Báo cáo khoa học: Long-term extracellular signal-related kin

Báo cáo khoa học: Long-term extracellular signal-related kinase activation following cadmium intoxication is negatively regulated by a protein kinase C-dependent pathway affecting cadmium transport ppt

... accuaaagca uuaccugccaucaau; ZIP8 #2, ccgauuucaccuucuucaugauuca; ZIP8 #3, ggauuccugucagugacgauuauua; eGFPsi, gcaagcuga cccugaaguucau; PKCa #1, ccaucggauuguucuuucuucauaa; PKCa #2, gccuccauuugauggugaagaugaa; ... gccuccauuugauggugaagaugaa; PKCd #1, ccacu acaucaagaaccaugaguuu; and PKCd #2, ccauccacaagaaaugc aucgacaa. PKCe #1, PKCe #2 and PKC siRNAs are the ‘validated Stealth RNAi duo pak’ from Inv...

Ngày tải lên : 23/03/2014, 06:20

13
331
0

Báo cáo khoa học: Puriﬁcation and structural study of the b form of human cAMP-dependent protein kinase inhibitor pdf

... vector The human PKIb coding region was ampliﬁed by PCR with oligonucleotides 5¢-CCCCATATGATGAGGACAGATT CATCAAAAATG-3¢ and 5¢-CATGGATCCTCATTTT TCTTCATTTTGAGGC-3¢. The ampliﬁed PCR fragment was inserted ... England Biolabs. DEAE Sepharose Fast Flow exchange media were obtained from Amersham Pharmacia Biotech Company. Isolation and sequencing of a cDNA clone encoding human PKIb A high qua...

Ngày tải lên : 07/03/2014, 15:20

6
531
0

Báo cáo khoa học: High levels of structural disorder in scaffold proteins as exempliﬁed by a novel neuronal protein, CASK-interactive protein1 pot

... such as Abi2. [We have also found an in vivo association and colocalization of Abi2 with Caskin1 (A. Balazs, V. Csizmok, P. Tompa, R. Udupa & L. Buday, unpublished results).] Caskin1 is a scaffold ... Ste5 scaffold allos- terically modulates signaling output of the yeast mating pathway. Science 311, 822–826. 19 Mark WY, Liao JC, Lu Y, Ayed A, Laister R, Szymc- zyna B, Chakrabartty...

Ngày tải lên : 16/03/2014, 02:20

13
408
0

Báo cáo khoa học: Acidic extracellular pH increases calcium inﬂux-triggered phospholipase D activity along with acidic sphingomyelinase activation to induce matrix metalloproteinase-9 expression in mouse metastatic melanoma pot

... phospholipase D (PLD)–mitogen-activated protein kinase (MAPK) [extracellular signal regulated kinase (ERK)1 ⁄ 2 and p38] pathway, at least in part through acidic pH e signaling through nuclear factor-jB ... Ka ¨ ha ¨ ri VM (1998) Enhance- ment of ﬁbroblast collagenase (matrix metalloproteinase-1) gene expression by ceramide is mediated by extracellular signal -regulated...

Ngày tải lên : 07/03/2014, 09:20

13
409
0

Báo cáo khoa học: Contributions to catalysis and potential interactions of the three catalytic domains in a contiguous trimeric creatine kinase doc

... enzymes were used to separate individual domains: D1, MfeI and XhoI; D2, XhoI and AatII; D3, AatII and AvrII. PCR using Ex Taq HS polymerase (Taka- ra USA, Santa Ana, CA, USA) was performed to ﬁll ... Fig. 1). Based on the above comparisons, it appears that all three FlgCK domains have the requisite elements for catalysis and are at least capable of the same types of structural interactions ....

Ngày tải lên : 16/03/2014, 06:20

9
567
0

Báo cáo khoa học: Structural studies of nucleoside analog and feedback inhibitor binding to Drosophila melanogaster multisubstrate deoxyribonucleoside kinase doc

... phos- phorylate all natural substrates and a wide range of medically important NAs with outstanding efﬁciency, as shown in Table 1 [5–9]. This makes it a very prom- ising candidate as a suicide ... in this battle is gene therapy, where a suicide gene is introduced into a malignant cell followed by the addi- tion of a NA speciﬁcally activated by the enzyme encoded by this...

Ngày tải lên : 16/03/2014, 06:20

10
308
0

Báo cáo khoa học: Identiﬁcation, characterization and activation mechanism of a tyrosine kinase of Bacillus anthracis docx

... MS, Fabiola F, Gattis JL, Somasundaram T & Chapman MS (2002) Reﬁnement of the arginine kinase transition-state analogue complex at 1.2 A resolution, mechanistic insights. Acta Crystallogr ... 625– 634. 38 Nieba L, Nieba-Axmann SE, Persson A, Ha ¨ ma ¨ la ¨ inen M, Edebratt F, Hansson A, Lidholm J, Magnusson K, Karlsson AF & Plu ¨ ckthun A (1997) BIACORE analysis of histidine-t...

Ngày tải lên : 23/03/2014, 06:20

11
407
0

Báo cáo khoa học: D1 – Extracellular Matrix Proteins docx

... Molecular Dentistry, Okayama University Graduate School of Medicine and Dentistry, Okayama, Okayama Japan, 2 Biodental Research Center, Okayama University Dental School, Okayama, Okayama Japan. E-mail: ... in macrophages via activation of the transcription factor PU.1 T. Alissaﬁ 1 , C. Tsatsanis 1 , A. Androulidaki 1 , I. Charalampopou- los 2 , E. Dermitzaki 1 , A. Gravanis 2 and A. Marg...

Ngày tải lên : 23/03/2014, 15:20

35
349
0

Báo cáo khoa học: Identiﬁcation and functional characterization of an aggregation domain in long myosin light chain kinase ppt

... 87, 2157–2161. 32 Noguchi J, Yanagisawa M, Imamura M, Kasuya Y, Sakurai T, Tanaka T & Masaki T (1992) Complete primary structure and tissue expression of chicken pec- toralis M -protein. J Biol Chem ... DA (1990) Isolation and characterization of a cDNA clone encoding avian skeletal muscle C -protein: an intracellular member of the immu- noglobulin superfamily. Proc Natl Acad Sci USA...

Ngày tải lên : 30/03/2014, 04:20

12
396
0

Tài liệu Báo cáo khoa học: Interruption of triacylglycerol synthesis in the endoplasmic reticulum is the initiating event for saturated fatty acid-induced lipotoxicity in liver cells pdf

... Horse- radish peroxidase-conjugated antibody against caspase-3 (#610325) was from BD Pharmigen, and antibody against b-actin (A5 441) was from Sigma. Statistical analysis All data are expressed as ... inhibit thapsigargin-induced Ctrl 3 h 12 h 24 h 36 h 6 h OA OA SA/OA SA/OA SA/OA SA/OA SA/OA SA OA FL1-Log Counts OA OA SA SA SA SA Ctrl Ctrl Ctrl Ctrl Ctrl SA OA SA/OA A B Fig. 5. Stearate (S...

Ngày tải lên : 14/02/2014, 22:20

12
721
0