funding from CNRS References Cooper JA & Hunter T (1985) Major substrate for growth factor-activated protein-tyrosine kinases is a low-abundance protein Mol Cell Biol 5, 3304–3309 Wellbrock C, Karasarides M & Marais R (2004) The RAF proteins take centre stage Nat Rev Mol Cell Biol 5, 875–885 Thomas G (1992) MAP kinase by any other name smells just as sweet Cell 68, 3–6 1678 ´ Chambard J, Lefloch R, Pouyssegur J & Lenormand P (2007) ERK implication in cell cycle regulation Biochim Biophys Acta 1773, 1299–1310 Ballif BA & Blenis J (2001) Molecular mechanisms mediating mammalian mitogen-activated protein kinase (MAPK) kinase (MEK)-MAPK cell survival signals Cell Growth Differ 12, 397–408 Roovers K & Assoian RK (2000) Integrating the MAP kinase signal into the G1 phase cell cycle machinery BioEssays 22, 818–826 Cheung ECC & Slack RS (2004) Emerging role for ERK as a key regulator of neuronal apoptosis Sci STKE 2004, PE45, www.stke.org/cgi/content/full/ sigtrans;2004/251/pe45 Colucci-D’Amato L, Perrone-Capano C & di Porzio U (2003) Chronic activation of ERK and neurodegenerative diseases BioEssays 25, 1085–1095 Namura S, Iihara K, Takami S, Nagata I, Kikuchi H et al (2001) Intravenous administration of MEK inhibitor U0126 affords brain protection against forebrain ischemia and focal cerebral ischemia Proc Natl Acad Sci USA 98, 11569–11574 ´ ´ 10 Amran D, Sancho P, Fernandez C, Esteban D, Ramos ´ AM, de Blas E, Gomez M, Palacios MA & Aller P (2005) Pharmacological inhibitors of extracellular signal-regulated protein kinases attenuate the apoptotic action of cisplatin in human myeloid leukemia cells via glutathione-independent reduction in intracellular drug accumulation Biochim Biophys Acta 1743, 269– 279 11 Cagnol S, Van Obberghen-Schilling E & Chambard J (2006) Prolonged activation of ERK1,2 induces FADDindependent caspase activation and cell death Apoptosis 11, 337–346 12 Martin P, Poggi MC, Chambard JC, Boulukos KE & Pognonec P (2006) Low dose cadmium poisoning results in sustained ERK phosphorylation and caspase activation Biochem Biophys Res Commun 350, 803–807 13 Marshall CJ (1995) Specificity of receptor tyrosine kinase signaling: transient versus sustained extracellular signal-regulated kinase activation Cell 80, 179–185 14 Santos SDM, Verveer PJ & Bastiaens PIH (2007) Growth factor-induced MAPK network topology shapes Erk response determining PC-12 cell fate Nat Cell Biol 9, 324–330 15 Adams PD & Parker PJ (1991) TPA-induced activation of MAP kinase FEBS Lett 290, 77–82 16 Schonwasser DC, Marais RM, Marshall CJ & Parker ă PJ (1998) Activation of the mitogen-activated protein kinase ⁄ extracellular signal-regulated kinase pathway by conventional, novel, and atypical protein kinase C isotypes Mol Cell Biol 18, 790–798 17 Liu WS & Heckman CA (1998) The sevenfold way of PKC regulation Cell Signal 10, 529–542 FEBS Journal 276 (2009) 1667–1679 ª 2009 The Authors Journal compilation ª 2009 FEBS P Martin et al 18 Bagchi D, Bagchi M, Tang L & Stohs SJ (1997) Comparative in vitro and in vivo protein kinase C activation by selected pesticides and transition metal salts Toxicol Lett 91, 31–37 19 Long GJ (1997) The effect of cadmium on cytosolic free calcium, protein kinase C, and collagen synthesis in rat osteosarcoma (ROS 17 ⁄ 2.8) cells Toxicol Appl Pharmacol 143, 189–195 20 Toullec D, Pianetti P, Coste H, Bellevergue P, GrandPerret T et al (1991) The bisindolylmaleimide GF 109203X is a potent and selective inhibitor of protein kinase C J Biol Chem 266, 15771–15781 21 Chida K, Kato N & Kuroki T (1986) Down regulation of phorbol diester receptors by proteolytic degradation of protein kinase C in a cultured cell line of fetal rat skin keratinocytes J Biol Chem 261, 13013–13018 22 He L, Girijashanker K, Dalton TP, Reed J, Li H et al (2006) ZIP8, member of the solute-carrier-39 (SLC39) metal-transporter family: characterization of transporter properties Mol Pharmacol 70, 171–180 23 Martin P, Fareh M, Poggi MC, Boulukos KE & Pognonec P (2006) Manganese is highly effective in protecting cells from cadmium intoxication Biochem Biophys Res Commun 351, 294–299 24 Martin P, Albagli O, Poggi MC, Boulukos KE & Pognonec P (2006) Development of a new bicistronic retroviral vector with strong IRES activity BMC Biotechnol 6, 4, doi: 10.1186/1472-6750-6-4 25 Bertin G & Averbeck D (2006) Cadmium: cellular effects, modifications of biomolecules, modulation of DNA repair and genotoxic consequences (a review) Biochimie 88, 1549–1559 26 Chuang SM, Wang IC & Yang JL (2000) Roles of JNK, p38 and ERK mitogen-activated protein kinases in the growth inhibition and apoptosis induced by cadmium Carcinogenesis 21, 1423–1432 Cd-induced ERK activation is inhibited by PKC 27 Iryo Y, Matsuoka M, Wispriyono B, Sugiura T & Igisu H (2000) Involvement of the extracellular signal-regulated protein kinase (ERK) pathway in the induction of apoptosis by cadmium chloride in CCRF-CEM cells Biochem Pharmacol 60, 1875–1882 28 Martelli A, Rousselet E, Dycke C, Bouron A & Moulis J (2006) Cadmium toxicity in animal cells by interference with essential metals Biochimie 88, 1807– 1814 29 Stohs SJ & Bagchi D (1995) Oxidative mechanisms in the toxicity of metal ions Free Radic Biol Med 18, 321– 336 30 Beyersmann D, Block C & Malviya AN (1994) Effects of cadmium on nuclear protein kinase C Environ Health Perspect 102(Suppl 3), 177–180 31 Block C, Freyermuth S, Beyersmann D & Malviya AN (1992) Role of cadmium in activating nuclear protein kinase C and the enzyme binding to nuclear protein J Biol Chem 267, 19824–19828 32 Ciarimboli G, Koepsell H, Iordanova M, Gorboulev V, Durner B et al (2005) Individual PKC-phosphorylation ă sites in organic cation transporter determine substrate selectivity and transport regulation J Am Soc Nephrol 16, 1562–1570 33 Krotova KY, Zharikov SI & Block ER (2003) Classical isoforms of PKC as regulators of CAT-1 transporter activity in pulmonary artery endothelial cells Am J Physiol Lung Cell Mol Physiol 284, L1037–L1044 34 Vayro S & Silverman M (1999) PKC regulates turnover rate of rabbit intestinal Na+-glucose transporter expressed in COS-7 cells Am J Physiol 276, C1053– C1060 35 Carlotti F, Zaldumbide A, Martin P, Boulukos KE, Hoeben RC et al (2005) Development of an inducible suicide gene system based on human caspase Cancer Gene Ther 12, 627–639 FEBS Journal 276 (2009) 1667–1679 ª 2009 The Authors Journal compilation ª 2009 FEBS 1679 ... uuaccugccaucaau; ZIP8 #2, ccgauuucaccuucuucaugauuca; ZIP8 #3, ggauuccugucagugacgauuauua; eGFPsi, gcaagcuga cccugaaguucau; PKCa #1, ccaucggauuguucuuucuucauaa; PKCa #2, gccuccauuugauggugaagaugaa;... PKCd #1, ccacu acaucaagaaccaugaguuu; and PKCd #2, ccauccacaagaaaugc aucgacaa PKCe #1, PKCe #2 and PKC siRNAs are the ‘validated Stealth RNAi duo pak’ from Invitrogen (Cergy Pontoise, France) Only... in cadmium accumulation, a simultaneous PMA treatment was still able to reduce cadmium accumulation by an additional 30% The simplest explanation is that PMA has a direct negative effect on cadmium